The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776104	985330	1027271	4776104	integrase	uncultured_Caudovirales_phage(30.0%)	42	995071:995085	1031968:1031982
WP_015571369.1|985330_986434_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.0e-59
WP_023305491.1|986445_987699_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	5.2e-97
WP_023305492.1|988039_989212_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	50.3	1.6e-111
WP_000189281.1|989208_989397_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_108168557.1|989393_990779_-	hypothetical protein	NA	Q3LZN8	Bacteriophage	74.0	3.2e-212
WP_023305494.1|990929_991232_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	8.8e-27
WP_023305495.1|991232_991472_-	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	88.3	1.1e-32
WP_023305496.1|991464_991683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032670916.1|991748_992507_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_023305498.1|992563_994630_-	hypothetical protein	NA	Q775A3	Bordetella_phage	68.1	5.1e-275
WP_023305499.1|994707_995256_-	DUF2815 domain-containing protein	NA	Q775A5	Bordetella_phage	67.6	7.6e-69
995071:995085	attL	TTCCCACTTCTCGCC	NA	NA	NA	NA
WP_023305500.1|995270_996572_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	57.1	1.3e-135
WP_023305501.1|996574_997468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023305504.1|998151_998781_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	41.7	1.4e-34
WP_023305505.1|998890_999115_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_057059698.1|999118_1001287_+	replication protein	NA	B6SCY1	Bacteriophage	70.9	6.8e-169
WP_015571352.1|1001597_1001873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023305507.1|1002150_1002570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023305508.1|1002584_1002815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023305509.1|1002818_1004444_+	hypothetical protein	NA	A0A2H4J3N6	uncultured_Caudovirales_phage	58.8	1.2e-173
WP_023305510.1|1004440_1004674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023305511.1|1004660_1005497_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	43.1	4.3e-47
WP_032670917.1|1005564_1005981_+	phage family protein	NA	R9TRJ4	Aeromonas_phage	80.9	6.9e-46
WP_023305513.1|1006198_1007110_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	37.6	9.2e-43
WP_023305514.1|1007167_1007731_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	51.3	9.6e-51
WP_023305515.1|1007732_1009724_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	49.4	1.6e-188
WP_023305516.1|1009725_1010175_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	2.0e-22
WP_023305517.1|1010177_1010645_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	44.7	2.1e-06
WP_023305518.1|1010647_1013356_+	hypothetical protein	NA	G9L6D3	Escherichia_phage	64.0	0.0e+00
WP_023305519.1|1013355_1016247_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	75.8	0.0e+00
WP_023305520.1|1016311_1016653_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	52.7	7.4e-22
WP_023305521.1|1016649_1018260_+	hypothetical protein	NA	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	1.4e-224
WP_023305522.1|1018280_1020275_+	hypothetical protein	NA	G3M191	Escherichia_virus	43.6	1.5e-106
WP_023305523.1|1020309_1021779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023305524.1|1021775_1022693_-	glycosyltransferase	NA	U5P087	Shigella_phage	89.5	6.6e-158
WP_023305525.1|1022689_1023052_-	GtrA family protein	NA	U5P0S6	Shigella_phage	56.7	5.1e-29
WP_023305526.1|1023237_1023468_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	71.4	3.5e-23
WP_023305527.1|1023448_1023988_+	lysozyme	NA	H6WRZ4	Salmonella_phage	90.4	3.3e-93
WP_023305528.1|1023984_1024347_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.3	3.9e-13
WP_032624792.1|1025452_1025731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023303152.1|1026203_1026575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045259856.1|1026653_1027271_-|integrase	phage integrase	integrase	A0A1V0E036	Clostridioides_phage	23.5	3.9e-05
1031968:1031982	attR	TTCCCACTTCTCGCC	NA	NA	NA	NA
>prophage 2
NZ_CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776104	2126032	2137396	4776104		Morganella_phage(33.33%)	12	NA	NA
WP_023306119.1|2126032_2127496_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.9e-45
WP_003857405.1|2127540_2127744_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_023300013.1|2128031_2128463_+	hypothetical protein	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
WP_003857403.1|2128497_2129184_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023306120.1|2129274_2130021_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_023306121.1|2130164_2132198_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.4	3.8e-20
WP_071788017.1|2132811_2133039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647994.1|2133601_2133820_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
WP_023306122.1|2134187_2134877_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.7e-81
