The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	1027868	1035008	4812358		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1027868_1028507_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001521147.1|1028503_1029766_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847993.1|1029762_1030671_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001272546.1|1030836_1031634_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141345.1|1031684_1032341_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001272917.1|1032446_1035008_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
>prophage 2
NZ_CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	1249630	1294007	4812358	holin,terminase,integrase	Escherichia_phage(62.0%)	54	1252729:1252745	1292153:1292169
WP_001296289.1|1249630_1251097_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|1251165_1252743_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1252729:1252745	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_021524935.1|1252935_1254186_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.0	2.3e-238
WP_032201546.1|1254189_1254384_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	98.4	4.3e-27
WP_060581754.1|1254380_1255031_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	97.7	6.8e-125
WP_001335975.1|1255023_1255275_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|1255432_1255681_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063816.1|1255730_1256612_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	100.0	1.6e-161
WP_032201542.1|1256608_1257430_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.1	2.8e-160
WP_001102253.1|1257426_1257726_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	2.5e-45
WP_000836290.1|1258034_1258619_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|1258773_1259004_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000086412.1|1259370_1260186_+	primosomal protein	NA	Q286X4	Escherichia_phage	96.0	3.5e-118
WP_001066741.1|1260182_1260968_+	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
WP_001231253.1|1261085_1261430_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	1.5e-59
WP_060581756.1|1261491_1262004_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	66.7	1.6e-44
WP_064764886.1|1262000_1262759_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	62.9	1.7e-63
WP_000212569.1|1262760_1262997_+	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	100.0	3.0e-38
WP_033883752.1|1263956_1264307_+	DUF2591 family protein	NA	G9L6B5	Escherichia_phage	72.4	5.6e-41
WP_033559466.1|1264299_1264638_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	96.4	2.0e-56
WP_108084459.1|1264678_1265353_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	98.7	2.4e-117
WP_000132534.1|1265349_1266825_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.6	5.8e-297
WP_060581760.1|1266915_1267272_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	78.0	1.7e-45
WP_060581763.1|1267979_1268186_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	98.5	5.1e-10
WP_021523209.1|1268200_1269880_+	hypothetical protein	NA	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_000133160.1|1269876_1270173_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_060581765.1|1270175_1270871_+	peptidase	NA	G9L6C4	Escherichia_phage	94.8	8.4e-89
WP_060581767.1|1270885_1271872_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	5.6e-187
WP_060581769.1|1271923_1272361_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	97.9	5.3e-73
WP_000012377.1|1272371_1272707_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_060581771.1|1272757_1273081_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	96.3	1.1e-51
WP_000179260.1|1273080_1273686_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_060581774.1|1273685_1276157_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	99.1	0.0e+00
WP_000568023.1|1276156_1276621_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_000336180.1|1276620_1277160_+	hypothetical protein	NA	A0A193GYJ4	Enterobacter_phage	81.8	1.6e-47
WP_060581780.1|1277172_1279686_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	93.9	0.0e+00
WP_060581782.1|1279682_1281485_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
WP_060581783.1|1281490_1283965_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	98.9	0.0e+00
WP_001147904.1|1284160_1284457_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_000708858.1|1284488_1284650_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001555163.1|1284733_1285246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000163643.1|1285232_1285559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060581784.1|1285688_1286399_-	BRO-like protein	NA	G9L6E2	Escherichia_phage	79.8	1.7e-100
WP_060581786.1|1286796_1287525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001188254.1|1287547_1287805_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	98.8	1.7e-42
WP_064764887.1|1288000_1290163_+	SGNH/GDSL hydrolase family protein	NA	F8R4T7	Escherichia_phage	51.0	2.6e-152
WP_060581789.1|1290252_1290654_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	91.7	3.4e-58
WP_000258383.1|1290643_1290952_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	5.1e-46
WP_060581791.1|1290941_1291571_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	6.8e-114
WP_060581793.1|1291567_1292065_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	64.0	8.2e-46
WP_001521044.1|1292261_1292801_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
1292153:1292169	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_014639259.1|1292816_1293335_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|1293645_1293837_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|1293854_1294007_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 3
NZ_CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	1718308	1812776	4812358	lysis,capsid,integrase,transposase,protease,terminase,portal,plate,tRNA,tail,head	Escherichia_phage(18.0%)	92	1745550:1745571	1779790:1779811
WP_001300883.1|1718308_1720342_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
