The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	592203	615524	4775558	integrase,transposase	Liberibacter_phage(33.33%)	17	598401:598425	615618:615642
WP_039269125.1|592203_593760_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|593800_595249_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000351437.1|595248_597372_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000090707.1|597358_598201_-|transposase	transposase	transposase	NA	NA	NA	NA
598401:598425	attL	TTTGGAACAATAAAGTTTGTACACT	NA	NA	NA	NA
WP_022651989.1|598423_599677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651990.1|599669_600446_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_022651991.1|600445_603715_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.8	1.7e-59
WP_022651992.1|603714_604350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651993.1|604333_605713_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	1.7e-08
WP_022651994.1|605712_606900_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_022651995.1|606889_608401_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.7	1.1e-88
WP_022651996.1|608403_609042_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_022651997.1|609025_609427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071993176.1|609677_611075_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_022652319.1|611109_612561_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_022652000.1|612550_614710_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_022652001.1|614699_615524_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
615618:615642	attR	AGTGTACAAACTTTATTGTTCCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	1850000	1857595	4775558	integrase	Enterobacteria_phage(30.0%)	10	1842416:1842430	1868109:1868123
1842416:1842430	attL	ACGGCGTAATCCTGT	NA	NA	NA	NA
WP_003863199.1|1850000_1851053_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
WP_003863197.1|1851358_1852462_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.7e-59
WP_003863195.1|1852473_1853727_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
WP_039268727.1|1853928_1855092_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	95.1	5.0e-219
WP_003863191.1|1854968_1855319_-	helix-turn-helix domain-containing protein	NA	Q5G8V4	Enterobacteria_phage	95.7	1.5e-57
WP_003863189.1|1855321_1855531_-	hypothetical protein	NA	A0A220IH74	Escherichia_phage	59.3	2.1e-11
WP_032628143.1|1855567_1856116_-	hypothetical protein	NA	E5AGD3	Erwinia_phage	35.0	2.3e-20
WP_003863184.1|1856124_1856325_-	hypothetical protein	NA	G8C7S1	Escherichia_phage	71.2	1.1e-20
WP_022650432.1|1856333_1857134_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	85.0	6.6e-138
WP_022650433.1|1857133_1857595_-	VUT family protein	NA	A0A2H4N7D9	Pectobacterium_phage	55.7	4.1e-39
1868109:1868123	attR	ACGGCGTAATCCTGT	NA	NA	NA	NA
>prophage 3
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	2336724	2367754	4775558	portal,head,terminase,tail,holin,capsid,integrase	Cronobacter_phage(80.0%)	37	2336029:2336043	2345190:2345204
2336029:2336043	attL	GAAGAGGGCAACCGC	NA	NA	NA	NA
WP_003858450.1|2336724_2337243_+	outer membrane protein OmpX	NA	K7PJP9	Enterobacteria_phage	31.4	3.2e-16
WP_108082280.1|2337358_2338942_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_017384915.1|2339211_2339340_-	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_039268748.1|2339506_2340547_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.4	4.4e-118
WP_039268749.1|2340547_2341126_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	40.7	1.3e-29
WP_001247709.1|2341245_2341467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268750.1|2341497_2342001_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	70.1	9.5e-58
WP_039268751.1|2342010_2342205_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_013097409.1|2342194_2342623_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.2	5.8e-24
WP_013097408.1|2342622_2343024_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	54.1	6.0e-39
WP_013097407.1|2343090_2343324_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_039268752.1|2343314_2344181_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	93.6	5.0e-147
WP_032657714.1|2344177_2344390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268754.1|2346547_2346754_+	hypothetical protein	NA	NA	NA	NA	NA
2345190:2345204	attR	GAAGAGGGCAACCGC	NA	NA	NA	NA
WP_039268756.1|2346727_2347051_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	88.5	1.3e-47
WP_039268757.1|2347047_2348100_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.3	1.5e-158
WP_039268760.1|2350044_2350842_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	53.1	8.2e-64
WP_039268761.1|2350901_2351924_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	79.1	1.6e-152
WP_039268762.1|2351926_2352628_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	3.3e-85
WP_039268763.1|2352687_2353179_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	78.0	1.4e-58
WP_039268764.1|2353175_2353682_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.7	1.1e-64
WP_058663725.1|2353678_2354386_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.2	2.3e-102
WP_039268766.1|2354382_2355510_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	82.7	4.3e-175
WP_013097392.1|2355506_2355962_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	3.5e-59
WP_039268767.1|2355971_2356265_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.4	6.8e-16
WP_039268768.1|2356261_2356603_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	89.1	5.4e-49
WP_039268770.1|2356602_2356971_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.4	3.6e-22
WP_039268771.1|2357090_2357351_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	59.3	2.4e-20
WP_039268772.1|2357538_2359851_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	57.5	3.8e-218
WP_039268773.1|2359847_2360177_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.5	4.6e-37
WP_039268774.1|2360173_2361358_+	phage protein	NA	F1BUK6	Cronobacter_phage	79.0	2.4e-176
WP_039268775.1|2361350_2361938_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	80.5	9.9e-91
WP_080332504.1|2361947_2364404_+	hypothetical protein	NA	F1BUK3	Cronobacter_phage	56.5	1.2e-169
WP_039268777.1|2364405_2364840_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	60.8	5.2e-20
WP_039268779.1|2364829_2365555_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	1.2e-61
WP_039268780.1|2365526_2366075_+	protein phage	NA	F1BUJ9	Cronobacter_phage	74.0	4.1e-62
WP_039268781.1|2366077_2367754_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.5	1.6e-205
>prophage 4
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	2705945	2766199	4775558	portal,protease,head,terminase,tail,holin,tRNA,capsid,integrase	Enterobacterial_phage(26.92%)	79	2699623:2699640	2773969:2773986
2699623:2699640	attL	TTTTGTAGGCCGGGTAAG	NA	NA	NA	NA
