The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	463622	544071	5225737	tRNA,transposase,tail	Escherichia_phage(26.92%)	59	NA	NA
WP_004175147.1|463622_464486_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_068814719.1|464496_465270_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.0e-26
WP_002912636.1|465511_466405_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_068814721.1|466649_468011_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	3.9e-207
WP_004175198.1|468329_469052_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_068814723.1|469048_470527_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
WP_004149057.1|470523_471939_-	MFS transporter	NA	NA	NA	NA	NA
WP_009485875.1|471940_475018_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_004149055.1|475018_478141_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_068814724.1|478140_479379_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_068814726.1|479679_480960_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_001101446.1|480991_482017_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040118527.1|482335_483259_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001101446.1|483598_484624_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021440454.1|485041_485653_-	positive transcription regulator	NA	NA	NA	NA	NA
WP_032411492.1|485768_485909_-	small membrane protein	NA	NA	NA	NA	NA
WP_000019449.1|486092_487073_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_004899452.1|487345_488047_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_068814727.1|488061_489918_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016531337.1|490206_491559_-	molecular chaperone	NA	NA	NA	NA	NA
WP_023282839.1|491696_492545_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_002912442.1|492659_493301_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.3	2.0e-36
WP_004151145.1|493391_493973_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	5.1e-31
WP_031591026.1|494003_495851_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_068814730.1|496082_497666_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	5.0e-36
WP_086910769.1|498431_499322_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.6	3.3e-45
WP_031591033.1|499714_500344_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_068814731.1|501303_502743_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_001118616.1|502873_503797_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_031591037.1|503954_505088_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_024177910.1|505093_505528_+	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_068814732.1|505544_507707_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_068814733.1|507779_509210_+	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
WP_068814736.1|509233_510697_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_023322974.1|510689_511820_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_031591043.1|511828_512923_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_159080874.1|513467_513893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549031.1|514135_515410_+|tail	phage tail protein	tail	A0A1J0MHZ5	Klebsiella_phage	46.5	1.4e-97
WP_158414492.1|515430_515592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023322969.1|516523_517675_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001118616.1|517858_518782_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_031591050.1|518886_520293_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_068814737.1|520480_521404_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	2.7e-175
WP_004180506.1|521584_523000_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_004899416.1|523021_524392_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.9	1.1e-31
WP_031589093.1|524555_525722_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_031589100.1|525914_526922_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.0	4.4e-30
WP_004144151.1|527490_527613_-	small membrane protein	NA	NA	NA	NA	NA
WP_001118616.1|527780_528704_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_001101446.1|529553_530579_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040118527.1|530897_531821_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002912373.1|534070_534838_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912371.1|534837_535578_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	24.9	1.7e-07
WP_068814743.1|535593_537489_+	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_068814745.1|537504_538659_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.7	8.5e-78
WP_031589117.1|538655_539549_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_071549005.1|539746_540670_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	9.2e-176
WP_031589124.1|541853_543062_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	39.1	4.4e-08
WP_001118616.1|543147_544071_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
>prophage 2
NZ_CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	631408	640955	5225737	transposase	Burkholderia_phage(33.33%)	9	NA	NA
WP_001118616.1|631408_632332_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_002911596.1|632511_633657_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004151461.1|634195_634477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|634519_635227_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_004200343.1|635270_636704_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.0	4.0e-101
WP_004200342.1|636684_637179_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	5.7e-31
WP_004899215.1|637153_638065_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|638248_639160_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_040183072.1|639275_640955_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	6.9e-20
>prophage 3
NZ_CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	779364	873301	5225737	protease,integrase,terminase,head,holin,transposase,plate,tail,capsid,portal	Vibrio_phage(29.11%)	114	789472:789489	844504:844521
WP_004175481.1|779364_780111_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_014343226.1|780590_781448_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_004200323.1|781603_782584_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004189318.1|782576_783377_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_004145488.1|783414_783537_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_002910764.1|784154_785096_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|785189_786179_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004200322.1|786204_787536_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|787563_788772_+	propionate kinase	NA	NA	NA	NA	NA
WP_068814843.1|788800_791095_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	1.5e-158
789472:789489	attL	GCGCGAGGAGCTGGCCGA	NA	NA	NA	NA
