The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028926	Pasteurella multocida strain 20N chromosome, complete genome	2277636	378275	462836	2277636	portal,integrase,protease,transposase,tRNA,terminase,tail	Mannheimia_phage(19.05%)	93	416654:416704	461230:461280
WP_083003178.1|378275_378827_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_108511471.1|379328_380252_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_108511472.1|380261_381218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108512039.1|381443_381698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511473.1|381726_385620_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.4	3.8e-114
WP_005723276.1|385844_386144_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_096744033.1|386124_387123_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_096743719.1|387397_388279_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_108511474.1|388421_389855_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_083003198.1|389844_390096_-	DUF997 family protein	NA	NA	NA	NA	NA
WP_005723284.1|390178_391525_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005717446.1|391626_392088_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_096743716.1|392242_392689_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_108511475.1|392759_393773_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_108511476.1|394025_394883_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_096743714.1|394991_396245_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_095177582.1|396522_397428_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_083003207.1|397458_397722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108511477.1|397739_398363_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_108511478.1|398493_398874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096743711.1|399243_399828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108511479.1|399850_401920_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005754612.1|402055_403474_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_108511480.1|403802_405374_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_083003220.1|405506_405977_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_005717461.1|406065_406356_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	40.0	4.5e-12
WP_059246224.1|406451_408095_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.8	1.3e-188
WP_104227500.1|408229_408967_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_104227501.1|408941_409739_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_104227502.1|409740_410340_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.7	8.2e-16
WP_108511481.1|410357_411206_+	ModD protein	NA	NA	NA	NA	NA
WP_108511482.1|411305_413138_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	1.8e-53
WP_005723318.1|413245_414142_-	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_108511483.1|414225_416370_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
416654:416704	attL	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATGCAAGC	NA	NA	NA	NA
WP_108511484.1|416998_417259_-	DNA helicase UvrD	NA	A0A0M3LNN9	Mannheimia_phage	56.5	4.0e-20
WP_078737784.1|417245_417836_-	DUF4376 domain-containing protein	NA	A0A0R6PGN1	Moraxella_phage	41.5	5.6e-25
WP_108511485.1|417846_418926_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_108511486.1|418939_422587_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	36.8	1.2e-141
WP_108511487.1|422590_423316_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	39.3	3.1e-33
WP_108511488.1|423248_423962_-	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	44.6	1.6e-50
WP_108511489.1|423963_424614_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	39.7	6.3e-38
WP_108511490.1|424644_425172_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	44.8	4.6e-31
WP_108511491.1|425372_426200_-	phage antirepressor N-terminal domain-containing protein	NA	Q0H8C7	Salmonella_phage	57.4	1.2e-60
WP_159074444.1|426522_426681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511492.1|426806_427334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511493.1|427342_427933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511494.1|428014_428362_-|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	38.7	1.5e-14
WP_108511495.1|428361_430734_-|tail	phage tail length tape measure family protein	tail	H6WRV7	Salmonella_phage	29.5	5.0e-24
WP_075269217.1|430720_430981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391488.1|431043_431433_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_108511496.1|431435_431945_-|tail	phage tail protein	tail	K7P6G8	Enterobacteria_phage	52.4	6.9e-40
WP_014391486.1|431941_432349_-|tail	tail protein	tail	NA	NA	NA	NA
WP_108511497.1|432345_432897_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	44.5	2.1e-26
WP_005719722.1|432896_433190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570083.1|433182_433509_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	38.9	7.9e-13
WP_108511498.1|433579_435595_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	52.8	5.5e-189
WP_108511499.1|435530_437069_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	58.6	1.4e-157
WP_014391481.1|437065_437287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511500.1|437283_439392_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	66.2	2.2e-265
