The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028716	Klebsiella pneumoniae strain SCM96 chromosome, complete genome	5398745	2403951	2413414	5398745	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|2403951_2405067_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|2405063_2407004_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|2407080_2407302_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|2407627_2407945_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|2407975_2410255_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|2410374_2410593_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|2410946_2411648_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_020323882.1|2411692_2413414_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
>prophage 2
NZ_CP028716	Klebsiella pneumoniae strain SCM96 chromosome, complete genome	5398745	2669107	2738253	5398745	terminase,plate,tRNA,head,capsid,tail,portal,integrase	Enterobacteria_phage(51.35%)	80	2696300:2696321	2733009:2733030
WP_004150803.1|2669107_2670214_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2670270_2670729_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2670745_2671396_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2671636_2672887_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_020324087.1|2673159_2673873_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|2673869_2674262_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150797.1|2674254_2674578_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004140530.1|2675027_2675255_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_020324096.1|2675367_2676561_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022631258.1|2676628_2676964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|2677183_2677369_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|2677459_2677954_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_094615866.1|2677980_2678487_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|2678503_2679391_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|2679446_2680853_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|2680849_2681860_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_020324075.1|2681972_2682170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|2682736_2683369_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_153933029.1|2683347_2683536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2683985_2684672_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094615865.1|2684982_2686491_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|2686611_2687502_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020324097.1|2687508_2689293_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|2689366_2690575_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|2690877_2691921_+	type II asparaginase	NA	NA	NA	NA	NA
WP_008807690.1|2692582_2693497_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
WP_020324076.1|2693586_2694225_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004190891.1|2694355_2694619_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2694678_2694804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|2694921_2694996_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2694995_2695097_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|2695154_2696168_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
2696300:2696321	attL	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
WP_004216842.1|2696432_2697416_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004213095.1|2697531_2697831_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_020806130.1|2697951_2698230_+	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004216643.1|2698250_2698469_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020324119.1|2698484_2698862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|2698877_2699141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324115.1|2699218_2699443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408797.1|2699439_2700006_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324116.1|2700238_2701174_+	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_020324090.1|2701211_2703359_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324106.1|2703616_2705563_+	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_020324074.1|2705555_2706563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324107.1|2707484_2708237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044816202.1|2708713_2709775_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020324092.1|2709768_2711496_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_020324109.1|2711652_2712492_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324085.1|2712502_2713537_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324091.1|2713586_2714453_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324071.1|2714557_2715073_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_004131559.1|2715072_2715273_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324103.1|2715263_2715548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324098.1|2715544_2716090_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_157833084.1|2716276_2716612_+	peptidase	NA	B6SD31	Bacteriophage	33.3	4.3e-06
WP_020324102.1|2716612_2717080_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_020324118.1|2717076_2717712_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_009486481.1|2717708_2718296_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324083.1|2718292_2718643_+	lysozyme	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_020324110.1|2718644_2719568_+|plate	baseplate J-like protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020806131.1|2719557_2722584_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324108.1|2722580_2722793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324070.1|2722792_2723890_+|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324073.1|2724043_2725402_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_032408799.1|2725646_2726138_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_020324072.1|2726153_2729129_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
WP_032440702.1|2729115_2729274_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_004131585.1|2729273_2729591_-	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_004216461.1|2729636_2730152_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_020324084.1|2730151_2731324_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_020324077.1|2731478_2732618_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_004213128.1|2732661_2732913_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004179368.1|2733177_2733417_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
2733009:2733030	attR	AAAAAAAGCCCCGTCGGGGGCG	NA	NA	NA	NA
WP_004150779.1|2733406_2733763_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150778.1|2733749_2734259_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004179371.1|2734404_2735097_+	CTP synthase	NA	NA	NA	NA	NA
WP_004148041.1|2735128_2736313_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_002901073.1|2736414_2737206_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2737189_2737636_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004179374.1|2737752_2738253_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP028716	Klebsiella pneumoniae strain SCM96 chromosome, complete genome	5398745	2834694	2904881	5398745	terminase,transposase,holin,tail,protease,integrase	Klebsiella_phage(21.28%)	78	2840125:2840141	2888151:2888167