WP_058228726.1|791525_792641_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|792750_793665_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_068814845.1|793674_794961_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004148803.1|794957_795833_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_068814850.1|795829_796549_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|796554_797448_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|797731_799375_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|799424_799901_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|799999_800926_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175494.1|801229_802525_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_068814852.1|802539_803346_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065803155.1|803586_804849_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	94.8	1.5e-232
WP_016244760.1|804891_805137_-	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	93.4	3.8e-36
WP_029497927.1|805354_806104_-	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	60.3	2.3e-84
WP_023312753.1|806100_806325_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	60.8	1.5e-18
WP_123640128.1|806556_806778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048265752.1|806848_807142_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_159080877.1|807810_807954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068814854.1|808295_808892_-	helix-turn-helix transcriptional regulator	NA	K7P850	Enterobacteria_phage	27.1	4.1e-07
WP_048289165.1|809000_809213_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068814858.1|809233_809554_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
WP_047666494.1|809749_810004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814860.1|810000_811095_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	40.3	9.7e-31
WP_068814862.1|811121_811517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023158880.1|811516_811738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814864.1|811730_812516_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.5e-62
WP_040209280.1|813167_813431_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
WP_068814868.1|813872_814148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064161787.1|815012_815747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065520066.1|816778_817372_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	63.2	1.2e-40
WP_068814873.1|817368_818139_+	dcm methylase	NA	D5LH17	Escherichia_phage	51.2	3.0e-63
WP_077269504.1|818135_818780_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.5	1.2e-102
WP_068814875.1|818776_819376_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.9	1.1e-65
WP_068814876.1|820013_820283_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	8.1e-32
WP_068815639.1|820260_820761_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.4	5.9e-76
WP_068814877.1|820757_821249_+	hypothetical protein	NA	Q2NPG0	Xanthomonas_virus	43.9	7.4e-31
WP_068814879.1|821350_821701_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	39.7	5.5e-12
WP_032424502.1|822012_822318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549025.1|822332_822683_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	4.6e-51
WP_004884285.1|822812_823307_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_068814881.1|823303_825034_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.0	2.3e-300
WP_068814883.1|825228_826458_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.7	1.3e-201
WP_068814885.1|826444_827098_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	9.3e-106
WP_068814887.1|827112_828321_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	2.2e-193
WP_077269505.1|828347_828563_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	7.2e-07
WP_040186339.1|828559_828880_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_004899632.1|828949_829147_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	2.4e-25
WP_004899631.1|829148_829481_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	2.9e-55
WP_032437723.1|829473_830013_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	3.7e-92
WP_068814891.1|830009_830375_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.0	5.4e-63
WP_000115125.1|830431_830923_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_001177591.1|830966_831320_+|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_031591515.1|831352_831616_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	96.6	1.0e-42
WP_068814894.1|831680_832148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814896.1|832192_834637_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	61.3	1.1e-252
WP_004207036.1|834636_835107_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_068814899.1|835103_835586_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	2.1e-78
WP_064143746.1|835596_835977_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	6.9e-69
WP_159080878.1|835973_836114_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	93.3	1.8e-19
WP_048981108.1|836340_836904_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049090873.1|837085_837310_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_004114537.1|839442_840390_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	79.4	2.9e-140
WP_004114539.1|840394_840634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114541.1|840636_840924_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
WP_064355300.1|840939_841557_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	59.9	2.6e-65
WP_068814901.1|841637_842135_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	36.0	1.9e-05
WP_068814903.1|842094_842571_+	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	37.2	3.3e-12
WP_068814905.1|842567_843122_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	46.7	2.4e-38
WP_064176649.1|843118_843508_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	58.1	4.6e-36
WP_141769813.1|843516_843780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|843784_844801_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
844504:844521	attR	GCGCGAGGAGCTGGCCGA	NA	NA	NA	NA
WP_068814908.1|845296_845875_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.0	5.1e-39
WP_019704473.1|845877_846096_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	70.8	1.7e-24
WP_068814910.1|846088_846496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814912.1|846483_847089_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	1.2e-22
WP_068814914.1|847085_847316_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114566.1|847296_847599_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_004114568.1|847608_847896_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_068814916.1|847898_848174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114570.1|848163_848742_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.2	1.8e-52
WP_068814917.1|848738_850328_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.7e-199
WP_068814918.1|850327_851899_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.2	4.6e-159
WP_023301732.1|851891_852734_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	1.7e-88
