The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044978	Bacillus thuringiensis strain BT62 chromosome, complete genome	5294964	1043206	1051154	5294964		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|1043206_1043491_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|1043529_1045164_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000743909.1|1045570_1047109_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833082.1|1047493_1048819_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.1	6.4e-45
WP_000929885.1|1048963_1049665_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000719223.1|1049648_1051154_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.3	5.4e-32
>prophage 2
NZ_CP044978	Bacillus thuringiensis strain BT62 chromosome, complete genome	5294964	1096765	1105741	5294964		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|1096765_1098073_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|1098161_1098881_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|1098873_1099128_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_151909486.1|1099967_1100408_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055563.1|1100391_1102611_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.3	3.0e-164
WP_000879025.1|1102595_1104011_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|1104116_1105157_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|1105153_1105741_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP044978	Bacillus thuringiensis strain BT62 chromosome, complete genome	5294964	2459096	2475864	5294964	tail	Brevibacillus_phage(100.0%)	11	NA	NA
WP_098584586.1|2459096_2459549_+	hypothetical protein	NA	A0A0K2CP30	Brevibacillus_phage	45.8	1.9e-25
WP_000077128.1|2459548_2460637_+	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	55.8	1.2e-94
WP_084064877.1|2460869_2461340_+	DNA polymerase III subunit gamma/tau	NA	A0A0K2CPC8	Brevibacillus_phage	52.9	1.4e-34
WP_000743719.1|2461426_2461669_+	hypothetical protein	NA	A0A0K2CP74	Brevibacillus_phage	55.0	2.1e-18
WP_103622761.1|2461741_2467057_+|tail	phage tail tape measure protein	tail	A0A0K2CPN3	Brevibacillus_phage	26.3	4.4e-145
WP_000068593.1|2467115_2467733_+	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	60.7	1.4e-71
WP_001126624.1|2467735_2468809_+	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	40.3	4.1e-74
WP_098584024.1|2468821_2472013_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	50.0	3.7e-06
WP_000057630.1|2472091_2472808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000007798.1|2472822_2473263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103622760.1|2473278_2475864_+	hypothetical protein	NA	A0A0K2CPJ7	Brevibacillus_phage	43.5	2.1e-31
>prophage 4
NZ_CP044978	Bacillus thuringiensis strain BT62 chromosome, complete genome	5294964	2488834	2503399	5294964		Brevibacillus_phage(55.56%)	12	NA	NA
WP_103622756.1|2488834_2489956_+	hypothetical protein	NA	A0A0K2CPP1	Brevibacillus_phage	37.0	5.6e-66
WP_098584151.1|2489967_2490699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006916875.1|2490777_2491221_+	hypothetical protein	NA	A0A0K2CPK2	Brevibacillus_phage	40.6	2.3e-23
WP_001111326.1|2491296_2491788_+	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	55.2	2.4e-37
WP_103622755.1|2491828_2492440_+	hypothetical protein	NA	A0A127AW14	Bacillus_phage	51.0	4.9e-48
WP_103622754.1|2492424_2495319_+	halomucin	NA	A0A0K2CPP4	Brevibacillus_phage	30.4	2.2e-13
WP_103622753.1|2495361_2499717_+	DNRLRE domain-containing protein	NA	A0A127AWB0	Bacillus_phage	27.5	6.4e-25
WP_046392586.1|2500286_2500655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655295.1|2500654_2501032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098583033.1|2501231_2502239_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A127AWA8	Bacillus_phage	46.9	7.8e-11
WP_000998963.1|2502255_2502555_+	hypothetical protein	NA	A0A0K2CPL0	Brevibacillus_phage	59.3	8.5e-22
WP_000540599.1|2502574_2503399_+	hypothetical protein	NA	A7KV11	Bacillus_phage	69.4	1.4e-79
>prophage 5
NZ_CP044978	Bacillus thuringiensis strain BT62 chromosome, complete genome	5294964	2511522	2520910	5294964		Brevibacillus_phage(100.0%)	9	NA	NA
WP_000177372.1|2511522_2512230_-	DNA polymerase I	NA	A0A0K2CNW2	Brevibacillus_phage	53.5	7.3e-64
WP_000781409.1|2512398_2512803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103622750.1|2513426_2514821_-	DNA polymerase I	NA	A0A0K2CP19	Brevibacillus_phage	45.4	1.2e-102
WP_000207534.1|2514907_2515567_-	hypothetical protein	NA	A0A0K2CPH8	Brevibacillus_phage	56.9	4.7e-57
WP_001090550.1|2516032_2516590_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	41.1	2.4e-25
WP_103622749.1|2516617_2517694_-	toprim domain-containing protein	NA	A0A0K2CNW6	Brevibacillus_phage	54.3	4.5e-105
