The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028951	Klebsiella aerogenes strain AR_0161 chromosome, complete genome	5086051	3158386	3206457	5086051	tail,coat,holin,integrase,terminase,head	Cronobacter_phage(29.17%)	69	3161066:3161081	3212689:3212704
WP_015366242.1|3158386_3159196_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.0	6.1e-14
WP_015366243.1|3159197_3160190_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.1	1.6e-08
WP_015366244.1|3160189_3161080_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3161066:3161081	attL	GCTATCGTAGGGCATA	NA	NA	NA	NA
WP_108684185.1|3161256_3162444_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	3.5e-119
WP_108684186.1|3162743_3163571_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	25.5	5.4e-18
WP_108684187.1|3163796_3164174_-	DUF2591 family protein	NA	A0A1P8DTT2	Salmonella_phage	45.2	1.7e-19
WP_047037005.1|3164173_3164395_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	46.8	5.1e-08
WP_047076777.1|3164612_3165302_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.9	1.8e-43
WP_108684188.1|3165298_3165517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108684189.1|3165513_3166635_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	51.8	4.1e-101
WP_108684190.1|3166648_3166933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108684191.1|3166947_3167463_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	69.6	3.4e-63
WP_108684192.1|3167459_3168332_-	ATP-binding protein	NA	A0A1B1P9H8	Acinetobacter_phage	50.6	2.3e-59
WP_157844057.1|3168343_3168502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015705909.1|3168754_3168961_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	76.5	2.5e-25
WP_108684194.1|3170030_3170723_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	54.1	1.8e-59
WP_049047723.1|3170850_3171099_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	52.7	2.6e-16
WP_108684195.1|3171195_3171738_+	regulator	NA	M9NZI6	Enterobacteria_phage	86.1	7.8e-82
WP_063402628.1|3171922_3172855_+	replication protein	NA	A0A077KB11	Edwardsiella_phage	78.7	2.8e-55
WP_108684196.1|3172851_3173553_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	80.0	1.8e-102
WP_059476412.1|3173753_3174419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059476413.1|3174435_3175374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155956787.1|3175668_3175833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108684197.1|3175931_3176504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108684198.1|3176553_3176811_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	70.1	9.2e-25
WP_108684199.1|3176993_3177443_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	50.7	4.1e-36
WP_108684200.1|3177435_3177606_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	57.4	1.6e-09
WP_108684201.1|3177598_3178180_+	protein NinG	NA	E7C9S3	Salmonella_phage	50.2	1.2e-40
WP_108684202.1|3178176_3178317_+	YlcG family protein	NA	NA	NA	NA	NA
WP_108684203.1|3178313_3179003_+	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	2.8e-60
WP_108684204.1|3179249_3179846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108684205.1|3179977_3180373_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	92.4	3.9e-59
WP_108684206.1|3180359_3180665_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	90.3	6.8e-43
WP_108684207.1|3180642_3181185_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	73.2	2.3e-78
WP_108684208.1|3181181_3181457_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.2	2.4e-15
WP_073981861.1|3181446_3181602_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.6	1.0e-15
WP_047041390.1|3182227_3182512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047052335.1|3182721_3182958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126003066.1|3182995_3183178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108684209.1|3183623_3183812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015705883.1|3183815_3184418_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	81.5	4.9e-77
WP_108684210.1|3184417_3185893_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	84.7	2.5e-255
WP_108684211.1|3185903_3187370_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	61.2	9.0e-157
WP_108684212.1|3187305_3188301_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.3	9.2e-113
WP_159082604.1|3188328_3189063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108684214.1|3189124_3190513_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.0	7.7e-150
WP_108684215.1|3190516_3190957_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	64.4	1.2e-43
WP_045142324.1|3190968_3192045_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	76.8	8.6e-157
WP_048229678.1|3192054_3192456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108684216.1|3192458_3192839_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
WP_108684217.1|3192838_3193012_+	50S ribosomal protein L13	NA	Q5G8X7	Enterobacteria_phage	57.1	1.1e-13
WP_015705872.1|3193011_3193359_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	62.6	3.5e-35
WP_032708485.1|3193361_3193802_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	53.2	8.9e-36
WP_108684218.1|3193798_3194188_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	56.2	1.3e-38
WP_108684219.1|3194256_3195009_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.6	2.1e-45
WP_108684220.1|3195060_3195750_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.4	2.0e-66
WP_108684221.1|3195954_3196512_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	89.3	1.2e-88
WP_108684475.1|3196575_3196974_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	36.5	2.3e-14
WP_108684222.1|3197045_3197909_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159082605.1|3198008_3198182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108684223.1|3198252_3199233_+	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	71.3	2.7e-77
WP_063402603.1|3199341_3199746_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.1	4.5e-18
WP_108684224.1|3199806_3202158_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	49.4	4.2e-124
WP_159082606.1|3202196_3202364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063402600.1|3202360_3202534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072207328.1|3202702_3203134_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	56.1	1.1e-35
WP_108684225.1|3203130_3203601_+	DUF1833 family protein	NA	NA	NA	NA	NA
WP_108684226.1|3203597_3203987_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	48.4	4.8e-33
WP_108684227.1|3203979_3206457_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	43.9	1.3e-192
3212689:3212704	attR	GCTATCGTAGGGCATA	NA	NA	NA	NA
>prophage 1
NZ_CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	19109	62712	451422	integrase,transposase	Salmonella_phage(45.45%)	39	30751:30810	73549:73749