WP_002901758.1|2834694_2835741_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|2835788_2836040_-	YciN family protein	NA	NA	NA	NA	NA
WP_004179471.1|2836446_2839044_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.4	3.7e-89
WP_002901772.1|2839389_2840364_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
2840125:2840141	attL	ATGGCGGTGGATCCGGT	NA	NA	NA	NA
WP_002901776.1|2840609_2840777_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_004179474.1|2841165_2843838_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|2843884_2844487_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|2844650_2845418_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|2845553_2845862_+	LapA family protein	NA	NA	NA	NA	NA
WP_004140292.1|2845868_2847038_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|2847229_2847967_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|2847966_2848293_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151906.1|2848424_2848646_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|2848918_2849668_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|2849739_2849919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179478.1|2850077_2852012_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	5.4e-08
WP_020324875.1|2852093_2853251_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|2853441_2854230_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004196433.1|2854428_2854971_-	HutD family protein	NA	NA	NA	NA	NA
WP_004148125.1|2855167_2856598_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|2856642_2857452_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2857453_2858446_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2858445_2859336_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004892753.1|2859512_2860700_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
WP_022631172.1|2860920_2861160_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_022631173.1|2861200_2862310_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
WP_022631174.1|2862322_2865472_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	56.5	7.8e-291
WP_022631175.1|2865609_2865765_-	DNA breaking-rejoining protein	NA	K7PGY4	Enterobacteria_phage	71.2	1.5e-14
WP_020804303.1|2865773_2865965_-	YebW family protein	NA	NA	NA	NA	NA
WP_022631176.1|2866071_2866170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631177.1|2866261_2866570_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_071784507.1|2866796_2867153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071784508.1|2867249_2867513_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_022631179.1|2867515_2868052_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	69.5	4.4e-61
WP_022631181.1|2868180_2868975_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.3	6.3e-64
WP_032408811.1|2869040_2869880_+	hypothetical protein	NA	Q8HA96	Salmonella_phage	53.1	2.3e-24
WP_022631183.1|2869882_2870632_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	80.3	3.0e-116
WP_022631184.1|2870639_2871008_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	44.3	6.4e-11
WP_022631185.1|2871004_2871208_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	3.7e-29
WP_086538002.1|2871690_2872734_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_022631188.1|2872723_2873566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343760.1|2874210_2875431_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_022631487.1|2875492_2875726_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	67.5	7.0e-24
WP_022631486.1|2875803_2876025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631485.1|2876082_2876682_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.7e-90
WP_031281243.1|2876890_2877187_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	1.7e-35
WP_004190680.1|2877183_2877552_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
WP_022631482.1|2877548_2878331_+	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	2.9e-114
WP_031281242.1|2878484_2878742_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_064159469.1|2878647_2879094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031281240.1|2879707_2880007_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_004184488.1|2880003_2880543_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_004190674.1|2880539_2880884_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2880880_2881156_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|2882114_2882360_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|2883222_2884227_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_022631478.1|2884204_2885512_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	5.2e-148
WP_022631477.1|2885511_2886912_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	9.2e-127
WP_022631476.1|2886895_2888008_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.2	4.8e-110
WP_016946679.1|2888092_2888878_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
2888151:2888167	attR	ATGGCGGTGGATCCGGT	NA	NA	NA	NA
WP_022631475.1|2888888_2889842_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	2.5e-131
WP_124724672.1|2889850_2890123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807837.1|2890163_2890559_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_004190649.1|2890560_2890815_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190646.1|2890824_2891058_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|2891044_2891428_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_008807839.1|2891429_2891981_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_004190640.1|2891977_2892370_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_022631474.1|2892393_2893566_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190637.1|2893619_2894102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631473.1|2894239_2894437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086621259.1|2894550_2895024_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	57.4	4.6e-22
WP_022631471.1|2895115_2898016_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	5.2e-100
WP_004190622.1|2898015_2898480_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
WP_022631470.1|2898660_2899143_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.2	1.1e-82
WP_022631469.1|2899152_2899533_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	2.4e-69
WP_022631468.1|2899529_2902604_+	kinase	NA	A0A286S259	Klebsiella_phage	96.7	0.0e+00
WP_022631464.1|2902679_2904881_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	38.0	4.4e-99
>prophage 4
NZ_CP028716	Klebsiella pneumoniae strain SCM96 chromosome, complete genome	5398745	3192243	3203130	5398745		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|3192243_3192864_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004179748.1|3192856_3194122_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002903955.1|3194133_3195036_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|3195296_3196058_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004179754.1|3196078_3196939_-	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_004176262.1|3197236_3197497_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179755.1|3197583_3198672_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176258.1|3198702_3199968_-	MFS transporter	NA	NA	NA	NA	NA
WP_004179756.1|3200022_3203130_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 5
