The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	644023	698281	4682574	transposase,integrase	Acinetobacter_phage(28.57%)	53	642688:642704	701249:701265
642688:642704	attL	CAGCTTCGCTGTTTTTG	NA	NA	NA	NA
WP_000006255.1|644023_644521_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|644744_646484_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|646443_647214_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|647284_648340_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|648391_648685_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|648687_649086_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|649095_649548_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|649853_650120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|650052_650589_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|650645_652103_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|652363_652822_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|652913_654158_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|654215_654617_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|654655_655711_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_010723085.1|655929_656946_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|657153_658557_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|658543_659476_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|659584_660631_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|661852_662191_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|662213_662564_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_010723086.1|662657_663812_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|664106_665015_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|665029_666997_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|667223_668606_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|668617_670228_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|670232_670991_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|671129_672134_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|673328_674060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|674150_674777_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|675048_675747_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|675773_676628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|676746_676971_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|676967_677408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|677524_678925_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|679209_679620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|679598_680555_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|680564_682763_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|682759_683716_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070700.1|683712_684402_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|684819_685434_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|685681_686011_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|686323_687034_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|687002_688646_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|688635_691161_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|691186_691855_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|691912_692500_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|692574_693117_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|693940_694168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|694202_694343_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|694342_694606_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|694969_695071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020224.1|696185_697073_+	attachment protein	NA	NA	NA	NA	NA
WP_085947771.1|697119_698281_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
701249:701265	attR	CAAAAACAGCGAAGCTG	NA	NA	NA	NA
>prophage 2
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	900967	965264	4682574	protease,lysis,terminase,tRNA,transposase,integrase	Enterobacteria_phage(48.28%)	65	947922:947968	969224:969270
WP_001295836.1|900967_901591_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|901561_902248_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|902244_904659_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|905089_909370_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|909409_909778_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|910468_910729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|911960_913055_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|913123_914050_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|914279_914762_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|914839_915655_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|915744_917526_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|917538_918315_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|918414_919293_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_001339197.1|920356_921565_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000006900.1|922313_923675_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|923731_925033_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|925054_926200_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|926427_927213_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|927223_928459_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|928480_929530_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|929846_931514_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|931523_932783_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|932793_933609_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|933605_934499_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|934693_935761_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|935757_936267_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|936384_937107_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|937109_937604_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|937777_939163_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|939198_939720_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|939827_940040_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|940041_940908_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|941378_941921_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|942140_942833_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|942863_945467_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|945445_946486_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|946496_947012_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|947014_947647_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
947922:947968	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|947981_949145_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|949264_949528_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|949850_949946_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|950008_951170_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|951481_951814_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|951861_952011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|952068_953595_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|954059_954611_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|954620_955418_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|955534_955636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|955632_956088_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|956087_956258_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|956250_956541_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|956537_956900_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|956896_957037_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|957122_957506_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|957903_958920_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|958924_959992_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|960564_960780_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|960779_961277_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|961493_961676_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|961766_962060_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|962350_962761_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|963046_963253_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|963417_963612_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|964000_964546_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|964520_965264_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
969224:969270	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	1190582	1240927	4682574	portal,protease,lysis,capsid,terminase,holin,head,tail,integrase	Enterobacteria_phage(75.0%)	69	1188860:1188875	1213660:1213675
1188860:1188875	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533640.1|1190582_1191653_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|1191630_1191849_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|1191888_1192056_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|1192144_1192426_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|1192617_1193166_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|1193162_1193384_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_000548551.1|1193775_1193967_-	DUF1382 family protein	NA	A0A0K2FJ42	Enterobacteria_phage	100.0	2.8e-26
WP_000149542.1|1193939_1194122_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|1194118_1194799_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|1194795_1195581_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|1195586_1195883_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|1195957_1196101_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1196069_1196234_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|1196306_1196675_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|1196857_1197058_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|1197324_1197807_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|1197807_1198131_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|1198595_1199030_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|1199045_1199885_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104863.1|1199997_1200711_-	LexA family transcriptional regulator	NA	M1FN96	Enterobacteria_phage	100.0	1.6e-127
WP_000437875.1|1200811_1201012_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|1201130_1201424_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|1201456_1202356_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|1202352_1203054_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|1203050_1203341_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|1203414_1203855_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|1203851_1204724_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|1204720_1204894_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|1204860_1205043_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|1205039_1205210_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|1205202_1205814_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_000144614.1|1205810_1206017_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271136.1|1205994_1206660_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|1206656_1207280_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000783735.1|1207956_1208280_+|holin	phage holin, lambda family	holin	A0A0K2FJ23	Enterobacteria_phage	100.0	1.3e-52
WP_000229403.1|1208263_1208740_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|1208956_1209139_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|1209229_1209523_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|1209812_1210223_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|1210508_1210715_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1210879_1211074_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|1211462_1212008_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|1211982_1213908_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
1213660:1213675	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|1213904_1214111_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|1214107_1215709_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|1215689_1217009_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|1217018_1217351_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|1217406_1218432_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|1218473_1218872_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|1218883_1219237_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|1219248_1219827_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|1219823_1220219_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|1220226_1220967_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|1220982_1221405_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1221386_1221821_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|1221813_1224375_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|1224371_1224701_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|1224700_1225399_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|1225404_1226148_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|1226084_1226717_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000515496.1|1226777_1230176_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	100.0	0.0e+00