WP_032628201.1|2705945_2707058_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_022650804.1|2707098_2707572_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_022650805.1|2707571_2708234_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_003857898.1|2708351_2709602_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_022650806.1|2709677_2709923_+	YmjA family protein	NA	NA	NA	NA	NA
WP_022650807.1|2709927_2711427_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_071524166.1|2711551_2711644_-	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_003857896.1|2712015_2712264_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_015570794.1|2712317_2712392_-	protein YoaJ	NA	NA	NA	NA	NA
WP_015570793.1|2712392_2712491_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_022650808.1|2712536_2713565_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	5.0e-13
WP_022650809.1|2713876_2714131_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_022650810.1|2714211_2714517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003857886.1|2714517_2714862_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_022650811.1|2715012_2715720_+	CTP synthase	NA	NA	NA	NA	NA
WP_022650812.1|2715751_2716939_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_022650813.1|2717038_2717830_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003857881.1|2717813_2718260_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_022650814.1|2718366_2720403_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_022650815.1|2720418_2721750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022650816.1|2722159_2722660_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_032103854.1|2722879_2724022_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.3	6.4e-94
WP_022650818.1|2723996_2724260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882635.1|2724641_2725418_-	DUF551 domain-containing protein	NA	M9NZE4	Enterobacteria_phage	43.1	1.1e-28
WP_039268806.1|2725414_2725837_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.7	2.5e-67
WP_039268809.1|2726173_2726404_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	97.4	9.7e-34
WP_052255153.1|2726400_2726919_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	52.3	1.3e-22
WP_063948321.1|2726905_2727931_-	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	90.4	4.6e-168
WP_039269162.1|2727927_2728341_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	86.1	3.6e-55
WP_039269163.1|2728875_2729079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269164.1|2729289_2729949_-	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	62.1	4.1e-69
WP_039268812.1|2730056_2730281_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	54.5	5.4e-13
WP_039268813.1|2730306_2730777_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	91.7	6.8e-74
WP_071882636.1|2731017_2731224_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	4.5e-14
WP_039268815.1|2731186_2732125_+	transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	87.1	6.5e-68
WP_039268818.1|2732121_2732616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268819.1|2732615_2733275_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	78.6	1.3e-99
WP_039268820.1|2733271_2733595_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.9	7.2e-43
WP_039268821.1|2733591_2733981_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	93.8	5.1e-67
WP_039268822.1|2733977_2734967_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.4	4.7e-178
WP_039268823.1|2734979_2735558_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	53.3	7.3e-46
WP_039268826.1|2736137_2737037_+|protease	serine protease	protease	NA	NA	NA	NA
WP_006809173.1|2737129_2737534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000220248.1|2737530_2737812_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_039268827.1|2737808_2738435_+	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	92.3	9.5e-108
WP_039268828.1|2738442_2738718_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	53.3	2.4e-15
WP_052255156.1|2738668_2738860_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.3	1.2e-18
WP_071882637.1|2739176_2739752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268831.1|2739937_2741395_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	91.8	9.8e-273
WP_039268832.1|2741413_2741644_+	DUF1327 domain-containing protein	NA	NA	NA	NA	NA
WP_039268833.1|2741659_2741944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268834.1|2742109_2742700_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	86.2	1.9e-97
WP_087713568.1|2742696_2743041_+	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	73.0	6.7e-47
WP_023315886.1|2743172_2743637_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	2.2e-48
WP_023315887.1|2743590_2745327_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.3	3.7e-141
WP_039269165.1|2745326_2746604_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	86.3	8.8e-217
WP_023315889.1|2746621_2747305_+|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	78.4	8.8e-99
WP_039268837.1|2747308_2748469_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	86.0	1.2e-185
WP_039269166.1|2748506_2748827_+	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	61.3	1.2e-34
WP_023315892.1|2748826_2749168_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	30.1	2.3e-07
WP_039268838.1|2749157_2749535_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	38.7	1.0e-19
WP_039268839.1|2749531_2749936_+	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	72.0	1.1e-43
WP_032104401.1|2749968_2750421_+|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	76.7	9.1e-60
WP_039268840.1|2750484_2750847_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	54.3	3.1e-26
WP_071882647.1|2750867_2751086_+	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	66.7	1.5e-23
WP_039268841.1|2751085_2754412_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	69.1	0.0e+00
WP_032104406.1|2754411_2754750_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	73.2	1.9e-46
WP_039268842.1|2754746_2755505_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	94.8	1.4e-142
WP_039268843.1|2755506_2756214_+	peptidase P60	NA	K7PLS6	Enterobacteria_phage	97.0	2.7e-143
WP_039269167.1|2756246_2756660_+	lipoprotein	NA	G8C7Q7	Escherichia_phage	65.7	4.9e-52
WP_039268844.1|2756718_2757309_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.6	3.3e-78
WP_039268846.1|2757362_2761199_+|tail	phage tail protein	tail	K7PJL6	Enterobacteria_phage	83.4	0.0e+00
WP_039268847.1|2761242_2761557_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	5.6e-32
WP_039268849.1|2761557_2762229_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	2.6e-87
WP_039268850.1|2762336_2762570_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	77.6	8.6e-30
WP_039268851.1|2762628_2764011_+	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	56.8	1.9e-124
WP_039268852.1|2764093_2764333_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	71.8	3.5e-26
WP_039268853.1|2764332_2764653_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.7	2.3e-25
WP_039268854.1|2764915_2766199_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.4e-09