NZ_CP028716	Klebsiella pneumoniae strain SCM96 chromosome, complete genome	5398745	4251798	4258703	5398745	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|4251798_4253277_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|4253273_4253996_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_032421568.1|4254314_4255676_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	6.7e-207
WP_002912636.1|4255921_4256815_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_040027268.1|4257055_4257829_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|4257839_4258703_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 6
NZ_CP028716	Klebsiella pneumoniae strain SCM96 chromosome, complete genome	5398745	4663774	4742318	5398745	terminase,plate,transposase,lysis,tail,tRNA,head,capsid,portal,integrase	Salmonella_phage(73.47%)	85	4708656:4708702	4744599:4744645
WP_002914079.1|4663774_4664512_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4664643_4665975_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_004180937.1|4666020_4666404_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4666716_4667406_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4667463_4668549_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4668752_4669178_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4669247_4669946_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_020324863.1|4669980_4672632_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_004180947.1|4672752_4674108_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4674149_4674473_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_020324862.1|4674476_4675772_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.0e-42
WP_004150973.1|4681928_4684502_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_004180948.1|4684631_4685363_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4685359_4686340_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4686471_4687209_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4687479_4687815_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4687921_4687969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4688069_4689230_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_004174805.1|4689226_4690099_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4690161_4691283_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4691292_4692363_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4692705_4693215_+	YfiR family protein	NA	NA	NA	NA	NA
WP_004180950.1|4693207_4694431_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004145671.1|4694444_4694927_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004180951.1|4694935_4696306_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4696362_4696821_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4696940_4697288_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4697327_4698095_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004180952.1|4698126_4698675_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4698693_4698942_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4699201_4700566_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4700729_4701521_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4701540_4702827_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4702946_4703537_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4703661_4704540_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004180954.1|4704626_4706288_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914160.1|4706435_4706777_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145682.1|4706843_4707134_-	RnfH family protein	NA	NA	NA	NA	NA
WP_031281023.1|4707123_4707600_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4707710_4708193_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4708656:4708702	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_022631377.1|4708796_4709174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631378.1|4709201_4709420_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.1e-26
WP_020323978.1|4709486_4710584_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.7	1.6e-174
WP_020323988.1|4710580_4711066_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	9.1e-58
WP_020324005.1|4711062_4713690_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	3.9e-118
WP_002896220.1|4713682_4713802_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_020324018.1|4713816_4714116_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	2.8e-33
WP_002896201.1|4714168_4714684_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_020323990.1|4714693_4715866_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	9.5e-210
WP_020324016.1|4716013_4717177_-|tail	tail fiber protein	tail	Q37842	Escherichia_phage	54.3	2.6e-50
WP_020324004.1|4717204_4717423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323992.1|4717423_4719532_-	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	39.6	7.4e-112
WP_031281025.1|4719537_4720134_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	61.3	4.3e-57
WP_020324006.1|4720123_4721032_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.9	4.9e-105
WP_020323996.1|4721018_4721381_-	lysozyme	NA	A0A1S6KZZ4	Salmonella_phage	83.9	2.9e-48
WP_020323981.1|4721377_4721950_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.8	1.6e-77
WP_020323986.1|4722018_4722465_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.0	2.5e-54
WP_002896172.1|4722457_4722889_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_020323995.1|4722984_4723413_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
WP_020323982.1|4723409_4723793_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
WP_020323999.1|4723797_4724307_-	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	1.2e-81
WP_004144702.1|4724287_4724503_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_004144701.1|4724506_4724710_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
WP_020323987.1|4724709_4725174_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.0e-74
WP_004185715.1|4725270_4725921_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.1	3.6e-102
WP_020324020.1|4725924_4726989_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
WP_020323980.1|4727005_4727839_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.5e-103
WP_019704191.1|4727979_4729743_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
WP_094615885.1|4729742_4730798_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.1e-176
WP_001118646.1|4730823_4731747_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	2.8e-172
WP_020324000.1|4731877_4733311_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_020324001.1|4733526_4734369_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.0e-59
WP_020323985.1|4734368_4734587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323998.1|4734873_4735107_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	2.4e-32
WP_020324007.1|4735117_4735306_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
WP_020324017.1|4735459_4737874_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	88.4	0.0e+00
WP_020324002.1|4737870_4738728_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.2	3.4e-116
WP_020324003.1|4738724_4738952_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	1.2e-33
WP_020323984.1|4738951_4739185_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.3e-30
WP_020806228.1|4739252_4739594_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	86.7	8.4e-50