WP_014839933.1|19109_20243_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017900677.1|20416_20671_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_049593898.1|20757_21819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839932.1|22715_23600_-	hypothetical protein	NA	A0A1B0VDL5	Salmonella_phage	41.1	9.8e-50
WP_017900953.1|24171_24777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839931.1|25364_25706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|26034_27039_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_048336622.1|27117_30087_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_001162012.1|30089_30647_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
30751:30810	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
WP_000845039.1|30952_31966_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|32118_32859_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_048336621.1|32948_34298_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.3	3.3e-12
WP_015063357.1|35037_35370_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|35496_36051_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_010466370.1|36706_37105_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003089115.1|37179_37530_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003150552.1|37542_37818_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089113.1|37825_38038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003299771.1|38050_41044_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003089107.1|41457_41697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904941.1|41794_42409_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
WP_001087809.1|42461_42698_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_010466447.1|42694_43060_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|43076_44723_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|44719_44965_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|44967_45243_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|45258_45609_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|45680_46115_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000427619.1|46214_47219_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_058671242.1|48518_49325_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_058671243.1|49299_49626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058671244.1|49757_50528_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_058671248.1|53706_54057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032492461.1|54759_55635_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032489477.1|55767_56655_+	class A extended-spectrum beta-lactamase SFO-1	NA	A0A1B0VBP7	Salmonella_phage	74.5	7.4e-114
WP_154590091.1|58153_58318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101724151.1|58383_58566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106479266.1|58501_61387_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.8	5.4e-190
WP_001067855.1|62007_62712_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
73549:73749	attR	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGAGGGGTTGGATCCATCAGGCAACGACGGGCTGCTGCCGGCCATCAGCGGACGCAGGGAGGACTTTCCGCAACCGGCCGTTCGATGCGGCACCGATGGCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	66585	128326	451422	integrase,transposase	Escherichia_phage(22.22%)	53	61955:62014	127569:128389
61955:62014	attL	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_000971921.1|66585_67956_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|68776_69637_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001161490.1|72853_73414_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000845048.1|73750_74764_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_063840321.1|75055_75610_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|75740_76571_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|76708_77341_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|77425_77878_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|78100_78448_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|78441_79281_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_079276088.1|79778_81227_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_014839891.1|82177_83419_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.5	8.2e-10
WP_014839892.1|83446_84097_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_014839893.1|84702_85719_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	3.7e-186
WP_048336589.1|85785_85899_+	small membrane protein	NA	NA	NA	NA	NA
WP_017901082.1|85977_86547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901081.1|86737_87484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901080.1|87550_88309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024266320.1|88560_89295_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_025999330.1|89925_90525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955508.1|91496_92617_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
WP_017901237.1|94208_95747_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.8	4.1e-277
WP_032430752.1|95795_96143_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	7.7e-59
WP_004118218.1|96139_96517_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	92.1	7.1e-58
WP_011251285.1|97272_97584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011251286.1|97580_98000_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017901337.1|98069_98483_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	46.3	1.1e-19
WP_048337397.1|98528_99452_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	1.4e-176
WP_017900868.1|99600_99867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900870.1|101040_102408_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_017900871.1|102510_103272_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_017900872.1|103268_103826_+	HutD family protein	NA	NA	NA	NA	NA
WP_040238706.1|103859_105392_-	aromatic amino acid lyase	NA	NA	NA	NA	NA
WP_017900874.1|105402_106278_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014228066.1|106308_106989_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017900875.1|106991_107636_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017900876.1|107632_108730_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	37.9	7.7e-12
WP_017900877.1|109237_110914_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017900878.1|110967_112362_+	cytosine permease	NA	NA	NA	NA	NA
WP_017900879.1|112373_113582_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_017900880.1|113574_114384_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_032440835.1|115124_115532_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	3.1e-14
WP_042948515.1|116296_117220_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	3.3e-173