WP_001005448.1|1720473_1721583_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|1721845_1722127_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830456.1|1722419_1722962_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677393.1|1723041_1723716_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_038999767.1|1723731_1726212_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405713.1|1726227_1727262_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_047149163.1|1727343_1727682_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134636.1|1727900_1728725_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1728845_1729118_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195564.1|1729340_1730129_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|1730125_1730926_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_029488678.1|1730990_1731809_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_047149162.1|1731860_1732607_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|1732580_1733546_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846231.1|1733542_1734547_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000858484.1|1734543_1735821_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|1736077_1737130_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001307281.1|1737437_1738292_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_047149161.1|1738320_1739583_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1739592_1740045_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823270.1|1740075_1740360_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1740363_1741719_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1741766_1742807_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1742906_1743686_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807356.1|1743767_1744667_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001318299.1|1745072_1745390_+	hypothetical protein	NA	NA	NA	NA	NA
1745550:1745571	attL	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
WP_000111938.1|1745655_1746669_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	83.6	1.4e-164
WP_000613396.1|1746765_1747062_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	71.1	8.6e-35
WP_001082439.1|1747197_1747473_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	82.2	4.4e-41
WP_004010431.1|1747650_1748151_+	hypothetical protein	NA	M1SV55	Escherichia_phage	83.1	1.1e-77
WP_000549519.1|1748217_1748436_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	64.0	1.6e-09
WP_000027679.1|1748458_1748734_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	47.7	5.2e-18
WP_060581747.1|1748723_1751015_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	73.7	0.0e+00
WP_047149158.1|1751014_1751473_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	53.0	9.6e-41
WP_001396141.1|1751489_1751714_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	59.4	6.4e-14
WP_064756689.1|1752014_1753643_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000906719.1|1753645_1754758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000747182.1|1754853_1755861_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	81.1	1.1e-161
WP_000156051.1|1755862_1757632_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	84.7	4.7e-301
WP_047149156.1|1757798_1758653_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	73.9	4.8e-118
WP_001742976.1|1758713_1759781_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.6	3.9e-170
WP_047149155.1|1759784_1760540_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	72.2	4.6e-80
WP_046276225.1|1760639_1761146_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	1.2e-63
WP_047149154.1|1761145_1761349_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	83.6	1.3e-26
WP_000524521.1|1761339_1761561_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	79.2	2.2e-27
WP_004010248.1|1761544_1762054_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.9	1.4e-80
WP_004010253.1|1762050_1762476_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	69.6	2.1e-42
WP_004010256.1|1762571_1763039_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	2.5e-60
WP_004010258.1|1763031_1763478_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.3	1.8e-47
WP_029392307.1|1763613_1764663_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_029392305.1|1764649_1765228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029392303.1|1765491_1766133_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	81.2	7.3e-95
WP_004010220.1|1766129_1766480_+	lysozyme family protein	NA	A0A0M4RE59	Salmonella_phage	70.7	1.5e-38
WP_047149153.1|1766485_1767394_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	81.5	5.0e-134
WP_004010222.1|1767386_1767917_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	8.1e-92
WP_029392299.1|1767928_1769614_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	60.0	6.1e-125
WP_000143189.1|1769613_1770192_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	52.1	8.4e-50
WP_047149152.1|1770327_1771521_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.9	4.4e-186
WP_047149151.1|1771533_1772052_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.1	2.5e-77
WP_000789944.1|1772106_1772421_+|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	63.9	1.9e-27
WP_000763322.1|1772453_1772576_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	84.6	1.9e-12
WP_047149150.1|1772565_1775007_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	4.2e-308
WP_000928499.1|1775020_1775485_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	3.2e-60
WP_000627827.1|1775481_1776645_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	79.3	1.7e-171
WP_000468306.1|1776725_1776947_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	75.3	4.5e-28
WP_085947770.1|1777014_1778383_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001059829.1|1778699_1779551_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000476014.1|1779960_1781322_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1779790:1779811	attR	AAAAAATAAGCCCGTGTAAGGG	NA	NA	NA	NA
WP_038999770.1|1781468_1781801_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|1781991_1782714_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675150.1|1782710_1784114_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000130850.1|1784110_1785526_-	MFS transporter	NA	NA	NA	NA	NA
WP_047149149.1|1785526_1788604_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001197875.1|1788604_1791727_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000678954.1|1791726_1792974_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_100249771.1|1793252_1793309_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_012767741.1|1793580_1793637_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_010723109.1|1793909_1793969_+	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_047149148.1|1794190_1794850_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000119087.1|1794846_1795608_+	protein-serine/threonine phosphatase PphC	NA	NA	NA	NA	NA
WP_057109460.1|1795604_1797545_+	protein kinase YegI	NA	NA	NA	NA	NA
WP_044064906.1|1797557_1798910_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.3	4.1e-07
WP_000288350.1|1799043_1799901_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_044064908.1|1799938_1803256_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_001295424.1|1803573_1804215_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|1804306_1804888_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_060581531.1|1804909_1806763_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_046464119.1|1807214_1808798_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	1.6e-34
WP_024189503.1|1809555_1810446_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	9.6e-45