2773969:2773986	attR	CTTACCCGGCCTACAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3000724	3007973	4775558		Escherichia_phage(83.33%)	8	NA	NA
WP_022651054.1|3000724_3001402_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	62.6	1.5e-77
WP_032609101.1|3001577_3001889_-	YebG family protein	NA	NA	NA	NA	NA
WP_017384547.1|3001998_3002613_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.7	3.3e-28
WP_022651056.1|3002657_3003512_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	34.9	1.2e-23
WP_003858259.1|3003513_3004131_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	1.4e-74
WP_039268870.1|3004141_3006580_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.5	2.9e-216
WP_003857424.1|3006710_3007016_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_003857421.1|3007118_3007973_-	benzoate transporter	NA	M1I711	Paramecium_bursaria_Chlorella_virus	33.2	8.1e-25
>prophage 6
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3329464	3405906	4775558	plate,terminase,tail,holin,tRNA,integrase	Enterobacteria_phage(29.41%)	79	3328105:3328120	3353632:3353647
3328105:3328120	attL	CGGAGGTAACCTGCCG	NA	NA	NA	NA
WP_003856933.1|3329464_3330625_+	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.3	2.5e-117
WP_022651250.1|3330659_3331082_-	GFA family protein	NA	NA	NA	NA	NA
WP_003856931.1|3331085_3331283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071785691.1|3331703_3331904_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_022651252.1|3332228_3332918_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.1e-77
WP_071787990.1|3332955_3333168_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_022651253.1|3333450_3333669_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	65.7	2.9e-19
WP_032645629.1|3334230_3334458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651254.1|3334662_3335001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651255.1|3335415_3335982_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.0	6.0e-77
WP_072031589.1|3336109_3336847_+	hypothetical protein	NA	K7P6T0	Enterobacteria_phage	55.7	5.4e-70
WP_072202872.1|3337706_3339017_-|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	46.2	1.3e-77
WP_022651261.1|3339075_3339309_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	76.3	9.5e-29
WP_022651262.1|3339377_3340088_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	3.6e-87
WP_022651263.1|3340088_3340403_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	6.6e-33
WP_022651264.1|3340443_3343995_-|tail	phage tail protein	tail	K7P840	Enterobacteria_phage	84.6	0.0e+00
WP_022651265.1|3344047_3344674_-|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	59.9	1.8e-53
WP_123839386.1|3344785_3345352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651267.1|3345428_3346142_-|tail	phage tail protein	tail	K7PLS6	Enterobacteria_phage	97.4	1.0e-142
WP_022651268.1|3346143_3346899_-|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	77.2	2.0e-115
WP_022651269.1|3346895_3347243_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	62.6	1.7e-37
WP_020690998.1|3347299_3347653_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
WP_022651270.1|3347727_3350640_-|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	34.7	1.6e-128
WP_032645632.1|3350636_3350951_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	1.1e-16
WP_022651271.1|3350947_3351259_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
WP_022651272.1|3351324_3351996_-	hypothetical protein	NA	I6PBN6	Cronobacter_phage	47.3	7.4e-50
WP_022651273.1|3352065_3352476_-	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	52.2	1.9e-32
WP_022651274.1|3352472_3353057_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	55.3	1.4e-49
WP_022651275.1|3353058_3353409_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	2.1e-32
WP_022651276.1|3353410_3353893_-	hypothetical protein	NA	A0A0E3GMJ4	Enterobacteria_phage	34.7	2.6e-12
3353632:3353647	attR	CGGAGGTAACCTGCCG	NA	NA	NA	NA
WP_127353320.1|3353929_3354286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268908.1|3354210_3355164_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	5.3e-134
WP_022651278.1|3355176_3355947_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
WP_022651279.1|3356027_3357125_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.9	1.8e-117
WP_022651280.1|3357126_3358515_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.2	2.1e-123
WP_022651281.1|3358516_3359824_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	57.3	1.3e-143
WP_022651282.1|3359801_3360800_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
WP_032645635.1|3360846_3361296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032645710.1|3362804_3363080_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.4	3.7e-32
WP_022651285.1|3363087_3363717_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	2.3e-101
WP_022651286.1|3363716_3363998_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_015570936.1|3363984_3364371_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_022651288.1|3365156_3365348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651290.1|3365873_3366707_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.7	3.3e-124
WP_032645711.1|3366703_3367066_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
WP_022651293.1|3367273_3367876_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	82.5	6.8e-95
WP_022651294.1|3368264_3368489_-	DinI family protein	NA	H6WRY5	Salmonella_phage	62.3	1.8e-21
WP_022651295.1|3368859_3369306_-	VOC family protein	NA	NA	NA	NA	NA
WP_039268909.1|3369792_3370974_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_014884019.1|3371319_3371538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014832179.1|3371839_3372289_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_039268911.1|3372565_3373252_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	63.0	2.0e-82
WP_032645637.1|3373248_3374166_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	71.1	4.2e-112
WP_039268913.1|3374250_3374802_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	47.3	7.5e-32
WP_022651300.1|3374804_3375032_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	62.2	1.6e-20
WP_022651301.1|3375131_3375524_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	63.1	6.3e-41
WP_162183705.1|3375772_3376099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268914.1|3376342_3379480_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.4	0.0e+00
WP_022651303.1|3379489_3380575_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.3	2.8e-123
WP_020882485.1|3380613_3380856_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_022651304.1|3380920_3381133_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	63.4	4.3e-20
WP_022651305.1|3381134_3382373_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	70.0	4.3e-168
WP_003856923.1|3382422_3383358_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
WP_003856922.1|3383401_3384775_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.1e-50