WP_108676103.1|852922_853939_+	peptidase	NA	M1Q578	Vibrio_phage	49.1	3.9e-74
WP_068814921.1|853941_854841_+|head	phage head protein	head	M4MB71	Vibrio_phage	59.4	1.5e-101
WP_068814923.1|854917_855424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114585.1|855423_855864_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	4.9e-34
WP_048981146.1|855863_856406_+	phage morphogeneis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	2.9e-60
WP_068814926.1|856402_857014_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.8	1.4e-39
WP_049086219.1|857016_857226_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_068814930.1|857227_858709_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	60.2	9.6e-167
WP_068814932.1|858718_859072_+|tail	phage tail protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	34.2	7.7e-14
WP_068814934.1|859075_859459_+	hypothetical protein	NA	A0A2P9JZJ9	Alteromonadaceae_phage	40.5	3.4e-15
WP_068814936.1|859557_861366_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	31.4	3.8e-64
WP_068814938.1|861365_862622_+	multidrug DMT transporter	NA	M4M9N2	Vibrio_phage	42.0	2.2e-87
WP_068814940.1|862614_863706_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	49.0	1.3e-91
WP_068814944.1|863696_864236_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	44.4	1.1e-32
WP_068814946.1|864232_864685_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_068814950.1|864671_865748_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.0	1.0e-101
WP_068814952.1|865732_866317_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	47.7	4.8e-45
WP_068814954.1|866319_867132_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	66.7	6.9e-26
WP_068814956.1|867131_868007_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	37.0	2.2e-25
WP_068814961.1|868016_870002_+	hypothetical protein	NA	A0A1J0MHZ5	Klebsiella_phage	45.2	1.7e-126
WP_068814965.1|870367_873301_+	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
>prophage 4
NZ_CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	1423134	1434022	5225737		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1423134_1423755_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004183946.1|1423747_1425013_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|1425024_1425927_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|1426188_1426950_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_023280043.1|1426970_1427831_-	inhibitor-resistant class A broad-spectrum beta-lactamase SHV-26	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|1428128_1428389_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|1428475_1429564_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|1429594_1430860_-	MFS transporter	NA	NA	NA	NA	NA
WP_014907638.1|1430914_1434022_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 5
NZ_CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	1875504	1931943	5225737	integrase,terminase,head,transposase,plate,tail,capsid,portal,tRNA	Enterobacteria_phage(51.43%)	62	1905703:1905762	1930964:1932020
WP_002901088.1|1875504_1876005_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|1876121_1876568_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|1876551_1877343_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068815126.1|1877444_1878629_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|1878660_1879353_-	CTP synthase	NA	NA	NA	NA	NA
WP_004176547.1|1879498_1880008_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|1879994_1880351_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004190888.1|1880340_1880580_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004213128.1|1880844_1881096_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_068815128.1|1881139_1882279_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	71.3	3.2e-146
WP_068815130.1|1882433_1883606_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	3.2e-157
WP_032414481.1|1883605_1884121_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	3.7e-57
WP_004131585.1|1884166_1884484_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|1884483_1884642_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_068815132.1|1884628_1887604_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.8	9.5e-222
WP_032457467.1|1887618_1888110_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	5.6e-55
WP_068815134.1|1888425_1889913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457351.1|1890162_1891260_-|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	1.3e-11
WP_009486478.1|1891259_1891472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815136.1|1891468_1894495_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.0	1.9e-23
WP_068815138.1|1894484_1895408_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.2e-52
WP_004131573.1|1895409_1895760_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	59.3	6.2e-24
WP_068815140.1|1895756_1896344_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.0	5.9e-59
WP_068815142.1|1896340_1896976_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.4	2.3e-56
WP_068815144.1|1896972_1897440_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	2.7e-46
WP_159080880.1|1897440_1897776_-	peptidase	NA	B6SD31	Bacteriophage	33.3	1.2e-05
WP_023339943.1|1897962_1898508_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.0	6.3e-31
WP_004213110.1|1898504_1898789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|1898779_1898980_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_023339940.1|1898979_1899495_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
WP_068815146.1|1899607_1900465_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.6	9.8e-71
WP_004213107.1|1900514_1901549_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	6.2e-96
WP_068815147.1|1901558_1902398_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.7	2.5e-95
WP_068815148.1|1902554_1904282_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.6	1.5e-235
WP_050597847.1|1904275_1905337_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	67.8	4.5e-142
1905703:1905762	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAG	NA	NA	NA	NA
WP_001118616.1|1905758_1906682_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_068815150.1|1907002_1907827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815152.1|1908196_1908556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549017.1|1908805_1910545_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_068815154.1|1913244_1914261_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.7	1.5e-65
WP_068815155.1|1914534_1915101_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	7.2e-14
WP_004213098.1|1915097_1915322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213097.1|1915390_1915663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815159.1|1915678_1916056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328080.1|1916071_1916290_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|1916310_1916589_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_068815161.1|1916709_1917009_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	75.8	7.1e-37