WP_001246632.1|1230237_1230858_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	100.0	8.3e-112
WP_001407643.1|1230922_1233247_+	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	100.0	6.0e-224
WP_016063193.1|1233246_1233831_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	100.0	1.2e-109
WP_000162952.1|1233959_1235192_-	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	100.0	2.7e-239
WP_000735931.1|1235782_1236673_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	100.0	6.2e-177
WP_000889231.1|1236669_1238247_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	100.0	2.3e-304
WP_000767389.1|1239102_1239579_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001295303.1|1239637_1240927_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 4
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	1611947	1647248	4682574	portal,tRNA,plate,tail,transposase,integrase	Shigella_phage(20.83%)	45	1617850:1617864	1653951:1653965
WP_001339197.1|1611947_1613156_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000713462.1|1613667_1614456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000076376.1|1614452_1614914_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759317.1|1614971_1616018_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1616014_1616809_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000799401.1|1616805_1617663_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1617646_1618783_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
1617850:1617864	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_000359434.1|1619032_1620259_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1620307_1621429_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|1621504_1622965_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|1622964_1623636_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1623804_1625175_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1625178_1625820_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1625855_1626962_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1627015_1627477_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1627486_1628140_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1628311_1629562_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1630055_1630721_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1630721_1631426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1631883_1632777_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1632867_1633995_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1633975_1634221_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1634257_1634569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1634685_1635027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1634964_1635273_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1635447_1636122_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1636212_1636413_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1636456_1637014_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1637189_1637369_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1637358_1638726_+	GntR family transcriptional regulator	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1638737_1638920_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1638919_1639393_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1639319_1640111_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1640101_1640686_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554703.1|1640689_1641319_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	95.4	1.1e-52
WP_010723096.1|1641320_1641734_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000548498.1|1641705_1642308_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_024184299.1|1642307_1642802_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	3.7e-46
WP_000905001.1|1642873_1643428_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1643534_1644368_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000943927.1|1644601_1644766_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1644868_1645192_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1645728_1645839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1645891_1646296_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1646516_1647248_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1653951:1653965	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 5
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	1829403	1870221	4682574	lysis,tRNA,tail,transposase,integrase	Escherichia_phage(45.16%)	43	1830550:1830568	1860925:1860943
WP_010723085.1|1829403_1830420_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1830550:1830568	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1830692_1830950_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1830999_1831950_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1832101_1832854_-	FNR family transcription factor	NA	NA	NA	NA	NA
WP_000945011.1|1833048_1833564_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1833574_1835101_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1835137_1836583_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000444929.1|1836582_1837893_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_000885458.1|1838068_1838977_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1839306_1839870_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1839890_1841123_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1841377_1842361_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1842838_1844212_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1844340_1845276_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1845327_1846563_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1846564_1846780_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1846858_1847068_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1847060_1847255_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1847311_1848121_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1848113_1850714_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1850815_1851091_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1851165_1851336_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1851335_1851557_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1851998_1852487_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1852483_1852639_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1853092_1853569_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1853692_1853989_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1854011_1854434_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1854446_1855304_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1855310_1856057_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1856079_1856640_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1856727_1856913_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1857109_1858567_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1858704_1858968_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1858948_1859308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1861073_1862054_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
1860925:1860943	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1862376_1865739_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1865738_1866314_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000078177.1|1866411_1867002_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1867318_1867552_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1867620_1867734_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1868512_1868947_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1869087_1870221_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 6
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	2062780	2081991	4682574	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|2062780_2064241_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|2064329_2065613_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2066217_2066331_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2066399_2066633_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|2066949_2067540_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001698950.1|2067637_2068213_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_001027733.1|2068212_2069175_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|2069125_2069695_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|2070083_2070317_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2070374_2070785_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2070936_2071110_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2071281_2071437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2071515_2071581_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2071583_2071772_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2071782_2071995_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2072357_2072855_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2072851_2073385_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2073381_2073693_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2073697_2073913_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2074666_2074882_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2075182_2075395_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2075449_2075539_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2075816_2076569_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|2076582_2077632_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|2077633_2077912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|2077978_2078230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2078446_2078602_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2078673_2078961_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2078960_2079200_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2079224_2079530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2079732_2080065_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|2080501_2080651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2080947_2081178_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2081261_2081669_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2081835_2081991_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 7
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	2539777	2548448	4682574		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2539777_2540881_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2540888_2542136_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2542132_2542690_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2542689_2543571_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2543628_2544528_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2544527_2545613_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2545985_2546879_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2547053_2548448_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 8
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	2899188	2910398	4682574	tail,integrase	Enterobacteria_phage(50.0%)	17	2897163:2897179	2914073:2914089
2897163:2897179	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2899188_2900121_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2900432_2901590_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2901742_2902105_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2902101_2903022_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2903018_2904350_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2904384_2904666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2904964_2905405_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2905431_2905950_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2905999_2906275_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2906274_2906769_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2906765_2907134_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2907491_2907854_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2907919_2908744_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2908871_2909408_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2909398_2909761_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2909760_2910066_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2910197_2910398_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2914073:2914089	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 9
NZ_CP028702	Escherichia coli strain J53 chromosome, complete genome	4682574	3292198	3299337	4682574		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|3292198_3294760_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|3294865_3295522_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|3295572_3296340_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|3296535_3297444_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|3297440_3298607_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|3298698_3299337_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