WP_098583026.1|2517718_2519011_-	DNA helicase	NA	A0A0K2CP24	Brevibacillus_phage	57.9	5.7e-139
WP_046392598.1|2519490_2520261_-	ATP-binding protein	NA	A0A0K2CNX1	Brevibacillus_phage	48.8	2.0e-62
WP_000277551.1|2520319_2520910_-	helix-turn-helix domain-containing protein	NA	A0A0K2CNS5	Brevibacillus_phage	43.4	2.3e-26
>prophage 6
NZ_CP044978	Bacillus thuringiensis strain BT62 chromosome, complete genome	5294964	2720738	2729409	5294964		Bacillus_phage(66.67%)	8	NA	NA
WP_000755525.1|2720738_2722019_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_078421567.1|2722118_2722883_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453886.1|2723123_2724884_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.4	6.3e-274
WP_000612413.1|2724969_2725647_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	2.5e-122
WP_001231631.1|2725643_2726717_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.5	3.9e-186
WP_061457074.1|2726741_2727329_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_061457075.1|2727526_2728246_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_061457076.1|2728536_2729409_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
>prophage 7
NZ_CP044978	Bacillus thuringiensis strain BT62 chromosome, complete genome	5294964	5169892	5177578	5294964		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221062.1|5169892_5170816_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.0e-45
WP_103622286.1|5170941_5171877_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.7	1.2e-21
WP_000018059.1|5171878_5172571_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.0e-06
WP_001014310.1|5172913_5173108_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001235507.1|5173146_5174346_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	3.6e-71
WP_103622285.1|5174641_5174965_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086126.1|5175037_5175802_-	class B sortase	NA	NA	NA	NA	NA
WP_000403758.1|5175834_5176605_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	3.7e-13
WP_001036848.1|5176594_5177578_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
>prophage 1
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	0	29178	561791	transposase	Vibrio_phage(33.33%)	20	NA	NA
WP_088346495.1|1409_2126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088362543.1|4629_5154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088362542.1|5157_6822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070984.1|6818_7181_-	DUF3958 domain-containing protein	NA	NA	NA	NA	NA
WP_025689740.1|7249_7522_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
WP_107992310.1|8514_8688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103622618.1|8691_9345_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_103622620.1|11317_13666_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_103622621.1|13827_15069_+	MFS transporter	NA	NA	NA	NA	NA
WP_103622622.1|15105_15456_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_103622623.1|15452_17918_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_103622624.1|18328_18538_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_103622625.1|19373_20021_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_107992325.1|20505_21012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240398.1|21299_21518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103622626.1|22102_23389_+	amino acid permease	NA	NA	NA	NA	NA
WP_000654819.1|23372_23969_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	V9LZQ4	Vibrio_phage	32.0	1.2e-06
WP_151909500.1|24224_24626_+|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	71.0	2.6e-50
WP_001245414.1|26051_26525_+	DUF1203 domain-containing protein	NA	NA	NA	NA	NA
WP_088363307.1|27564_29178_+	SH3 domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.9	5.1e-44
>prophage 2
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	32825	37288	561791		Bacillus_phage(50.0%)	7	NA	NA
WP_088363305.1|32825_33200_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	45.8	4.2e-26
WP_103621946.1|33249_33762_-	damage repair protein	NA	O64031	Bacillus_phage	45.0	6.3e-33
WP_103621945.1|34348_35440_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	50.1	6.6e-96
WP_000725639.1|35439_35598_+	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_070184225.1|35787_36582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002182105.1|36604_36844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043944.1|37015_37288_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	9.7e-25
>prophage 3
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	50777	51203	561791		Streptococcus_phage(100.0%)	1	NA	NA