WP_068815163.1|1917124_1918138_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	79.4	2.2e-154
WP_068815165.1|1918372_1919386_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.5	1.4e-12
WP_004150782.1|1919443_1919545_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|1919544_1919619_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|1919736_1919862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|1919921_1920185_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|1920315_1920954_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|1921043_1921958_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|1922618_1923662_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004140494.1|1923964_1925173_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_023279889.1|1925246_1927031_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_068815169.1|1927037_1927928_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|1928048_1929557_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|1929867_1930554_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001118616.1|1931019_1931943_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
1930964:1932020	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGGCCATAGCCTCCGCAACCTGACCATCGTAGTCACGCAGTGTCAGTGAACCTCCGAACAGCTGTTTTACCCGGTACATCGCCGTTTCCGCTATCGAGCGACGGTTGTAATCTGTTGTCCATTTCCACCGCGCATTACTCCCGGTCATTCGCTGATTAGCCACTGCACGGTTACGGTCTGCATATTCACCGGGCCAGTAACCCGCACCTTTTCGGGGTGGGATAAGCGCGCTGATTTTCTTACGCCGCAGTTCATCGTGACAGAGCCGGGTGTCGTAAGCGCCGTCTGCCGATGCTGCCCTGATTTTTCTGTGAGTCTGCCGGATAAGACCCGGGAAGGCTTCTGAGTCCGTCACATTGTTCAGCGACAGGTCAGCGCAGATGATTTCATGTGTTTTACTGTCAACGGCGAGATGCAGCTTACGCCAGATACGGCGGCGTTCCTGGCCATGCTTTTTGACTTTCCACTCGCCTTCACCGAAGACCTTCAGCCCGGTGGAATCAATTACCAGGTGTGCGATTTCACCCCGGGTGGGCGTTTTGAAACTGACATTAACCGACTTTGCCCGCCTGCTGACACAGCTGTAATCCGGGCAGCGTAGCGGAACGTTCATCAGAGAAAAAATGGAATCAATAAAGCCCTGCGCAGCGCGCAGGGTCAGCCTGAATACGCGTTTAATGACCAGCACAGTCGTGATGGCAAGGTCAGAATAGCGCTGAGGTCTGCCTCGTGAAGAAGGTGTTGCTGACTCATACCAGGCCTGAATAGCTTCATCATCCAGCCAGAAAGTTATGGAGCCACGGTTGATGAGGGCTTTATTGTAGGTGGGCCAGTTGGTGATTTTGAACTTTTGCTTTGCCACGGAACGGTCTGCGTTGTCGGGAAGATGCGTGATCTGATCCTTCAACTCAGCAAAAGTTCGATTTATTCAACAAAGCC	NA	NA	NA	NA
>prophage 6
NZ_CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	2183144	2192607	5225737	tRNA,protease	Bacillus_phage(16.67%)	8	NA	NA
WP_023279659.1|2183144_2184866_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.6	1.2e-14
WP_002898014.1|2184910_2185612_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2185965_2186184_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|2186303_2188583_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|2188613_2188931_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|2189256_2189478_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|2189554_2191495_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|2191491_2192607_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 7
NZ_CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	2643960	2718180	5225737	integrase,terminase,head,transposase,holin,plate,tail,capsid,portal,tRNA	Enterobacteria_phage(19.57%)	90	2699551:2699565	2724964:2724978
WP_002892491.1|2643960_2645478_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|2645809_2647285_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892486.1|2647344_2649492_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_002892484.1|2649574_2650909_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_004147422.1|2651274_2652843_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892402.1|2653135_2653408_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892400.1|2653508_2654429_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
WP_004211259.1|2654939_2655806_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004147417.1|2655828_2656854_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_023279772.1|2656855_2659291_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012068380.1|2659301_2659997_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004151792.1|2660055_2660616_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_020804404.1|2661087_2661750_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892375.1|2661727_2662033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004147414.1|2662085_2663390_-	citrate synthase	NA	NA	NA	NA	NA
WP_002892370.1|2663900_2664071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892366.1|2664149_2664551_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002892360.1|2664946_2665240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074192281.1|2665902_2666109_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.7	1.6e-08
WP_071549009.1|2667451_2668297_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_068815281.1|2668298_2670242_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_025713552.1|2670659_2670974_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	48.4	4.4e-13
WP_141769812.1|2671131_2671677_-	hypothetical protein	NA	A0A291LCK3	Klebsiella_phage	38.1	6.3e-15
WP_004176137.1|2671657_2672689_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_068815285.1|2672772_2672952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025713554.1|2673004_2673601_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	36.4	3.6e-32
WP_065954093.1|2673597_2674746_-|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	26.1	1.7e-09
WP_068815287.1|2674735_2675185_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	39.7	2.3e-15
WP_065954091.1|2675181_2675763_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_049268057.1|2675759_2676845_-|tail	tail protein	tail	Q8SBG7	Shigella_phage	30.6	1.5e-39
WP_068815289.1|2676841_2678242_-	hypothetical protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	39.1	4.0e-05
WP_068815295.1|2678288_2680142_-	hypothetical protein	NA	A0A172JGI1	Citrobacter_phage	45.3	1.8e-21
WP_047719073.1|2680283_2680562_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000896639.1|2680563_2680935_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_068815297.1|2680938_2682450_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.4	1.2e-103
WP_071549008.1|2682454_2682631_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_065954087.1|2682633_2683179_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_068815298.1|2683175_2683535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815299.1|2683539_2683920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815300.1|2683921_2684971_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	8.1e-51
WP_068815301.1|2685069_2685477_-|head	head decoration protein	head	NA	NA	NA	NA
WP_068815304.1|2685476_2686067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040210580.1|2686068_2686935_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	48.1	1.1e-48
WP_068815306.1|2686931_2688566_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.5	1.4e-89