WP_000427623.1|120494_121499_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_108684482.1|121583_121745_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_023307212.1|121938_122691_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023307210.1|123294_124068_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023304046.1|124133_124835_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_006687059.1|124900_126007_-	alkene reductase	NA	NA	NA	NA	NA
WP_085838714.1|126219_126549_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	33.7	9.7e-11
WP_000888080.1|126578_126917_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_085838715.1|126921_127503_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|127621_128326_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
127569:128389	attR	TGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 3
NZ_CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	138938	188345	451422	transposase	Escherichia_phage(30.77%)	40	NA	NA
WP_001067855.1|138938_139643_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_106479264.1|139633_142882_+	viral (Super1) RNA helicase	NA	NA	NA	NA	NA
WP_042934506.1|143182_143776_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_042934505.1|143909_144638_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_014839905.1|144654_144960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934503.1|144973_145315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125316032.1|145378_145588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839903.1|145650_146595_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_048336588.1|146675_147197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839902.1|147193_147796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934502.1|148036_148756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934501.1|148772_149450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934526.1|149455_149932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839901.1|150122_150407_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.8	2.9e-19
WP_014839900.1|150396_150645_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_024266306.1|151310_151919_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_014839899.1|152055_152454_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_017901071.1|152827_153184_-	hypothetical protein	NA	A0A141HRY5	Bacillus_phage	40.8	2.1e-11
WP_017901072.1|153564_154359_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_106479265.1|155231_156212_-|transposase	IS5-like element ISEc68 family transposase	transposase	Q38213	Escherichia_phage	80.6	2.4e-153
WP_017901075.1|157721_158207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901076.1|158217_158550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077252861.1|160472_160586_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	3.6e-10
WP_049257520.1|160677_162249_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.9	4.2e-19
WP_106479267.1|163241_164165_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.2	3.3e-165
WP_017901321.1|164227_164653_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261275.1|164649_164880_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017901322.1|165132_167709_-	EstP	NA	NA	NA	NA	NA
WP_017901323.1|167711_169919_-	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_032437422.1|170649_171432_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.9	2.7e-136
WP_017901324.1|171428_172451_-|transposase	IS21-like element ISSen3 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	85.0	2.1e-173
WP_007372130.1|174336_174516_+	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
WP_106479263.1|176130_177099_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	1.0e-180
WP_025999313.1|178519_179002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900939.1|179277_179682_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_040238691.1|180411_181494_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	97.8	1.9e-188
WP_060591598.1|181615_184690_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.5	0.0e+00
WP_060591595.1|184741_185986_+	lactose permease	NA	NA	NA	NA	NA
WP_071527922.1|186052_186223_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_032448228.1|187268_188345_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	198384	271289	451422	protease,integrase,transposase	Enterobacteria_phage(12.5%)	57	189088:189116	279585:279613
189088:189116	attL	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_000427623.1|198384_199389_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_040238778.1|199792_200803_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_042948536.1|201040_202123_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.4	8.8e-186
WP_042948535.1|202230_205290_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.8	0.0e+00
WP_046654864.1|205341_206595_+	lactose permease	NA	NA	NA	NA	NA
WP_003846919.1|206651_206822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435793.1|207986_208313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118106.1|208393_209290_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016151338.1|209454_210531_-	dihydroorotase	NA	NA	NA	NA	NA
WP_004118110.1|210527_211784_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_004118113.1|211820_212762_-	dihydroorotate dehydrogenase	NA	A0A1V0SH91	Hokovirus	32.6	3.6e-18
WP_016151336.1|212754_213603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118116.1|213967_215224_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118118.1|215436_216702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019441.1|217070_218051_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_049129460.1|218174_218453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118092.1|218549_218810_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_029591135.1|218866_220930_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_015065566.1|221012_221432_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_047929043.1|221792_222797_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004118062.1|223143_223422_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004181742.1|223515_223728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040210113.1|224703_225018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437744.1|225260_225713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413243.1|226214_227150_-|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
WP_104471589.1|229400_230628_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	1.7e-169
WP_087728521.1|231337_232458_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	1.1e-50
WP_004026560.1|232584_233484_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
WP_016946352.1|234951_235206_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014386529.1|237280_238417_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_040238715.1|238482_238800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|238950_239274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106479262.1|239270_240029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026549.1|240025_240985_-	DNA replication protein	NA	NA	NA	NA	NA