WP_160348101.1|1810721_1811576_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.7e-68
WP_060581635.1|1811624_1812776_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	5.8e-42
>prophage 4
NZ_CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	1829415	1838779	4812358	transposase	Escherichia_phage(37.5%)	8	NA	NA
WP_021518757.1|1829415_1830822_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	6.2e-38
WP_021518756.1|1831045_1832110_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.8	3.2e-103
WP_021518755.1|1832136_1833006_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	2.9e-110
WP_021518754.1|1833037_1833928_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	4.3e-29
WP_021518753.1|1833942_1834497_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.4	5.6e-51
WP_021518752.1|1834677_1835844_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	7.0e-112
WP_000019441.1|1836139_1837120_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_000025037.1|1837483_1838779_+	O9 family O-antigen ABC transporter ATP-binding protein Wzt	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.5e-14
>prophage 5
NZ_CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	2710321	2767677	4812358	holin,capsid,transposase,protease,integrase,portal,terminase,tRNA,tail,head	Escherichia_phage(42.55%)	64	2718513:2718527	2767779:2767793
WP_001297484.1|2710321_2711428_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2711463_2712105_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2712108_2713479_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2713647_2714319_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2714318_2715779_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2715854_2716976_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359434.1|2717024_2718251_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2718500_2719637_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2718513:2718527	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2719620_2720484_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000241001.1|2721038_2721707_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001189123.1|2722384_2723893_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_042047081.1|2725527_2726058_-	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_085948620.1|2726059_2727272_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001233546.1|2730663_2731263_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_000515345.1|2731330_2734810_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_000090843.1|2734870_2735479_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_001333568.1|2735415_2736159_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_001152457.1|2736164_2736863_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001330090.1|2736862_2737219_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224003.1|2737196_2740424_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_077253127.1|2740470_2740731_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_001324129.1|2740772_2741159_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097535.1|2741158_2741863_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001206700.1|2741923_2742268_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000968644.1|2742264_2742714_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2742710_2743049_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719064.1|2743057_2743375_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_000766109.1|2743451_2744669_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2744683_2745283_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923134.1|2745275_2746502_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2746649_2748407_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2748406_2748889_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2749036_2749387_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|2749912_2750206_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2750296_2750479_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2750695_2751229_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2751292_2751643_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2751647_2751863_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|2752012_2752174_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|2752170_2752359_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333560.1|2752619_2752955_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_001333559.1|2753025_2753238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2753726_2753813_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2754207_2755029_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2755025_2755406_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2755406_2756465_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2756466_2756745_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2756912_2757125_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_011076332.1|2757327_2757546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224662.1|2758159_2758342_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000761441.1|2758435_2758849_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001151150.1|2758849_2759272_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2759312_2760383_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|2760454_2760880_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|2760863_2761106_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|2761497_2761836_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_001092153.1|2762267_2762468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2762560_2762779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2762743_2762947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2763347_2763536_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2763532_2763724_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2763817_2766259_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2766320_2766590_+	excisionase	NA	NA	NA	NA	NA
WP_000074971.1|2766558_2767677_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
2767779:2767793	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	2932804	3059519	4812358	holin,lysis,protease,capsid,integrase,terminase,portal,plate,tRNA,tail,head	Escherichia_phage(36.07%)	116	2944743:2944763	3046250:3046270
WP_000152888.1|2932804_2934565_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|2934633_2935152_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|2935221_2935389_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|2935644_2936208_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445533.1|2936204_2937845_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|2937849_2939103_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053099.1|2939232_2941140_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