WP_000483310.1|2688565_2688829_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_068815311.1|2688837_2690964_-|terminase	terminase	terminase	A0A0C5ABH4	Bacteriophage	34.5	6.1e-98
WP_068815313.1|2690905_2691487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065954080.1|2691748_2692387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065954079.1|2692482_2692689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068815315.1|2692922_2693312_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	1.1e-24
WP_064148680.1|2693308_2693806_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.2	2.5e-79
WP_064782731.1|2693783_2694053_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	77.2	7.4e-33
WP_068815318.1|2694596_2695280_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.8	3.4e-58
WP_009308007.1|2695276_2695417_-	YlcG family protein	NA	NA	NA	NA	NA
WP_068815320.1|2695413_2696052_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	68.4	9.2e-74
WP_068815322.1|2696044_2696713_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	80.1	2.5e-106
WP_012542614.1|2696709_2696877_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	3.5e-09
WP_068815323.1|2696857_2697325_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	3.4e-33
WP_071549007.1|2697606_2697828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077269509.1|2698008_2698857_-	DUF551 domain-containing protein	NA	A0A248SKW5	Klebsiella_phage	93.4	2.7e-49
WP_068815324.1|2698853_2699234_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.2	1.6e-62
WP_077269510.1|2699233_2700067_-	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	43.9	1.1e-26
2699551:2699565	attL	CGGCGATGCGCTGGC	NA	NA	NA	NA
WP_046181580.1|2700063_2700270_-	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	1.1e-31
WP_068815326.1|2700266_2700668_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	31.9	6.7e-06
WP_064146426.1|2700664_2700967_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068815328.1|2700963_2701812_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_068815329.1|2702975_2703296_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	67.9	6.5e-36
WP_019704103.1|2703345_2703561_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	60.9	5.5e-15
WP_068815331.1|2703660_2704293_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.5	2.0e-33
WP_008807814.1|2704729_2704936_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_068815333.1|2705017_2705302_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	78.7	9.5e-39
WP_068815335.1|2705318_2706065_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.2	7.0e-65
WP_068815338.1|2706061_2706685_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
WP_032426563.1|2706713_2707241_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	1.1e-56
WP_068815340.1|2707454_2707799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815341.1|2707791_2708469_+	morphogenetic protein	NA	H2BDG4	Pseudomonas_virus	47.4	1.7e-49
WP_040217354.1|2708465_2708693_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	43.2	1.8e-08
WP_068815344.1|2708689_2708911_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_064344914.1|2708910_2709150_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	7.8e-10
WP_071549006.1|2709162_2709498_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068815346.1|2709374_2710538_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	86.8	6.6e-203
WP_004143017.1|2710968_2711835_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_023279775.1|2711836_2712049_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|2712094_2713480_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004151319.1|2713655_2714150_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004178782.1|2714153_2714876_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004178781.1|2714983_2715322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178780.1|2715418_2715928_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004143002.1|2715924_2716992_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_068815347.1|2717103_2718180_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
2724964:2724978	attR	CGGCGATGCGCTGGC	NA	NA	NA	NA
>prophage 8
NZ_CP028953	Klebsiella pneumoniae strain AR_0141 chromosome, complete genome	5225737	2722679	2787820	5225737	transposase,tRNA,protease	Escherichia_phage(28.57%)	59	NA	NA
WP_020316413.1|2722679_2723306_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004177222.1|2723334_2724105_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012737523.1|2724163_2725018_+	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004177223.1|2725125_2725908_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_004177224.1|2725894_2726572_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.0	1.3e-22
WP_002892258.1|2726712_2727630_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004142979.1|2727626_2728085_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002892208.1|2728081_2728492_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023279233.1|2728598_2731100_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	4.7e-113
WP_004151327.1|2731231_2732026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892205.1|2732228_2732708_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002892203.1|2732813_2734466_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_004147385.1|2734735_2735956_+	MFS transporter	NA	NA	NA	NA	NA
WP_002892195.1|2736181_2737858_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_002892192.1|2737893_2739198_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_002892189.1|2739261_2740224_-	ferrochelatase	NA	NA	NA	NA	NA
WP_002892184.1|2740352_2740997_-	adenylate kinase	NA	NA	NA	NA	NA
WP_004177228.1|2741219_2743094_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	4.9e-115
WP_002892177.1|2743205_2743811_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|2743810_2744143_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004147381.1|2744200_2746108_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	3.0e-43
WP_004177230.1|2746200_2746752_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|2746902_2747280_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892142.1|2747349_2747877_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|2747889_2748063_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_023279779.1|2748130_2749030_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.6e-63
WP_004177234.1|2749065_2752413_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_002892080.1|2752542_2753193_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_004177236.1|2753335_2754529_+	multidrug efflux RND transporter periplasmic adaptor subunit AcrA	NA	NA	NA	NA	NA
WP_002892069.1|2754551_2757698_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.7	1.1e-47
WP_002892066.1|2758183_2758558_+	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_002892050.1|2758584_2758803_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_002892030.1|2758961_2759528_+	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_002892026.1|2759660_2760131_+	membrane protein	NA	NA	NA	NA	NA