WP_163270243.1|3384832_3384985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003856916.1|3385259_3386243_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_022651306.1|3386333_3387464_-	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_003856913.1|3387780_3388269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651307.1|3388297_3389614_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_022651308.1|3389637_3390093_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003856903.1|3391238_3391763_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_123839387.1|3392326_3392602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647470.1|3392777_3393122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651313.1|3395751_3396759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268915.1|3396748_3399211_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_022651315.1|3399215_3399740_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022651316.1|3399775_3400858_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022651318.1|3401190_3401682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651321.1|3404136_3405906_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3686494	3738836	4775558	integrase,terminase,tail,holin	Escherichia_phage(23.33%)	75	3688408:3688436	3736623:3736651
WP_003859884.1|3686494_3687139_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	3.3e-55
WP_003859879.1|3687306_3688287_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
3688408:3688436	attL	GATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_003859877.1|3688764_3689436_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.1e-80
WP_032666022.1|3689502_3689910_-	cell envelope integrity/translocation protein TolA	NA	NA	NA	NA	NA
WP_003859872.1|3690052_3691321_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.5	3.4e-229
WP_003859869.1|3691320_3691626_-	hypothetical protein	NA	I6PCW5	Cronobacter_phage	40.6	7.8e-15
WP_003859867.1|3691738_3692101_+	GtrA family protein	NA	U5P0S6	Shigella_phage	85.0	4.4e-49
WP_003859865.1|3692097_3693027_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	90.1	5.7e-157
WP_039268929.1|3693019_3694330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859861.1|3695009_3697433_-	SGNH/GDSL hydrolase family protein	NA	G0XNW5	Escherichia_phage	39.8	3.5e-142
WP_039268930.1|3697488_3699966_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.8	0.0e+00
WP_039268931.1|3699952_3700318_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	93.3	1.1e-63
WP_039268932.1|3700331_3700802_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	94.2	1.1e-79
WP_039268933.1|3700801_3701299_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.9	5.3e-85
WP_039268934.1|3701298_3704202_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	37.3	1.7e-106
WP_039268935.1|3704214_3704886_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.8	7.0e-56
WP_017693204.1|3704943_3705687_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	85.4	1.3e-71
WP_032608745.1|3705751_3706135_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_039268936.1|3706131_3706596_-	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	44.8	2.0e-30
WP_039268937.1|3706598_3706949_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	2.0e-38
WP_006820518.1|3706948_3707122_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	7.8e-12
WP_001514201.1|3707121_3707523_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	81.5	7.1e-56
WP_108082289.1|3707585_3707879_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	85.6	5.7e-39
WP_039268939.1|3707888_3708965_-	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	87.7	2.3e-178
WP_023300384.1|3708982_3709432_-	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	5.5e-65
WP_023314024.1|3709444_3710710_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	88.6	2.1e-215
WP_039268940.1|3711598_3712948_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	88.4	4.1e-233
WP_022651105.1|3713017_3713284_-	hypothetical protein	NA	Q5G8Y6	Enterobacteria_phage	94.3	3.8e-42
WP_022651104.1|3713345_3714830_-	hypothetical protein	NA	G0ZND4	Cronobacter_phage	88.1	2.2e-259
WP_015571553.1|3714816_3715389_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	72.1	6.5e-71
WP_022651103.1|3715416_3715752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651102.1|3715811_3716027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651101.1|3716131_3716383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047724946.1|3716560_3716758_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	90.7	1.6e-16
WP_022651100.1|3716714_3716987_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	59.1	3.1e-15
WP_022651099.1|3716983_3717526_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	70.4	2.7e-74
WP_001514184.1|3717528_3717804_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_001514183.1|3717800_3718202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039268944.1|3718913_3719603_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	5.1e-62
WP_003859831.1|3719715_3720357_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	71.6	2.6e-76
WP_003859830.1|3720349_3720520_-	NinE family protein	NA	G8C7V4	Escherichia_phage	90.9	8.2e-22
WP_003859829.1|3720516_3720954_-	NinB protein	NA	G8C7V3	Escherichia_phage	69.0	2.7e-53
WP_003859826.1|3721134_3721368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859824.1|3721376_3721628_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	83.6	4.3e-27
WP_003859822.1|3721937_3722540_-	DUF551 domain-containing protein	NA	G8C7V0	Escherichia_phage	67.5	1.8e-31
WP_003859819.1|3722536_3723061_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	48.3	4.8e-36
WP_003859817.1|3723057_3723402_-	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	96.5	2.1e-56
WP_003859816.1|3723398_3724271_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	66.2	5.8e-103
WP_003859814.1|3724255_3725125_-	replication protein	NA	K7PGT1	Enterobacteria_phage	48.8	8.4e-62
WP_003859813.1|3725210_3725756_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	82.3	7.3e-80
WP_003859811.1|3725785_3726019_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	67.6	1.1e-21
WP_039269179.1|3726123_3726828_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	66.7	1.1e-88
WP_003859807.1|3726838_3727135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039269180.1|3727678_3728116_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	97.2	3.9e-76
WP_003859803.1|3728279_3728489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003859801.1|3728490_3728649_+	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	92.2	3.2e-20
WP_001752704.1|3728645_3728852_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_003859795.1|3728930_3729215_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	91.5	1.9e-47
WP_003859792.1|3729233_3730079_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	1.1e-69
WP_003859791.1|3730075_3730756_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.7	4.5e-127
WP_003859790.1|3730752_3731181_+	hypothetical protein	NA	G8C7S8	Escherichia_phage	97.2	2.6e-72