WP_103621936.1|50777_51203_+	HD domain-containing protein	NA	A0A060QNR4	Streptococcus_phage	63.4	2.1e-37
>prophage 4
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	55750	56842	561791		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_103621932.1|55750_56842_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	46.9	2.3e-88
>prophage 5
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	62126	63650	561791		Liberibacter_phage(100.0%)	1	NA	NA
WP_103621927.1|62126_63650_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	29.3	1.5e-53
>prophage 6
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	82733	83443	561791		Clostridium_phage(50.0%)	2	NA	NA
WP_103621916.1|82733_83093_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WFJ2	Clostridium_phage	44.8	3.2e-15
WP_001033047.1|83245_83443_+	helix-turn-helix domain-containing protein	NA	A0A142LP09	Marinitoga_camini_virus	44.1	9.5e-06
>prophage 7
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	99877	102433	561791		Catovirus(100.0%)	1	NA	NA
WP_103621906.1|99877_102433_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.1	2.9e-09
>prophage 8
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	108444	108771	561791		Lactobacillus_phage(100.0%)	1	NA	NA
WP_103621902.1|108444_108771_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	36.6	4.8e-10
>prophage 9
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	114654	122253	561791		Tupanvirus(100.0%)	1	NA	NA
WP_103621897.1|114654_122253_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.7	4.3e-162
>prophage 10
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	132181	133987	561791		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_103621888.1|132181_133987_+	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	29.1	5.0e-16
>prophage 11
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	139030	142111	561791		Aureococcus_anophage(50.0%)	2	NA	NA
WP_103621885.1|139030_141115_+	ATP-binding cassette domain-containing protein	NA	A0A076FI99	Aureococcus_anophage	25.7	9.5e-19
WP_103621884.1|141205_142111_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	40.8	3.7e-44
>prophage 12
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	147065	148166	561791		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_103622157.1|147065_148166_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.8	3.8e-83
>prophage 13
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	164521	165286	561791		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_103622997.1|164521_165286_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.0e-23
>prophage 14
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	169738	170812	561791		Faustovirus(100.0%)	1	NA	NA
WP_103622996.1|169738_170812_+	patatin-like phospholipase family protein	NA	A0A0H3TN97	Faustovirus	28.4	1.8e-29
>prophage 15
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	177886	192158	561791	integrase,transposase	Bacillus_phage(60.0%)	11	172732:172752	204845:204865
172732:172752	attL	CCATCAAGCTAAGATTTTAAA	NA	NA	NA	NA
WP_151909503.1|177886_179008_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	8.9e-173
WP_103621664.1|179425_180427_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_103621665.1|180830_182003_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	5.2e-06
WP_103621666.1|182465_183113_-	YukJ family protein	NA	NA	NA	NA	NA
WP_103621667.1|183653_185396_+	S8 family serine peptidase	NA	A0A1V0S9L2	Catovirus	28.3	7.2e-12
WP_103621668.1|185529_185712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103621669.1|186873_187839_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	53.6	6.9e-81
WP_103621670.1|188324_189077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103621671.1|189250_190123_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_000573033.1|190368_190602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103621672.1|190790_192158_+	S8 family serine peptidase	NA	Q2A0D0	Sodalis_phage	26.0	3.6e-19
204845:204865	attR	CCATCAAGCTAAGATTTTAAA	NA	NA	NA	NA
>prophage 16
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	206023	209204	561791		Geobacillus_virus(50.0%)	2	NA	NA
WP_103621522.1|206023_206857_-	peptidase M15	NA	A0A0H3V0Q8	Geobacillus_virus	47.1	8.1e-30
WP_103621521.1|207416_209204_+	peptidoglycan-binding protein	NA	A0A2L0HNW5	Microbacterium_phage	30.8	9.3e-07
>prophage 17
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	213384	216932	561791		Tetraselmis_virus(50.0%)	2	NA	NA
WP_103621518.1|213384_214347_-	endonuclease I	NA	A0A2P0VMP9	Tetraselmis_virus	31.6	5.5e-14
WP_103621517.1|215969_216932_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	58.0	1.5e-91
>prophage 18
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	219992	223980	561791		Brevibacillus_phage(50.0%)	4	NA	NA