WP_021313732.1|2760105_2761557_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.1	4.6e-12
WP_002892021.1|2761657_2762356_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002892018.1|2762352_2762493_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_002892011.1|2762492_2762756_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002892007.1|2762871_2763942_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.8	6.1e-70
WP_004177240.1|2764212_2765484_+	maltoporin	NA	NA	NA	NA	NA
WP_002892003.1|2765620_2765935_-	PTS transporter subunit EIIB	NA	NA	NA	NA	NA
WP_023279781.1|2765999_2768057_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_064174663.1|2768088_2769291_-	galactosidase	NA	NA	NA	NA	NA
WP_004204761.1|2769295_2770147_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279783.1|2770157_2771465_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279784.1|2771527_2772760_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_068815348.1|2773116_2774226_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.0	2.5e-26
WP_068815349.1|2774459_2776019_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002891985.1|2776053_2776326_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_023279787.1|2776490_2777354_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_068815351.1|2777398_2777995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118616.1|2778038_2778962_-|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_001101446.1|2779301_2780327_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004142688.1|2781955_2782171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004147352.1|2782167_2782425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|2783333_2784359_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001118616.1|2784698_2785622_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_071549005.1|2785923_2786847_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	9.2e-176
WP_071549004.1|2786890_2787820_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	3.5e-175
>prophage 1
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	0	10424	214704		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_015056403.1|2622_5262_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	20.5	1.9e-19
WP_015056404.1|5243_6407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015056405.1|6403_7681_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.2	1.3e-13
WP_015056406.1|7677_8793_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_068814612.1|8789_10424_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.6	1.7e-103
>prophage 2
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	15024	15576	214704		Wolbachia_phage(100.0%)	1	NA	NA
WP_013213996.1|15024_15576_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	6.2e-18
>prophage 3
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	20759	26018	214704		Virus_Rctr197k(100.0%)	1	NA	NA
WP_040224080.1|20759_26018_-	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.3	6.8e-05
>prophage 4
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	55656	59258	214704		Cronobacter_phage(25.0%)	7	NA	NA
WP_004182076.1|55656_56478_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_004182074.1|57310_57724_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|57724_58003_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|57992_58313_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_020325128.1|58393_58618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004182070.1|58628_58841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|58901_59258_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 5
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	63551	67916	214704		Emiliania_huxleyi_virus(33.33%)	4	NA	NA
WP_040224738.1|63551_65609_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	9.1e-22
WP_004182058.1|65678_65927_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004182056.1|65975_66518_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.3	9.3e-51
WP_004182054.1|67352_67916_-	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
>prophage 6
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	70998	76508	214704		Pectobacterium_phage(25.0%)	6	NA	NA
WP_023157779.1|70998_71253_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	8.8e-12
WP_004118478.1|71489_71915_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004118481.1|72434_72665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023157782.1|72898_74407_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	1.1e-24
WP_004182047.1|74811_75237_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_023157784.1|75236_76508_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	1.5e-155
>prophage 7
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	84911	93686	214704	integrase,transposase	Macacine_betaherpesvirus(50.0%)	7	75818:75832	101298:101312
75818:75832	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_004182039.1|84911_85883_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_004182032.1|85882_87049_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	4.0e-224
WP_004182030.1|87800_88811_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|89528_90269_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004182028.1|91412_92360_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	2.3e-12
WP_071527918.1|92386_92698_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004182026.1|92762_93686_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.7	7.1e-176
101298:101312	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
>prophage 8
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	98994	107498	214704	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_004178088.1|98994_100992_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|102031_103239_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|104667_105099_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|105349_106825_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|106817_107498_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
>prophage 9
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	110871	118134	214704		Leptospira_phage(33.33%)	5	NA	NA
WP_004098958.1|110871_114018_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|114104_114545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023317528.1|114671_117125_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.5	9.9e-84
WP_000843497.1|117165_117363_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004182013.1|117396_118134_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
>prophage 10
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	123227	125305	214704		Bacillus_phage(100.0%)	2	NA	NA
WP_001188930.1|123227_123908_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|123904_125305_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
>prophage 11