WP_019704179.1|4739557_4739758_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
WP_020806226.1|4739765_4740275_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_000102106.1|4740307_4740550_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_031281027.1|4740672_4741302_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.1	3.9e-61
WP_022631381.1|4741304_4742318_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	8.5e-191
4744599:4744645	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 1
NZ_CP028717	Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence	134869	3811	11752	134869	transposase	Escherichia_phage(28.57%)	13	NA	NA
WP_001493762.1|3811_4384_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|4520_5111_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_077256884.1|5161_5737_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.3	1.6e-45
WP_000780222.1|5883_6165_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|6145_6475_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_048337415.1|6710_6968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|7001_7706_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004152383.1|7893_8202_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_014343480.1|8198_8849_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_014343481.1|8904_9549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072101986.1|9598_10195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013609537.1|10361_10955_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_013023834.1|11026_11752_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	28.3	1.2e-05
>prophage 2
NZ_CP028717	Klebsiella pneumoniae strain SCM96 plasmid pSCM96-1, complete sequence	134869	67257	110291	134869	transposase,integrase	Escherichia_phage(41.18%)	47	70090:70103	112555:112568
WP_001568041.1|67257_67959_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|68395_68626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015345000.1|68689_69361_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568038.1|69363_70335_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
70090:70103	attL	ATGCACGGCCAGCA	NA	NA	NA	NA
WP_004152765.1|70583_72068_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568036.1|72477_72909_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004197646.1|72908_74180_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_004098982.1|74591_75467_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|76147_76774_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_006788217.1|76893_77073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197635.1|77528_78323_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_017899884.1|78520_79537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053389906.1|79547_79862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380813.1|79888_80248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023785.1|80452_80758_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001568025.1|80759_80978_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_013023783.1|81795_82086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023782.1|82082_83210_-	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_015344964.1|83243_84836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023780.1|85042_85822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023779.1|85834_86335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023778.1|86609_86873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023777.1|86869_87436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023776.1|87466_87961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048337418.1|88004_88373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|88406_88610_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_017899889.1|88658_88916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009653916.1|88991_89246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013609504.1|89381_90158_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_017899891.1|90398_90722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023770.1|91960_93142_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_013023768.1|94333_95191_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|95183_95261_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152385.1|95492_95744_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_052145515.1|95879_96389_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	3.7e-17
WP_001323889.1|96562_98140_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001067855.1|98463_99168_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|99923_100775_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|101082_101898_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|101958_102762_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|102761_103598_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|103658_104363_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|104513_105329_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|105518_106223_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|106455_107316_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|108102_108807_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|109277_110291_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
112555:112568	attR	TGCTGGCCGTGCAT	NA	NA	NA	NA
>prophage 1
NZ_CP028718	Klebsiella pneumoniae strain SCM96 plasmid pSCM96-2, complete sequence	46161	0	10975	46161		Streptococcus_phage(33.33%)	12	NA	NA
WP_004221702.1|3304_3490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004221700.1|3447_3660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557557.1|3722_3998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510385.1|4015_4270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196235.1|4379_5201_-	sprT domain-containing protein	NA	NA	NA	NA	NA
WP_023408316.1|5197_5377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072053.1|5393_5660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000351937.1|5649_6300_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001293458.1|6337_6793_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_004199098.1|6804_9132_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_000517490.1|9135_10398_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_100774542.1|10480_10975_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.6	5.2e-16
>prophage 2
NZ_CP028718	Klebsiella pneumoniae strain SCM96 plasmid pSCM96-2, complete sequence	46161	29606	30122	46161		Tupanvirus(100.0%)	1	NA	NA
WP_001025390.1|29606_30122_-	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 3
NZ_CP028718	Klebsiella pneumoniae strain SCM96 plasmid pSCM96-2, complete sequence	46161	34722	39175	46161	transposase	Burkholderia_phage(25.0%)	5	NA	NA
WP_000516402.1|34722_35385_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|35765_36428_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000343760.1|36516_37737_-|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549892.1|37838_38078_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_001067834.1|38470_39175_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 4
NZ_CP028718	Klebsiella pneumoniae strain SCM96 plasmid pSCM96-2, complete sequence	46161	42437	44549	46161	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001310555.1|42437_43454_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_039023245.1|43562_44549_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	9.0e-52