WP_006808847.1|2135140_2135380_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
WP_022647996.1|2135706_2136126_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_032671166.1|2136127_2137396_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	90.8	1.6e-226
>prophage 3
NZ_CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776104	2432877	2479105	4776104	terminase,head,lysis,tail	Cronobacter_phage(33.33%)	62	NA	NA
WP_023306288.1|2432877_2433549_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	1.2e-79
WP_023306289.1|2433541_2434810_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.5	5.8e-229
WP_023306290.1|2434809_2435127_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	44.0	7.1e-11
WP_032671217.1|2435491_2436616_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	26.5	4.9e-22
WP_108168622.1|2436645_2438895_-	hypothetical protein	NA	W6PEG9	Cronobacter_phage	36.5	4.8e-109
WP_108168623.1|2438951_2441432_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	91.0	0.0e+00
WP_032671219.1|2441418_2441784_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	90.8	5.4e-63
WP_023306296.1|2441797_2442268_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.3	1.0e-77
WP_023306297.1|2442267_2442765_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.7	2.8e-86
WP_023306298.1|2442764_2446283_-	hypothetical protein	NA	R9TMK1	Aeromonas_phage	37.2	9.5e-104
WP_023306299.1|2446319_2447063_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.1	2.0e-64
WP_023306300.1|2447113_2447869_-	surface protein	NA	G0ZNE6	Cronobacter_phage	53.0	2.9e-58
WP_023306301.1|2447927_2448311_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	57.5	1.7e-38
WP_014883994.1|2448307_2448676_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	3.0e-45
WP_023306302.1|2448678_2449035_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	55.6	3.6e-27
WP_032671222.1|2449034_2449208_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	51.9	1.7e-11
WP_023306304.1|2449261_2449810_-	HNH endonuclease	NA	K9L517	Pectobacterium_phage	42.2	9.4e-35
WP_023306305.1|2449911_2450295_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	75.6	7.5e-47
WP_023306306.1|2450371_2450737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061353765.1|2450746_2451844_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	4.5e-161
WP_017693196.1|2451854_2452289_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	1.4e-49
WP_108168624.1|2452292_2453678_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.3	1.8e-151
WP_047659003.1|2453747_2454263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108168625.1|2454302_2455292_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.1	3.6e-109
WP_108168626.1|2455239_2456691_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	74.2	2.5e-196
WP_108168627.1|2456702_2458178_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	77.2	2.7e-230
WP_032634757.1|2458187_2458637_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.9	1.5e-54
WP_108168628.1|2458669_2459308_-	hypothetical protein	NA	I6S676	Salmonella_phage	91.0	5.9e-113
WP_045333336.1|2459311_2459530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108168629.1|2459709_2460255_-	hypothetical protein	NA	A0A1V0E5P7	Salmonella_phage	64.9	2.5e-56
WP_108168630.1|2460606_2461068_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	75.2	3.1e-55
WP_108168631.1|2461064_2461367_-	hypothetical protein	NA	A0A289ZTW9	Serratia_phage	49.5	5.0e-14
WP_108168632.1|2461363_2461858_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	98.2	3.2e-90
WP_023622516.1|2461835_2462060_-|lysis	lysis S family protein	lysis	M9NZI9	Enterobacteria_phage	95.9	2.1e-33
WP_108168633.1|2462365_2463055_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	5.5e-56
WP_108168634.1|2463051_2463168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752686.1|2463164_2463524_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	98.3	2.6e-65
WP_001752687.1|2463520_2463811_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.6	1.8e-45
WP_108168635.1|2463803_2463974_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	94.3	9.0e-21
WP_006809771.1|2463973_2464429_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_085841678.1|2465126_2465900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023300409.1|2465976_2466276_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	53.7	7.4e-18
WP_108168781.1|2466272_2467052_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.2	1.4e-95
WP_108168636.1|2467048_2467777_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	66.7	2.5e-35
WP_108168637.1|2467910_2468456_-	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	96.1	2.6e-93
WP_108168638.1|2468486_2468714_-	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	70.4	3.4e-23
WP_108168782.1|2468825_2469530_+	hypothetical protein	NA	Q76H56	Enterobacteria_phage	78.6	1.0e-102
WP_108168639.1|2469616_2470051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168640.1|2470467_2470935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168641.1|2470939_2471545_+	hypothetical protein	NA	A0A2C9D0J8	Yersinia_phage	36.1	3.2e-28