WP_061406081.1|439394_439871_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	55.6	3.8e-40
WP_016533221.1|440129_440306_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	65.5	2.9e-14
WP_108511501.1|440353_440770_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PD76	Moraxella_phage	54.3	1.2e-34
WP_108511503.1|440993_441317_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_108511504.1|441289_441820_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	51.4	4.4e-45
WP_081273045.1|441816_442113_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	50.0	4.9e-14
WP_108512040.1|442365_442812_-	antitermination protein	NA	A0A1P8DTF1	Proteus_phage	31.5	5.9e-11
WP_108511505.1|442865_443447_-	recombination protein NinG	NA	A0A0M3LTG3	Mannheimia_phage	59.5	8.7e-55
WP_108511506.1|443520_443946_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	61.5	6.6e-44
WP_108511507.1|443949_445386_-	AAA family ATPase	NA	Q7Y5V9	Haemophilus_phage	63.6	1.1e-175
WP_081273046.1|445385_446276_-	replication protein	NA	A0A0M3LQL8	Mannheimia_phage	51.2	8.6e-70
WP_108511508.1|446512_446965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064702804.1|447013_447214_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	41.3	2.6e-06
WP_064702805.1|447335_448022_+	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	3.6e-68
WP_108511509.1|448116_449079_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	29.6	5.5e-30
WP_108511510.1|449582_449813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391460.1|449825_449996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391459.1|449976_450171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108512041.1|450639_451653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108511511.1|451923_452559_+	Bro-N domain-containing protein	NA	E7DUM4	Liberibacter_phage	46.5	1.3e-24
WP_108511512.1|452643_452928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064965007.1|452914_453142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108511513.1|453488_454133_+	ribonuclease H-like domain-containing protein	NA	R9ZX90	Cellulophaga_phage	25.7	8.8e-08
WP_096742952.1|454136_454802_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	54.5	2.1e-65
WP_096742953.1|454804_455407_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	45.1	1.3e-32
WP_108511514.1|455447_455627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108511515.1|455698_456346_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	67.6	1.8e-24
WP_108511516.1|456457_456721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099821951.1|456808_457606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108511517.1|457878_458181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108511518.1|458434_459055_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	44.8	6.5e-16
WP_108511519.1|459117_459561_+	pyruvate kinase	NA	A0A0M3LPG0	Mannheimia_phage	46.1	1.2e-24
WP_108511520.1|459952_461125_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	52.3	1.9e-109
WP_104227505.1|461393_462836_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
461230:461280	attR	TGGTGGAGATAATCGGGATCGAACCGACGACCTCTTGCATGCCATGCAAGC	NA	NA	NA	NA
>prophage 2
NZ_CP028926	Pasteurella multocida strain 20N chromosome, complete genome	2277636	554897	614385	2277636	head,capsid,portal,integrase,transposase,tRNA,terminase,protease,tail	uncultured_Caudovirales_phage(36.84%)	64	552753:552768	614615:614630
552753:552768	attL	TTTATTTAATCAATTT	NA	NA	NA	NA
WP_108511554.1|554897_557480_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.0	1.2e-188
WP_104227533.1|557535_558039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083003364.1|558038_559118_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_005717609.1|559246_559513_+	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_046333762.1|559578_559980_-	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_104227535.1|560071_562759_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_108511555.1|562842_563157_-	DUF2547 family protein	NA	NA	NA	NA	NA
WP_083003370.1|563249_563555_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_108511556.1|563600_564506_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	2.3e-62
WP_108511557.1|564509_565598_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_005717623.1|565614_566142_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_108511558.1|566324_567659_-	type IV pilus secretin PilQ	NA	NA	NA	NA	NA
WP_108511559.1|567668_568031_-	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_108511560.1|568033_568558_-	ATPase	NA	NA	NA	NA	NA
WP_104884245.1|568557_569073_-	competence protein ComB	NA	NA	NA	NA	NA
WP_104227539.1|569112_569886_-	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_016534629.1|570021_572583_+	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_108511561.1|572614_574027_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_096743653.1|574138_575026_+	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_102955867.1|575028_575610_+	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_108511562.1|575771_576617_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_096743651.1|576713_578069_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_096743650.1|578156_578735_-	thymidine kinase	NA	A0A1Z1LZ42	Serratia_phage	52.1	1.8e-52