WP_003859789.1|3731177_3731345_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	96.2	3.6e-22
WP_039268945.1|3731341_3732094_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	86.4	9.6e-131
WP_039268946.1|3732098_3733223_+	site-specific DNA-methyltransferase	NA	A0A060D598	Salmonella_phage	48.4	6.8e-88
WP_039268947.1|3733219_3733438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268948.1|3733434_3733776_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	51.9	3.2e-17
WP_039268949.1|3733867_3734086_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	64.8	2.1e-17
WP_039268950.1|3734176_3734446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268951.1|3734534_3735065_+	hypothetical protein	NA	A0A059VFZ8	Pseudomonas_phage	42.1	3.0e-30
WP_039268952.1|3735221_3735494_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	2.5e-28
WP_039268953.1|3735462_3736548_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	9.6e-148
WP_003859787.1|3736870_3737209_-	YebY family protein	NA	NA	NA	NA	NA
3736623:3736651	attR	GATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_022651438.1|3737225_3738095_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_022651439.1|3738096_3738468_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003859784.1|3738605_3738836_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
>prophage 8
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	3919341	3927087	4775558		Bodo_saltans_virus(16.67%)	7	NA	NA
WP_003859480.1|3919341_3919953_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.1e-14
WP_003859479.1|3919991_3920972_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_003859478.1|3921164_3922169_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-33
WP_003859477.1|3922217_3923384_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_003859476.1|3923623_3924505_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.4	1.5e-103
WP_003859475.1|3924505_3925591_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	3.7e-99
WP_003859473.1|3925680_3927087_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
>prophage 9
NZ_CP027604	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 chromosome, complete genome	4775558	4373970	4459592	4775558	portal,plate,protease,terminase,tail,holin,tRNA	Enterobacteria_phage(19.15%)	91	NA	NA
WP_003860724.1|4373970_4374708_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003860725.1|4374840_4376169_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860727.1|4376221_4376605_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860729.1|4376920_4377610_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_022651671.1|4377649_4378735_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860733.1|4378939_4379359_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_003860734.1|4379429_4380128_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_022651672.1|4380163_4382827_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_022651673.1|4382936_4384292_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003860739.1|4384338_4384662_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_003860741.1|4384658_4385966_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_006811623.1|4386117_4386570_-	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
WP_022651674.1|4392224_4394798_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	4.5e-127
WP_003863167.1|4394927_4395659_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_003863165.1|4395655_4396636_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_039268995.1|4396767_4397505_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863162.1|4397772_4398114_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100229775.1|4398219_4398267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863160.1|4398374_4399535_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_003863157.1|4399531_4400404_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_003863156.1|4400464_4401586_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_039269031.1|4401596_4402667_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_003863151.1|4402879_4403254_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003863149.1|4403407_4403944_+	YfiR family protein	NA	NA	NA	NA	NA
WP_003863147.1|4403936_4405157_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_003863144.1|4405169_4405655_+	OmpA family protein	NA	NA	NA	NA	NA
WP_003863143.1|4405657_4407028_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003863141.1|4407066_4407471_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|4407603_4407951_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863138.1|4407994_4408762_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003863136.1|4408793_4409333_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|4409348_4409597_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|4409713_4411075_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_020883913.1|4411166_4412033_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026094274.1|4412052_4413339_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003863126.1|4413391_4413985_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003863124.1|4414107_4414986_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_022651676.1|4415071_4416733_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|4416707_4416890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863121.1|4416871_4417210_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003863119.1|4417271_4417559_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|4417548_4418025_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|4418142_4418625_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_039269032.1|4419367_4420573_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_039269186.1|4420828_4421500_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.2	5.1e-83
WP_039269033.1|4421509_4421827_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	1.9e-24
WP_012906750.1|4422337_4422517_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_032619507.1|4422538_4422943_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	49.2	3.1e-35
WP_039269035.1|4422983_4424054_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_039269037.1|4424130_4424709_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	54.4	8.9e-52
WP_052255160.1|4424708_4426886_-	hypothetical protein	NA	A0A0M3ULF6	Salmonella_phage	38.7	1.9e-54
WP_032619504.1|4426888_4427440_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	41.0	4.3e-27
WP_039269039.1|4427432_4428347_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	46.0	6.3e-60
WP_032619502.1|4428330_4428684_-|plate	baseplate assembly protein	plate	E5FFH4	Burkholderia_phage	50.0	8.5e-21
WP_039269041.1|4428720_4429839_-	late control protein D	NA	R9TNM7	Vibrio_phage	32.6	2.7e-36
WP_032620301.1|4429841_4430057_-|tail	tail protein	tail	R9TR63	Vibrio_phage	52.9	1.8e-13
WP_032619500.1|4430031_4430502_-|tail	phage tail protein	tail	D4HTW5	Vibrio_phage	33.8	3.8e-16