WP_024198103.1|241027_241435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901100.1|241444_241888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003031967.1|243151_244120_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	2.8e-13
WP_025999344.1|245483_246221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901253.1|246300_246783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072096726.1|246864_247977_+	tellurite resistance domain protein	NA	NA	NA	NA	NA
WP_023288354.1|248026_249475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901256.1|249492_252561_+	virulence factor SrfB	NA	NA	NA	NA	NA
WP_017901257.1|252560_255275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901258.1|255268_256288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901259.1|256284_258252_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017901260.1|258251_258977_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.8	3.1e-17
WP_025999345.1|258966_260181_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017901262.1|260231_261800_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_017901263.1|261835_262339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032747566.1|262398_262854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901264.1|262947_264540_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	6.1e-175
WP_017901265.1|264570_264921_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	3.4e-38
WP_004189163.1|264917_265358_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004902307.1|265554_265737_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|267411_268383_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_017900945.1|268382_269549_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.9	2.2e-222
WP_017900946.1|270278_271289_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
279585:279613	attR	GGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
>prophage 5
NZ_CP028952	Klebsiella aerogenes strain AR_0161 plasmid unnamed, complete sequence	451422	275373	341382	451422	protease,transposase	Enterobacteria_phage(20.83%)	58	NA	NA
WP_032430783.1|275373_276390_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049015454.1|277968_279066_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.9	1.5e-60
WP_077253478.1|279640_280609_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	1.3e-180
WP_025999290.1|281039_281948_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_017900727.1|282335_282686_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	4.2e-20
WP_000790483.1|282829_283261_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004118652.1|283511_284987_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697968.1|284979_285660_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475503.1|285849_287235_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|287263_287617_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_017900726.1|287730_289023_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|289033_292180_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
WP_017900725.1|292266_292707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128306664.1|292804_295276_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	5.0e-83
WP_000843497.1|295316_295514_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|295547_296285_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_025999288.1|296573_297023_-	copper resistance protein	NA	NA	NA	NA	NA
WP_017900722.1|297257_299075_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|299074_299971_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|300010_300391_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_017900721.1|300395_301325_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|301379_302060_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|302056_303457_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_017900720.1|303672_304107_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_000612626.1|305494_305842_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_048337392.1|305838_306243_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.0	3.6e-68
WP_017901360.1|308746_309010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901361.1|309239_309521_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017901362.1|309554_310124_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_017901363.1|310204_313000_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	40.9	1.2e-128
WP_017901364.1|312999_313191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901365.1|313339_313678_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_017901366.1|313689_314178_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_017901367.1|314164_315127_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_064761963.1|315927_316269_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.2	3.2e-57
WP_000612626.1|316265_316613_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_106479261.1|318831_319755_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	3.0e-166
WP_023287184.1|322592_323036_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_004144067.1|323032_323503_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_032435794.1|323634_324585_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	8.1e-167
WP_072096747.1|324586_325555_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	8.5e-180
WP_017901409.1|325743_326004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322246.1|326353_327277_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	6.9e-171
WP_017901247.1|327615_328827_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_020481021.1|328913_329867_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
WP_004118155.1|330023_330872_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017901245.1|330895_331567_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901244.1|331563_332226_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017901243.1|332230_333049_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
WP_017901242.1|333045_334011_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012569499.1|334079_335060_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_106479260.1|335605_336529_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	3.3e-173
WP_017901464.1|336655_336922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017901463.1|336935_337724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026319.1|337723_338188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071600446.1|339126_339540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017901461.1|339732_340257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106479259.1|340458_341382_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	91.9	5.6e-165