WP_001086539.1|2941151_2943260_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000212422.1|2943503_2944613_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|2944609_2945152_-	cell division protein ZapC	NA	NA	NA	NA	NA
2944743:2944763	attL	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_044866904.1|2945325_2946336_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001111465.1|2946446_2947184_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919497.1|2947149_2947665_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|2947672_2948215_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165668.1|2948226_2949297_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000286312.1|2949287_2951888_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001295349.1|2951912_2952614_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750293.1|2952696_2953236_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263933.1|2953591_2954167_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244308.1|2954159_2955119_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000056006.1|2955115_2956261_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235203.1|2956271_2957063_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|2957059_2957827_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|2957869_2960482_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001307697.1|2960747_2961950_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|2962118_2963519_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|2964121_2965210_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|2965394_2966585_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109486.1|2966806_2967454_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2967480_2968029_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925985.1|2968209_2970057_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572633.1|2970317_2974778_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|2974777_2975482_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|2975462_2976785_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|2976781_2977567_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|2977702_2978482_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436932.1|2978458_2979352_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011620.1|2979505_2980252_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|2980248_2980431_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056538.1|2980482_2981715_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000570539.1|2981751_2982738_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|2982734_2984483_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|2984519_2986784_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2986991_2987276_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2987435_2989109_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|2989219_2989903_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|2990075_2990840_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|2991008_2992292_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057138.1|2992362_2993451_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|2993649_2994342_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_047149115.1|2994471_2996232_+	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_000642546.1|2996637_2997495_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|2997549_2999832_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|3000150_3000369_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|3000450_3001614_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|3001613_3002093_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_049066947.1|3002107_3004555_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	96.4	0.0e+00
WP_000785970.1|3004547_3004667_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3004699_3004975_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3005031_3005550_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_049066944.1|3005562_3006753_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
WP_049066942.1|3006812_3007406_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	3.0e-103
WP_113639816.1|3007436_3007931_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	81.0	1.2e-68
WP_032330348.1|3007930_3008524_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.8	4.9e-53
WP_086707776.1|3008495_3008912_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.8	1.2e-21
WP_113639815.1|3008914_3010210_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	88.8	7.7e-144
WP_048236796.1|3010206_3010818_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	1.1e-116
WP_048236794.1|3010810_3011719_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.2e-161
WP_000127163.1|3011723_3012071_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_049066887.1|3012067_3012703_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	6.5e-112
WP_001001784.1|3012769_3013222_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_049066890.1|3013214_3013682_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_001440152.1|3013644_3013818_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_049066892.1|3013789_3014215_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	97.2	5.5e-67
WP_001712252.1|3014202_3014628_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	96.5	8.6e-60
WP_001144101.1|3014642_3015140_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3015139_3015421_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846414.1|3015424_3015628_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000988633.1|3015627_3016137_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_029397143.1|3016236_3016980_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.6	7.3e-123
WP_016237184.1|3016983_3018057_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_001085948.1|3018115_3018970_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156851.1|3019143_3020916_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|3020915_3021950_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_016242008.1|3022284_3024099_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_016242007.1|3024085_3025333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049066900.1|3025535_3027656_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	96.0	0.0e+00
WP_001565038.1|3027645_3027921_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	98.9	6.6e-45
WP_049066902.1|3027917_3028142_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	98.6	8.5e-35
WP_021540633.1|3028141_3028444_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	97.0	2.5e-45