WP_023299869.1|4432745_4433033_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_039269044.1|4433084_4433591_-|tail	tail protein	tail	NA	NA	NA	NA
WP_039269045.1|4433587_4435057_-|tail	tail protein	tail	R9TMQ0	Vibrio_phage	46.8	3.2e-77
WP_039269046.1|4435095_4435719_-|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	38.6	1.6e-14
WP_039269047.1|4435711_4436266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269048.1|4436274_4436937_-	hypothetical protein	NA	R9TR34	Vibrio_phage	36.7	2.5e-21
WP_039269050.1|4436938_4437295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269051.1|4437294_4437630_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	43.6	6.8e-12
WP_039269189.1|4437697_4439776_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	53.3	2.7e-199
WP_032634300.1|4439765_4441286_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.4	1.6e-153
WP_039269052.1|4441294_4441510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269054.1|4441506_4443630_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	74.7	7.0e-304
WP_032619489.1|4443630_4444134_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	62.3	5.2e-48
WP_039269056.1|4444343_4444859_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	91.2	3.4e-79
WP_039269058.1|4444855_4445392_-	lysozyme	NA	K7PM52	Enterobacteria_phage	81.1	4.1e-83
WP_000286102.1|4445391_4445607_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	80.3	6.3e-27
WP_039269059.1|4446405_4447470_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.9	5.0e-173
WP_016240136.1|4447620_4447812_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	79.0	5.1e-20
WP_039269061.1|4448010_4448703_-	antitermination protein	NA	NA	NA	NA	NA
WP_039269063.1|4448724_4449786_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.7	7.0e-111
WP_039269064.1|4449782_4450475_-	antirepressor	NA	G0ZND1	Cronobacter_phage	55.1	3.1e-59
WP_032678776.1|4450577_4451912_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	51.3	9.7e-118
WP_039269065.1|4451908_4452763_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	82.2	1.1e-58
WP_020690687.1|4452752_4452932_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	8.6e-14
WP_032678779.1|4453104_4453653_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.7	1.3e-68
WP_032678781.1|4453675_4453891_-	cell division protein	NA	NA	NA	NA	NA
WP_032678782.1|4453989_4454616_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.3	2.7e-46
WP_016247397.1|4455249_4455621_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	2.2e-56
WP_039269066.1|4455674_4456505_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	77.5	3.9e-117
WP_039269067.1|4456640_4457180_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	74.3	2.9e-73
WP_039269068.1|4457167_4457365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039269069.1|4457361_4457655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032678787.1|4457651_4458224_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	83.4	1.3e-92
WP_039269071.1|4458425_4459592_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	3.9e-147
>prophage 1
NZ_CP027605	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence	118226	1579	19938	118226	tail,transposase	Salmonella_phage(73.68%)	21	NA	NA
WP_164908659.1|1579_1981_+|tail	tail fiber domain-containing protein	tail	J9Q6E3	Salmonella_phage	94.2	2.8e-60
WP_040110304.1|2045_2834_+	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	63.5	3.9e-58
WP_000064173.1|2908_3232_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	1.4e-46
WP_006812500.1|3245_3938_+	membrane protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
WP_040110303.1|3939_4191_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	88.0	5.4e-30
WP_080332520.1|4141_4348_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.0	8.1e-24
WP_016582627.1|4375_4900_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016582626.1|4903_5173_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_023315962.1|5589_6255_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
WP_160956455.1|6260_6614_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.2e-45
WP_077990606.1|6655_7453_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.1	2.1e-11
WP_006812583.1|7716_8442_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.2	3.8e-140
WP_000027057.1|8994_9855_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|10037_10595_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|10758_13764_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_040110300.1|15002_16118_+	DNA primase	NA	J9Q720	Salmonella_phage	97.0	3.6e-214
WP_006812580.1|16198_16993_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	2.9e-141
WP_032666393.1|17293_17551_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	4.4e-35
WP_006812578.1|17585_18908_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.9	1.8e-257
WP_006812577.1|19067_19280_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	3.7e-32
WP_003100847.1|19380_19938_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
>prophage 2
NZ_CP027605	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed1, complete sequence	118226	25574	111198	118226	tail,integrase,terminase,portal	Salmonella_phage(93.62%)	102	26450:26465	36135:36150
WP_000067984.1|25574_25880_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
26450:26465	attL	ATGATTCCATACATCC	NA	NA	NA	NA
WP_006812573.1|27061_27895_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	2.3e-88
WP_022649890.1|27905_28109_+	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	50.7	5.6e-09
WP_006812571.1|28124_28490_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
WP_006812570.1|28489_28735_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_006812569.1|28831_29356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006812568.1|29346_29763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023315967.1|29936_31043_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
WP_004110129.1|31034_31421_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004110118.1|31684_31897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006812566.1|32006_34373_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.5	0.0e+00
WP_004110112.1|34469_35705_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	2.3e-238
WP_074136117.1|35885_38249_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.8	0.0e+00
36135:36150	attR	GGATGTATGGAATCAT	NA	NA	NA	NA
WP_023315970.1|38251_38947_+	hypothetical protein	NA	Q854L3	Mycobacterium_phage	45.1	1.4e-19
WP_074136122.1|38966_40136_+	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	95.4	7.8e-212
WP_160389865.1|40150_40576_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	1.7e-71
WP_052255174.1|40607_41531_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_040110290.1|41657_42089_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	8.9e-73
WP_040110289.1|42208_43237_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	4.1e-164
WP_040110288.1|43297_44242_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	2.2e-180