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	129823	130534	214704		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_085921126.1|129823_130534_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 12
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	133991	138298	214704		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_004152097.1|133991_134417_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|134429_135719_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|135766_137518_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|137535_137898_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|137947_138298_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
>prophage 13
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	142417	191834	214704	integrase,transposase	uncultured_Caudovirales_phage(37.5%)	39	172094:172110	196790:196806
WP_077253535.1|142417_143764_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|143812_144208_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_009653207.1|144396_145794_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004197671.1|146033_146312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197678.1|146646_147213_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004197675.1|147337_148981_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	25.0	1.5e-22
WP_023157975.1|149094_151542_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	69.2	6.1e-25
WP_009653212.1|151560_152994_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004099051.1|153082_154366_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004099052.1|154495_156688_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_001118616.1|157105_158029_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_022631502.1|158329_158530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706028.1|162787_163339_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	79.0	1.0e-73
WP_019706029.1|163354_165451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019706030.1|165842_166847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068814598.1|167057_170066_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_004118540.1|170226_170784_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118538.1|170915_171248_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|171601_172750_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
172094:172110	attL	GGTGGCGTGCACCCCGG	NA	NA	NA	NA
WP_021740570.1|172874_175892_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	7.2e-52
WP_004118534.1|176265_176640_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|177168_178365_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|178436_179264_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|179282_180761_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|181244_181598_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|181693_182977_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|183026_183455_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_000427614.1|184118_185123_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|185201_185759_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|185752_186124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|186120_186621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|186617_186944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|187198_187555_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|187544_187946_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|187942_188233_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000845048.1|188539_189553_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|189698_190490_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|190653_191001_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|190994_191834_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
196790:196806	attR	GGTGGCGTGCACCCCGG	NA	NA	NA	NA
>prophage 14
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	195034	197963	214704		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_000136268.1|195034_196681_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_003465059.1|196697_197063_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087809.1|197059_197296_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000904941.1|197348_197963_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
>prophage 15
NZ_CP028954	Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence	214704	211009	214290	214704	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_001201739.1|211009_211393_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|211389_211737_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|211786_213322_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_015058217.1|214080_214290_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.9	2.9e-13
>prophage 1
NZ_CP028955	Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence	134346	0	104156	134346	protease,transposase,integrase	Escherichia_phage(39.53%)	96	14182:14198	107265:107281
WP_004152379.1|6047_6773_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.8	7.1e-06
WP_004152380.1|6844_7438_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004199370.1|7604_8201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153014.1|8250_8895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152382.1|8950_9601_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_004152383.1|9597_9906_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_001067855.1|10282_10987_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001277466.1|11086_11452_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000522996.1|13182_13608_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|13635_13911_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_004200999.1|13926_14292_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
14182:14198	attL	GATCAAAACCAGCGGCC	NA	NA	NA	NA
WP_001166628.1|14363_14819_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001776119.1|15078_15606_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001776120.1|15638_16070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001776122.1|16549_17515_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_004152765.1|17984_19469_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|19877_20309_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|20308_21580_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_012600007.1|21661_22639_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|22635_23841_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|24255_24525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|24881_25748_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|26515_26773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|26830_27607_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|27603_28347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|28397_28748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|29309_29540_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|29832_30537_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001288432.1|30689_32123_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001067855.1|33009_33714_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001445937.1|34094_35051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|35235_35847_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|35900_36182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|36354_36690_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_000019450.1|36918_37899_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_004152386.1|38929_39787_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171450.1|39779_39857_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152385.1|40088_40340_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_108676127.1|40475_40838_-	endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|40877_41582_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032140899.1|43203_43446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068815678.1|43477_44128_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|44233_45433_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|45464_46349_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|46486_46879_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004199413.1|48144_51162_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_071549085.1|51294_51435_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001039463.1|51443_51830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324562.1|52581_53286_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_004201232.1|55192_55879_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_004201234.1|56016_56754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201235.1|57273_58743_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001749988.1|59499_60069_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|60461_61475_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|61630_62104_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|62324_62591_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|62733_63498_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|63758_64973_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|65006_66440_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|66821_67028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071549088.1|67032_67545_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|68346_69051_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_087759376.1|69148_70268_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
WP_022631495.1|70315_70954_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	8.3e-75
WP_004098982.1|71365_72241_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004098977.1|72865_73492_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
WP_006788217.1|73611_73791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|75669_77178_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000227969.1|77719_78796_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_020324562.1|79508_80213_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_063840321.1|80356_80911_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|81102_81807_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550555.1|81952_82243_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
WP_077625545.1|82337_82838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|82814_83519_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|83759_84464_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|86894_87899_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|88080_88257_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_022631488.1|88586_89402_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.0	4.5e-09
WP_001067855.1|89555_90260_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_009310051.1|90441_90705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058650054.1|91271_91616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338367.1|91723_92359_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016338368.1|92358_94467_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_016338369.1|94456_95734_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000754566.1|97310_97727_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261276.1|97723_97954_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004153649.1|98618_98825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|98870_99179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|99206_99536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|99603_99960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152339.1|99966_100299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|100298_101081_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_011977773.1|101972_102203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152341.1|102294_102768_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152342.1|102887_104156_-|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
107265:107281	attR	GGCCGCTGGTTTTGATC	NA	NA	NA	NA
>prophage 2
NZ_CP028955	Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence	134346	108731	124627	134346		Enterobacteria_phage(20.0%)	19	NA	NA
WP_004152345.1|108731_110759_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|110870_111086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|111310_111643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|112019_112994_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|112990_114196_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|114517_115414_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|115814_117086_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|117085_117517_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|117748_118720_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|118722_119394_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|119454_119685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|120121_120823_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|120822_121044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|121053_121473_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568044.1|121526_122294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152356.1|122973_123402_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001568046.1|123444_123951_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	4.1e-08
WP_001568047.1|123993_124185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|124372_124627_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
>prophage 3
NZ_CP028955	Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence	134346	127766	132041	134346		Vibrio_phage(33.33%)	4	NA	NA
WP_004152756.1|127766_128330_+	methyltransferase	NA	M4M9L8	Vibrio_phage	42.0	1.7e-18
WP_004152654.1|129160_129673_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
WP_004152655.1|129720_129963_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152656.1|130031_132041_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.5e-24