WP_005717662.1|578736_578973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104227547.1|578993_580025_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.8e-111
WP_005717672.1|580243_580459_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_104227548.1|580574_582323_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.6	1.1e-41
WP_108511563.1|582398_584267_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	4.5e-36
WP_108511564.1|584604_585555_-	transaldolase	NA	A0A127KNC6	Cyanophage	26.8	3.7e-10
WP_108511565.1|585572_586622_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_108511566.1|586634_587306_-	cyclase family protein	NA	NA	NA	NA	NA
WP_096743606.1|587316_588609_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_005718519.1|588608_589085_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_108511567.1|589138_590116_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083003419.1|590164_590620_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_005718523.1|590641_591595_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_096743605.1|591587_592448_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_108511568.1|592626_593253_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_108511569.1|593254_594259_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_108511570.1|594279_595293_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_083003433.1|595645_596635_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_046333747.1|596658_597219_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_096743604.1|597215_598496_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_108511571.1|599067_600267_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	40.6	6.3e-84
WP_108511572.1|600441_602223_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	36.4	7.7e-78
WP_108511573.1|602206_602632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511574.1|602636_602957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511575.1|602949_603165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720749.1|603157_603376_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_005720750.1|603575_603755_+	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
WP_005752847.1|603894_604098_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_108511576.1|604276_604909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511577.1|604912_605761_-|transposase	transposase	transposase	A0A0R6PHP9	Moraxella_phage	43.7	1.3e-62
WP_005720121.1|605855_606152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005720119.1|606233_606701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108511578.1|606907_608575_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	69.4	1.3e-241
WP_108511579.1|608571_608931_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	68.1	1.4e-39
WP_108511580.1|609234_609591_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	52.7	4.2e-28
WP_108511581.1|609599_609929_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	31.6	2.7e-05
WP_108512045.1|609915_610263_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	37.7	6.6e-10
WP_108511582.1|610255_611467_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	62.5	2.5e-144
WP_108511583.1|611468_612029_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	60.7	4.2e-54
WP_108511584.1|612080_613280_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	62.7	2.0e-130
WP_108511585.1|613920_614385_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	38.2	2.3e-21
614615:614630	attR	AAATTGATTAAATAAA	NA	NA	NA	NA
>prophage 3
NZ_CP028926	Pasteurella multocida strain 20N chromosome, complete genome	2277636	1152945	1161010	2277636		Escherichia_phage(66.67%)	7	NA	NA
WP_083004163.1|1152945_1153665_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.2	3.4e-16
WP_108511736.1|1153911_1156347_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.2	1.3e-224
WP_104884131.1|1156357_1156978_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.8	1.4e-71
WP_108511737.1|1156979_1157825_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	33.2	5.4e-21
WP_108511738.1|1157913_1158519_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.2	4.1e-23
WP_108511739.1|1158536_1159085_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_083004171.1|1159135_1161010_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.2	2.2e-14
>prophage 4
NZ_CP028926	Pasteurella multocida strain 20N chromosome, complete genome	2277636	1652917	1662275	2277636		Planktothrix_phage(33.33%)	9	NA	NA
WP_083005117.1|1652917_1653916_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	3.0e-15
WP_083005119.1|1653932_1654913_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	3.4e-19
WP_083005121.1|1654990_1655776_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_010906540.1|1655784_1656576_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	4.4e-17
WP_108511860.1|1656810_1658364_+	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_005724296.1|1658438_1659386_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_096743149.1|1659455_1660343_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_108511861.1|1660342_1660960_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_104227786.1|1661000_1662275_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.3	2.2e-90