WP_103621514.1|219992_221066_-	tyrosine recombinase XerS	NA	A0A0K2CP59	Brevibacillus_phage	25.1	3.9e-08
WP_103621513.1|222264_222516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103621512.1|223151_223598_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_103621511.1|223743_223980_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A125RQ76	Bacillus_phage	94.4	4.2e-32
>prophage 19
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	247173	251171	561791	integrase,transposase	Bacillus_phage(50.0%)	4	237327:237343	262597:262613
237327:237343	attL	ATAATTTTTTCTTTATT	NA	NA	NA	NA
WP_103621496.1|247173_247494_+	TM2 domain-containing protein	NA	A0A127AZ85	Bacillus_phage	39.8	2.7e-10
WP_151909504.1|247902_249024_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.5	1.5e-172
WP_103621967.1|249447_249732_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.0	2.1e-09
WP_103621966.1|249743_251171_-	MBL fold metallo-hydrolase	NA	H8ZJP5	Ostreococcus_tauri_virus	36.7	7.0e-05
262597:262613	attR	ATAATTTTTTCTTTATT	NA	NA	NA	NA
>prophage 20
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	256991	260411	561791		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_103621963.1|256991_258107_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	55.5	2.8e-110
WP_142391011.1|258428_260411_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.3	1.9e-13
>prophage 21
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	266491	267481	561791		Salmonella_phage(100.0%)	1	NA	NA
WP_103621956.1|266491_267481_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	32.4	2.8e-05
>prophage 22
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	279527	280460	561791		Staphylococcus_phage(100.0%)	1	NA	NA
WP_103621753.1|279527_280460_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.6e-45
>prophage 23
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	289651	325639	561791		Paenibacillus_phage(66.67%)	8	NA	NA
WP_103621762.1|289651_290239_-	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	31.7	2.2e-05
WP_103621763.1|291829_292363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103621764.1|292430_296102_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	38.3	2.9e-55
WP_142390996.1|296124_300939_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.0	4.0e-105
WP_103621766.1|300851_302681_-	hypothetical protein	NA	D0R7J2	Paenibacillus_phage	28.2	1.2e-22
WP_151909505.1|302765_304913_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_151909506.1|304893_311052_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	27.9	9.6e-35
WP_151909507.1|311071_325639_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.7	3.4e-38
>prophage 24
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	329768	331865	561791		Paenibacillus_phage(100.0%)	1	NA	NA
WP_151909511.1|329768_331865_-	hypothetical protein	NA	D0R7J2	Paenibacillus_phage	30.4	3.3e-35
>prophage 25
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	341705	357728	561791		Paenibacillus_phage(66.67%)	6	NA	NA
WP_151909512.1|341705_349649_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.9	2.9e-36
WP_151909513.1|349593_349911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151909514.1|349805_350333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151909515.1|350382_356094_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.9	1.8e-35
WP_103621797.1|356097_356931_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_103621796.1|356927_357728_-	alpha/beta fold hydrolase	NA	A0A023W6C9	Mycobacterium_phage	32.0	4.6e-06
>prophage 26
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	366238	366877	561791		Clostridioides_phage(100.0%)	1	NA	NA
WP_103621790.1|366238_366877_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.1	2.3e-24
>prophage 27
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	375141	379442	561791		Streptococcus_phage(50.0%)	2	NA	NA
WP_103622732.1|375141_376533_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.3	7.0e-26
WP_103622731.1|377948_379442_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.3	1.1e-82
>prophage 28
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	384793	385072	561791		Paenibacillus_phage(100.0%)	1	NA	NA
WP_088363541.1|384793_385072_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.4	1.9e-12
>prophage 29
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	394845	401848	561791		Bacillus_phage(20.0%)	6	NA	NA
WP_103622527.1|394845_396111_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.1	7.9e-101
WP_000063576.1|396107_396449_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	32.1	1.8e-07
WP_001161879.1|396495_396909_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	50.4	3.4e-29