WP_058657563.1|2471866_2472076_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	5.7e-33
WP_108168642.1|2472146_2473115_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	1.5e-38
WP_108168643.1|2473122_2473407_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	93.6	1.1e-47
WP_108168644.1|2473416_2474334_+	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	99.3	7.5e-170
WP_108168645.1|2474330_2475011_+	exonuclease	NA	M9NZE1	Enterobacteria_phage	95.1	2.0e-127
WP_047058769.1|2475007_2475436_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.8	1.5e-72
WP_108168646.1|2475596_2476262_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	93.3	2.5e-114
WP_108168783.1|2476267_2476486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168647.1|2476577_2476793_+	hypothetical protein	NA	A0A0N7C211	Escherichia_phage	59.4	2.5e-15
WP_063860680.1|2476794_2477433_+	HNH endonuclease	NA	A0A173GC65	Salmonella_phage	43.2	3.7e-30
WP_023306353.1|2477538_2477787_+	hypothetical protein	NA	S4TND0	Salmonella_phage	53.1	2.6e-16
WP_023306354.1|2477818_2479105_+	DUF3596 domain-containing protein	NA	Q6HA01	Enterobacteria_phage	55.3	5.5e-134
>prophage 4
NZ_CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776104	2752778	2842827	4776104	protease,tail,portal,tRNA,terminase,head,holin,integrase,transposase,capsid	Enterobacteria_phage(24.14%)	104	2780998:2781013	2842753:2842768
WP_003859899.1|2752778_2753660_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_108168660.1|2753853_2755902_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
WP_003859895.1|2755921_2756608_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_023306473.1|2756704_2757202_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_022648459.1|2757334_2758618_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_022648460.1|2758586_2761220_+	MCE family protein	NA	NA	NA	NA	NA
WP_074132810.1|2761297_2762740_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_006811010.1|2762844_2763084_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
WP_023306475.1|2763118_2763763_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.5e-55
WP_108168661.1|2763930_2764911_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_022648464.1|2765279_2765618_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_023300432.1|2765634_2766504_-	copper resistance D domain-containing protein	NA	NA	NA	NA	NA
WP_023300433.1|2766505_2766877_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_003859784.1|2767014_2767245_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_022648467.1|2767356_2767995_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_022648468.1|2768019_2768682_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_022648469.1|2768663_2770739_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_022648470.1|2770814_2771465_-	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_023306478.1|2771637_2772816_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_080346798.1|2772877_2774296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859774.1|2775720_2776362_-	ketohydroxyglutarate aldolase	NA	NA	NA	NA	NA
WP_023306481.1|2776401_2778213_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_022648481.1|2778447_2779923_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.2	4.6e-76
WP_003859769.1|2780277_2781147_+	transcriptional regulator HexR	NA	NA	NA	NA	NA
2780998:2781013	attL	CTGGCGCAGCTGACGG	NA	NA	NA	NA
WP_003859767.1|2781261_2782704_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_032676184.1|2782747_2783719_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_022648483.1|2783838_2785158_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_022648484.1|2785173_2786133_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_023306484.1|2786195_2786951_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	6.7e-15
WP_022648485.1|2786947_2787733_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_006811035.1|2787785_2788796_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.5	3.6e-08
WP_022648487.1|2788804_2789419_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_063160107.1|2789499_2790021_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	5.8e-10
WP_003859747.1|2790055_2790796_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023300445.1|2790823_2791267_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_023300446.1|2791268_2793041_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_071785211.1|2793039_2793231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022648490.1|2793304_2793871_+	hydrolase	NA	NA	NA	NA	NA
WP_063136104.1|2794235_2794502_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	4.7e-40
WP_108168662.1|2794595_2795879_-|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	63.3	1.4e-145
WP_108168663.1|2795937_2796171_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	6.6e-30
WP_045892418.1|2796278_2796950_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	73.5	1.2e-87