WP_000920226.1|44241_44508_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_162183712.1|44555_45587_+	recombinase	NA	J9Q736	Salmonella_phage	98.8	1.3e-194
WP_040110286.1|45678_45879_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	92.3	6.7e-23
WP_004110049.1|45882_46713_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_004110046.1|46875_47247_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	99.2	1.0e-69
WP_108082292.1|47230_47641_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
WP_040110285.1|47709_47985_+	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	2.3e-45
WP_004110033.1|48201_48537_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	1.6e-56
WP_006812558.1|48536_48749_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_040110284.1|49317_50382_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	7.9e-187
WP_022649908.1|51125_51770_+	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
WP_040110283.1|51845_52340_+	GNAT family acetyltransferase	NA	J9Q6J3	Salmonella_phage	97.0	7.3e-87
WP_040110282.1|52371_52875_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.6	2.1e-89
WP_040110281.1|53103_54189_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.3	1.7e-205
WP_160859089.1|55831_56335_+	SMC family ATPase	NA	J9Q741	Salmonella_phage	99.4	8.2e-86
WP_006812552.1|56324_57071_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	3.4e-136
WP_002214145.1|57082_57652_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_040110279.1|57729_60045_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.6	0.0e+00
WP_040110278.1|60152_61295_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.7	2.9e-219
WP_040110277.1|61377_62247_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	99.3	1.8e-160
WP_040110276.1|62436_63540_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.4	4.4e-217
WP_162183711.1|63559_63955_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	96.9	7.9e-68
WP_160859086.1|63957_64428_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	2.0e-89
WP_040110274.1|64427_65072_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	99.5	1.5e-116
WP_040110273.1|65135_65555_+	hypothetical protein	NA	J9Q743	Salmonella_phage	97.1	3.2e-67
WP_040110272.1|65564_66107_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	97.2	4.2e-96
WP_004109984.1|66145_67252_-	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_040110271.1|67462_68305_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.1	4.4e-108
WP_004109976.1|68490_69084_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
WP_108082293.1|69286_69523_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	98.7	9.0e-35
WP_040110269.1|70859_71354_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	99.4	4.9e-83
WP_040110268.1|71522_73592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040110267.1|73981_75667_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
WP_040110266.1|75725_76415_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	97.4	6.8e-123
WP_040110265.1|76411_76693_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.9	1.9e-47
WP_040110264.1|76695_77067_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	99.2	1.2e-62
WP_040110263.1|77158_77800_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	98.6	7.0e-114
WP_040110262.1|77796_78348_+	hypothetical protein	NA	J9Q748	Salmonella_phage	90.7	2.8e-95
WP_040110261.1|78386_79085_+	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	89.7	6.0e-111
WP_040110260.1|79140_79344_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	95.5	3.7e-29
WP_040110259.1|79533_79800_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	69.3	3.4e-30
WP_040110258.1|79885_80122_+	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	96.2	7.9e-39
WP_040110257.1|80118_80439_+	hypothetical protein	NA	J9Q750	Salmonella_phage	93.4	1.3e-57
WP_157842145.1|80685_80850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006812532.1|82288_82531_-	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	8.9e-38
WP_032655918.1|82676_82898_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	1.2e-33
WP_160859106.1|82905_83121_+	hypothetical protein	NA	J9Q804	Salmonella_phage	97.2	4.1e-34
WP_006812530.1|83261_83573_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.2e-47
WP_006812529.1|83701_84097_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	2.0e-42
WP_160859095.1|84307_84505_+	hypothetical protein	NA	J9Q753	Salmonella_phage	98.5	1.6e-32
WP_006812526.1|84710_85193_+	hypothetical protein	NA	J9Q805	Salmonella_phage	97.5	2.5e-87
WP_016051712.1|85836_86040_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
WP_040110254.1|86090_86741_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	2.1e-113
WP_006812523.1|87064_87592_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
WP_000683475.1|87596_88019_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_001291547.1|88078_88357_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_006812522.1|88359_89919_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.6	4.4e-295
WP_032634983.1|89983_90682_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	99.1	2.5e-125
WP_040110316.1|90681_91350_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
WP_016051719.1|91346_91985_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	100.0	3.8e-112
WP_001113021.1|91977_92232_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_002211789.1|92237_93128_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_000176291.1|93137_93404_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_006812517.1|93601_94243_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
WP_002211787.1|94245_95502_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_040110315.1|95535_97110_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	99.2	3.2e-301
WP_040110314.1|97132_98029_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	98.0	5.1e-147
WP_040110313.1|98055_98931_+	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	1.9e-162
WP_040110312.1|99005_99929_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	98.4	9.9e-154
WP_040110311.1|99972_100407_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	1.4e-73
WP_040110310.1|100406_101240_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	5.8e-153
WP_040110309.1|101337_101682_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	99.1	5.5e-57
WP_040110308.1|101672_102146_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	2.0e-81
WP_000469441.1|102147_102531_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_040110307.1|102605_103352_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	89.1	6.6e-116
WP_000163862.1|103412_103730_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|103855_104080_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_040110306.1|104087_108668_+	tape measure protein	NA	J9Q712	Salmonella_phage	90.6	0.0e+00
WP_000440566.1|108709_109045_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_016051624.1|109134_109833_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.7e-137