WP_000998210.1|397224_397677_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_103622528.1|397681_400939_-	hypothetical protein	NA	A0A2I7SCU7	Paenibacillus_phage	30.4	1.4e-32
WP_103622529.1|401302_401848_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	46.1	2.0e-37
>prophage 30
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	405237	406374	561791		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_033689567.1|405237_406374_-	aspartate phosphatase	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	41.3	1.6e-73
>prophage 31
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	412208	412631	561791		Bacillus_phage(100.0%)	1	NA	NA
WP_103622535.1|412208_412631_-	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	77.9	3.8e-60
>prophage 32
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	431489	437751	561791		Bacillus_phage(66.67%)	6	NA	NA
WP_103621807.1|431489_431765_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	49.4	2.7e-14
WP_103621808.1|432755_433235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103621809.1|433324_433708_-	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	46.5	4.0e-24
WP_103621810.1|434566_434866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107992312.1|435758_435944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103621811.1|436449_437751_+	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	54.7	1.1e-89
>prophage 33
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	497969	499619	561791		Bacillus_phage(100.0%)	1	NA	NA
WP_103622359.1|497969_499619_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	24.1	1.6e-08
>prophage 34
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	504081	504804	561791		Synechococcus_phage(100.0%)	1	NA	NA
WP_103622363.1|504081_504804_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3ELR0	Synechococcus_phage	41.0	9.5e-43
>prophage 35
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	512074	520231	561791	tRNA	Enterobacteria_phage(25.0%)	6	NA	NA
WP_103622369.1|512074_512953_+	NAD(P)-dependent oxidoreductase	NA	A0A140G5S6	Enterobacteria_phage	24.1	1.6e-12
WP_103622370.1|512949_514251_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	32.5	4.2e-41
WP_103622371.1|514377_515592_+	MFS transporter	NA	A0A1B0RXA6	Streptococcus_phage	24.0	3.1e-14
WP_103622372.1|515657_517427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103622373.1|517447_517759_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_103622374.1|517777_520231_+|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	31.2	3.9e-80
>prophage 36
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	524182	524398	561791		Bacillus_phage(100.0%)	1	NA	NA
WP_001167047.1|524182_524398_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.7	3.7e-19
>prophage 37
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	527463	535461	561791	transposase	uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_103622379.1|527463_528345_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.7	9.5e-45
WP_086388116.1|530831_531926_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	3.4e-92
WP_098236842.1|532257_532515_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_103622380.1|532735_534106_+	M23 family metallopeptidase	NA	D7RWE0	Brochothrix_phage	42.6	4.3e-20
WP_103622381.1|534714_535461_+	AAA family ATPase	NA	A0A2H4J4U1	uncultured_Caudovirales_phage	38.9	5.4e-33
>prophage 38
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	543048	548171	561791		Bacillus_phage(33.33%)	5	NA	NA
WP_103622602.1|543048_544824_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.8	1.5e-44
WP_103622603.1|544816_545128_+	PqqD family protein	NA	NA	NA	NA	NA
WP_103622604.1|545120_545513_+	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_103622605.1|545512_547348_+	asparagine synthetase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	25.5	2.8e-14
WP_103622606.1|547424_548171_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	4.3e-30
>prophage 39
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	552116	555735	561791	protease	Tupanvirus(50.0%)	5	NA	NA
WP_103622609.1|552116_553058_-|protease	zinc metalloprotease	protease	A0A2K9KZL9	Tupanvirus	33.7	2.6e-24
WP_103622610.1|553140_553332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103622611.1|553346_554270_-	Zn-dependent exopeptidase M28	NA	NA	NA	NA	NA
WP_103622612.1|554846_555533_-	YukJ family protein	NA	NA	NA	NA	NA
WP_103622627.1|555624_555735_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	85.7	8.7e-09
>prophage 40
NZ_CP044979	Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence	561791	561004	561721	561791		Bacillus_phage(100.0%)	1	NA	NA
WP_103622616.1|561004_561721_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	3.8e-36