WP_000557703.1|3028443_3028668_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217679.1|3028731_3029232_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_001389237.1|3029409_3029766_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|3029874_3030174_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023391.1|3030267_3031263_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067977.1|3031294_3032092_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190363.1|3032173_3032764_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242684.1|3032863_3033772_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000918506.1|3033772_3035203_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109259.1|3035412_3036561_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165879.1|3036874_3037501_+	hydrolase	NA	NA	NA	NA	NA
WP_000534637.1|3037535_3038399_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3038400_3039018_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|3039028_3041473_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3041711_3043004_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3043094_3044438_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3044448_3045060_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3045218_3049208_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
3046250:3046270	attR	AGTGCGGCATTTTCGCCAGAT	NA	NA	NA	NA
WP_000228473.1|3049342_3049837_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3050381_3051347_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043592.1|3051469_3053236_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_001202175.1|3053236_3054958_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|3054999_3055704_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3055988_3056207_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_060581617.1|3056891_3059168_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	2.5e-166
WP_000520781.1|3059198_3059519_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 7
NZ_CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	3727242	3781439	4812358	holin,lysis,capsid,transposase,integrase,portal,terminase,tail,head	Enterobacteria_phage(35.19%)	63	3729769:3729816	3777536:3777583
WP_000654804.1|3727242_3728211_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_000772656.1|3728398_3729607_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
3729769:3729816	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001619161.1|3730563_3731409_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	38.0	5.0e-35
WP_060581740.1|3731401_3731800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957441.1|3731799_3732465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060581741.1|3733395_3735285_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_108084473.1|3735537_3736044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|3736046_3736457_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_001619155.1|3736437_3736671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948620.1|3736951_3738165_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_001233083.1|3741044_3741644_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	6.3e-109
WP_108084474.1|3741714_3745212_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_000090917.1|3745272_3745905_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_045154394.1|3745841_3746585_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.3e-148
WP_001152639.1|3746590_3747289_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|3747288_3747618_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_021548553.1|3747614_3750194_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.7	0.0e+00
WP_000459458.1|3750186_3750621_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_021548554.1|3750602_3751025_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	5.9e-61
WP_021548555.1|3751040_3751781_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	7.8e-125
WP_021548556.1|3751788_3752184_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	5.0e-70
WP_001518407.1|3752180_3752759_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_029395143.1|3752770_3753124_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_001468354.1|3753135_3753531_-	DNA packaging FI family protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	3.1e-56
WP_029395141.1|3753572_3754598_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	2.9e-186
WP_012304872.1|3754653_3754986_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	96.4	4.6e-53
WP_029395138.1|3754995_3756315_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.2e-232
WP_057077926.1|3756295_3757897_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	5.5e-309
WP_000198149.1|3757893_3758100_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027321.1|3758096_3760022_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|3759996_3760542_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001663509.1|3760930_3761164_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3761220_3761631_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3761981_3762134_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001446997.1|3762121_3762559_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	95.9	3.0e-68
WP_060581801.1|3762555_3763032_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	1.9e-84
WP_001120496.1|3763035_3763362_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_000907077.1|3763762_3764512_+	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_125282403.1|3764527_3764872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000069422.1|3764875_3765490_+	hypothetical protein	NA	A0A2D1GNI4	Pseudomonas_phage	36.4	9.9e-33
WP_001205456.1|3765515_3765860_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	7.2e-57
WP_001433852.1|3765878_3766868_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_060581690.1|3766875_3767673_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	9.8e-150
WP_000767113.1|3767692_3768082_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210164.1|3768078_3768405_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_060581688.1|3768401_3769055_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	99.1	2.8e-126
WP_072199996.1|3769054_3769549_-	PerC family transcriptional regulator	NA	S5FUZ7	Shigella_phage	99.4	4.7e-86
WP_000104977.1|3769545_3770487_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_001250269.1|3770476_3770656_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|3770831_3771383_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3771420_3771621_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3771718_3772345_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000559916.1|3772572_3773088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|3773558_3773921_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_057077927.1|3773986_3774811_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000008200.1|3774938_3775475_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3775465_3775828_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206734.1|3775827_3776133_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	2.6e-50