WP_017382568.1|2796950_2797265_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	64.7	1.5e-32
WP_108168664.1|2797307_2800865_-	host specificity protein	NA	Q9MCU0	Escherichia_phage	72.0	0.0e+00
WP_047731792.1|2800918_2801503_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	53.1	1.1e-54
WP_108168665.1|2801502_2802213_-	peptidase P60	NA	F1C573	Cronobacter_phage	69.4	4.3e-96
WP_006809150.1|2802215_2802974_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	64.0	1.0e-95
WP_063959197.1|2802970_2803309_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_108168666.1|2803311_2806776_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	93.5	0.0e+00
WP_022646498.1|2807106_2808030_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	3.8e-177
WP_108168667.1|2808055_2808286_-	cor protein	NA	Q5G8V7	Enterobacteria_phage	69.6	8.5e-22
WP_045332808.1|2808406_2808685_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	2.8e-43
WP_016240212.1|2808693_2809077_-	hypothetical protein	NA	K7PKV6	Enterobacterial_phage	94.4	6.7e-64
WP_033146297.1|2809085_2809529_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	94.5	1.6e-72
WP_022648886.1|2809588_2809936_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_108168668.1|2809932_2810382_-	hypothetical protein	NA	K7P6X4	Enterobacteria_phage	98.0	1.9e-73
WP_045626370.1|2810378_2810717_-|head,tail	head-tail adaptor protein	head,tail	K7P7L2	Enterobacteria_phage	96.4	5.4e-57
WP_080396471.1|2810716_2811043_-	hypothetical protein	NA	K7PGU9	Enterobacterial_phage	99.1	3.4e-56
WP_016066093.1|2811076_2812234_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	100.0	4.5e-212
WP_047345265.1|2812236_2812914_-|head,protease	HK97 family phage prohead protease	head,protease	F1C583	Cronobacter_phage	100.0	3.2e-125
WP_108168669.1|2812931_2814206_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.3	1.6e-247
WP_108168670.1|2814205_2815720_-|terminase	terminase	terminase	Q9MCT1	Enterobacteria_phage	99.6	8.0e-294
WP_006809164.1|2815726_2816212_-|terminase	terminase	terminase	Q77WA1	Escherichia_phage	98.8	1.3e-80
WP_032624429.1|2816395_2816599_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	76.1	9.8e-22
WP_001031354.1|2816598_2816940_-	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	99.1	4.6e-64
WP_047749350.1|2816996_2817587_-	hypothetical protein	NA	K7P7D2	Enterobacteria_phage	94.4	5.6e-110
WP_047749351.1|2817568_2819029_-	glycosyltransferase family 2 protein	NA	A0A220NRM5	Escherichia_phage	77.2	5.5e-231
WP_108168671.1|2819028_2819589_-	hypothetical protein	NA	A0A220NRM6	Escherichia_phage	88.7	1.4e-97
WP_100160544.1|2819708_2820044_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	73.9	3.7e-42
WP_108168672.1|2820120_2820666_+	hypothetical protein	NA	S4TR57	Salmonella_phage	96.7	3.1e-94
WP_108168673.1|2821126_2821462_-	hypothetical protein	NA	Q5QF73	Pseudomonas_virus	55.4	6.6e-15
WP_108168674.1|2821579_2821780_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	80.4	7.9e-16
WP_108168675.1|2821730_2822003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108168676.1|2822010_2822640_-	endolysin	NA	G8C7W0	Escherichia_phage	86.6	6.2e-99
WP_045338762.1|2822639_2822918_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.3e-37
WP_023150206.1|2822907_2823297_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	99.2	8.9e-64
WP_105322835.1|2823802_2824030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570940.1|2824076_2824562_-	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
WP_108168677.1|2824857_2825640_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.0	1.1e-108
WP_032621744.1|2825643_2827515_-	DNA replication protein	NA	Q5G8S8	Enterobacteria_phage	59.6	1.1e-223
WP_108168678.1|2827622_2828555_-	hypothetical protein	NA	C5IHL2	Burkholderia_virus	37.8	1.7e-36
WP_108168679.1|2828551_2828749_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032645228.1|2828750_2828969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384394.1|2829083_2829791_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	73.4	2.6e-93
WP_017384395.1|2830204_2830405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240231.1|2831019_2831223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168680.1|2831203_2831614_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	83.5	9.5e-48
WP_006811082.1|2831800_2832307_+	hypothetical protein	NA	F1C5A2	Cronobacter_phage	54.8	4.1e-53
WP_108168681.1|2832319_2833180_+	hypothetical protein	NA	F1C5A3	Cronobacter_phage	75.9	1.6e-126
WP_006811084.1|2833179_2833431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044901830.1|2833432_2833855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023337027.1|2833851_2833977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023337026.1|2833973_2834330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023337025.1|2834322_2834655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058660500.1|2834717_2834954_+	excisionase	NA	Q8W657	Enterobacteria_phage	88.5	1.1e-37