WP_023316016.1|109825_110623_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.5	2.3e-154
WP_023316017.1|110610_111198_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.3	1.9e-102
>prophage 1
NZ_CP027606	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence	87025	0	63477	87025	integrase,transposase	Escherichia_phage(22.22%)	60	33454:33513	60555:61337
WP_004098982.1|422_1298_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004098977.1|1922_2549_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
WP_006788217.1|2668_2848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032667567.1|3303_4095_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
WP_004098973.1|4091_4835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|4885_5236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032413492.1|5860_7669_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_058684107.1|7665_8712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023770.1|10028_11210_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_032667578.1|11705_12083_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	3.2e-58
WP_032667561.1|12079_12427_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
WP_032667560.1|12477_14016_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
WP_005012528.1|14126_15341_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072159712.1|15374_16778_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.0e-106
WP_108082295.1|16956_17653_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.5e-125
WP_123615964.1|17807_18644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072159722.1|18842_19811_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	3.1e-182
WP_001039463.1|20523_20910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|20918_21110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|22122_22878_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_032419526.1|23661_23796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|24408_24744_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|24916_25198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|25251_25863_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_011977825.1|25859_26021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108082296.1|26047_27004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000075580.1|27088_27244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067834.1|27384_28089_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000018329.1|28278_29094_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067834.1|29244_29949_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000219391.1|30070_30976_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|30972_32211_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|32210_32795_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|33287_34052_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
33454:33513	attL	CCCTTGATCGTGGCATAGGCCGTGGGGATCGATTTGAAACCGCGCACCGGCTTGATCAGT	NA	NA	NA	NA
WP_000845048.1|35325_36339_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_010792467.1|36487_36952_+	aminoglycoside N-acetyltransferase AAC(3)-Ib	NA	NA	NA	NA	NA
WP_015243636.1|37162_37495_+	quaternary ammonium compound efflux SMR transporter QacF	NA	NA	NA	NA	NA
WP_000679427.1|37667_38015_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|38008_38848_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_004883563.1|38975_39248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|39429_40434_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|40661_41867_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|41877_42183_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001323888.1|42226_42394_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|42382_42943_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|42946_45913_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_043002023.1|45982_46411_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.6	1.3e-20
WP_000509966.1|46417_47023_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_039272567.1|49681_52714_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_039272634.1|52710_53304_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	1.2e-40
WP_063840321.1|54655_55210_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|55340_56171_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|56308_56941_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|57025_57478_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|57700_58048_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|58041_58881_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|59008_59509_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022650072.1|60015_60648_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.2	1.0e-77
WP_001493761.1|61476_62868_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
60555:61337	attR	ACTGATCAAGCCGGTGCGCGGTTTCAAATCGATCCCCACGGCCTATGCCACGATCAAGGGGTCGTTTGCGGGAGGGGGCGGAATCCTACGCTAAGGCTTTGGCCAGCGATATTCTCCGGTGAGATTGATGTGTTCCCATCCGAGCGGCGAAACATGGGCCAAGAGATCGGGCGATAGCAGCTTTCCATCGCGTTTCTGGTTTGCAACGACCTCGCCGAGCTTCATGGTGTTCCAGAAGATGATGATGGCGGCGAGCAGATTCATGCCGGCGATGCGGTAATGCTGGCCTTCGGCGGAACGGTCGCGGATTTCACCGCGGCGGTGGAAGCTGATTGCCCGCTTCAGCGCATGATGAGCTTCGCCTTTGTTGAGCCCGATCTGGGCACGCCGTTGGAGTTCGGCATCCAGAATCCAGTCGATCATGAACAGGGTGCGCTCGACGCGACCGACTTCCCGCAGGGCTGTCGCGAGCTCGTTCTGCCGCGGATAGGAGGCGAGTTTCCGCAGAATCTGGCTTGGCGCGACGGTCCCGGCAGCAATGGTGGCGGCGATGCGCAGGATGTCGGGCCAATTGCGCTCGATCATGGCTTGGTTGACCTTTCCGCCGATCAACGCTCGCAGGTGCGCCGGGGCGGCCGACGGATTGAACGCGTAGAGCCGTTTGGATGGCAGGTCGCGGATGCGCGGAGCGAACCGGTAGCCGAGAATGGCACATGCGGCAAAGACGTGATCGGTGAAGCCGCCCGTGTCGGTGAACTGCTCGCGGATATGGCGTCCAGCATC	NA	NA	NA	NA
WP_001493762.1|62904_63477_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
>prophage 2
NZ_CP027606	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence	87025	69468	74107	87025	transposase	Escherichia_phage(50.0%)	4	NA	NA
WP_004199214.1|69468_70494_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|70490_71270_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_047665864.1|71656_72538_+	carbapenem-hydrolyzing class A beta-lactamase KPC-6	NA	A0A1B0VBP7	Salmonella_phage	52.5	2.0e-74
WP_004152397.1|72787_74107_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
>prophage 3
NZ_CP027606	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence	87025	77514	80413	87025		Enterobacteria_phage(66.67%)	3	NA	NA
WP_001217881.1|77514_78072_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|78254_79115_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000018330.1|79597_80413_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.9	4.3e-161
>prophage 4
NZ_CP027606	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0093 plasmid unnamed2, complete sequence	87025	85018	86358	87025	transposase	Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000046891.1|85018_85354_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001067834.1|85653_86358_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