WP_000433939.1|3776132_3776483_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_057077906.1|3776359_3777523_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	7.0e-229
WP_000893278.1|3777727_3778981_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3777536:3777583	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3778992_3780096_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|3780383_3781439_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
>prophage 8
NZ_CP028578	Escherichia coli strain WCHEC005784 chromosome, complete genome	4812358	3791573	3857387	4812358	plate,tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	57	NA	NA
WP_060581685.1|3791573_3792071_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056849.1|3792246_3792996_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000729703.1|3793205_3793466_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615983.1|3793468_3793747_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3793902_3794643_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|3794613_3795381_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3795586_3796165_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3796404_3798849_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3798891_3799365_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118036.1|3799518_3800289_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000420818.1|3800329_3801466_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001101839.1|3801896_3802289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508724.1|3802266_3806499_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_032329316.1|3806574_3808716_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001142958.1|3808925_3809444_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|3810138_3810639_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3810673_3810898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056989.1|3810948_3812424_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611744.1|3812430_3812844_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393852.1|3812847_3814698_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3814661_3815744_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113709.1|3815768_3817049_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3817045_3817570_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3817572_3818904_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343289.1|3818908_3819670_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614325.1|3819678_3822444_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088852.1|3822440_3823184_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240525.1|3823188_3824601_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122545204.1|3824709_3828144_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087741.1|3828154_3829507_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|3829530_3830013_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908066.1|3830056_3830971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236653.1|3830980_3831460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108084475.1|3831596_3832382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001340895.1|3832918_3833650_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|3833714_3834182_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326702.1|3834178_3834901_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|3834934_3835690_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3835761_3837120_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000016007.1|3837167_3837791_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|3837794_3838595_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|3838835_3839750_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3839746_3840550_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140187.1|3846309_3846885_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594006.1|3847072_3848104_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001294600.1|3848096_3848750_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|3848789_3849605_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|3849722_3850127_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3850123_3850831_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3850942_3852661_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001336393.1|3852714_3853539_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239163.1|3853738_3854449_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635537.1|3854462_3854885_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3854881_3855427_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3855592_3855793_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3855779_3856040_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176549.1|3856088_3857387_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP028576	Escherichia coli strain WCHEC005784 plasmid pCTXM15_005784, complete sequence	112422	1262	28311	112422	transposase,protease,integrase	Escherichia_phage(42.86%)	26	NA	NA
WP_001066941.1|1262_2003_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_032156742.1|2123_2249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001440647.1|2372_2534_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_029702141.1|3213_3954_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000239590.1|5303_6179_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|6225_6558_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067858.1|6904_7609_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001513661.1|7979_8159_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|8163_8544_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|8543_8765_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|8947_10504_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_023142242.1|10500_11772_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
WP_001553854.1|11893_15010_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_000991832.1|16057_16990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246636.1|16993_17989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|18696_18915_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|18916_19222_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|19222_20029_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001067858.1|20805_21510_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|22209_23070_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|23238_23943_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|24241_25102_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001262765.1|25378_26689_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|26973_27375_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|27307_27565_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|27657_28311_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