WP_108168682.1|2835009_2836323_+|integrase	integrase	integrase	Q8W658	Enterobacteria_phage	85.8	1.0e-220
WP_108168683.1|2836301_2837075_+	hypothetical protein	NA	Q859D1	Escherichia_coli_phage	79.5	2.5e-57
WP_003859737.1|2837126_2837522_+	membrane protein	NA	NA	NA	NA	NA
WP_003859735.1|2837562_2838306_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1S6L2V9	Erwinia_phage	30.2	6.1e-29
WP_015570275.1|2838302_2839274_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_100248961.1|2839170_2839446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023300450.1|2839472_2840216_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023306486.1|2840294_2840855_-	VOC family protein	NA	NA	NA	NA	NA
WP_023306487.1|2841093_2842827_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	37.2	1.4e-87
2842753:2842768	attR	CTGGCGCAGCTGACGG	NA	NA	NA	NA
>prophage 5
NZ_CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776104	3519390	3602588	4776104	portal,tRNA,terminase,holin,transposase,capsid	Escherichia_phage(21.95%)	88	NA	NA
WP_003863138.1|3519390_3520158_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_003863136.1|3520189_3520729_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_022649067.1|3520744_3520993_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003863132.1|3521109_3522471_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_014832951.1|3522637_3523429_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032671396.1|3523448_3524735_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_015571577.1|3524787_3525405_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_022649070.1|3525503_3526382_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_023306740.1|3526467_3528129_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_071524123.1|3528103_3528286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003863121.1|3528267_3528606_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_003863119.1|3528667_3528955_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006811645.1|3528944_3529421_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863115.1|3529538_3530021_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_001549565.1|3530677_3531919_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	48.3	6.7e-105
WP_001549566.1|3531977_3532856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549567.1|3532981_3533194_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_077633883.1|3533358_3534714_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_057064095.1|3534955_3535576_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_047363791.1|3536939_3537167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168785.1|3537388_3537670_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000350435.1|3537704_3538274_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_047363789.1|3538379_3541229_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.5e-128
WP_001446316.1|3541228_3541420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168710.1|3541480_3543058_+	cell division protein FtsH	NA	C7U047	Ostreococcus_tauri_virus	43.8	4.5e-98
WP_001275372.1|3543145_3543604_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_108168711.1|3543626_3544541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168712.1|3544643_3545531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047363779.1|3545620_3546232_+	membrane protein	NA	NA	NA	NA	NA
WP_108168713.1|3546311_3547457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168714.1|3547446_3547887_+	thiol reductase thioredoxin	NA	V5L6J2	Insectomime_virus	32.4	2.6e-11
WP_108168715.1|3547890_3549606_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016154556.1|3549602_3550100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003847784.1|3551071_3552223_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_057064083.1|3552447_3553428_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.3	6.1e-93
WP_069219379.1|3554384_3555536_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	6.4e-41
WP_108168716.1|3555492_3555849_-	hypothetical protein	NA	U5P4I9	Shigella_phage	91.2	5.7e-33
WP_057064435.1|3556987_3557809_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	2.3e-45
WP_106672551.1|3558025_3558727_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_015063050.1|3558767_3559004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057064437.1|3559003_3559447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015063048.1|3559471_3559939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168717.1|3560240_3561209_-	phage exclusion protein	NA	NA	NA	NA	NA
WP_108168718.1|3561737_3564047_+	ATPase	NA	NA	NA	NA	NA
WP_015063045.1|3564050_3565367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000093087.1|3565363_3567559_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_108168719.1|3568412_3568892_+	hypothetical protein	NA	A9J566	Pseudomonas_phage	29.8	2.3e-13
WP_057064440.1|3568907_3569384_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_001548165.1|3569392_3569614_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_007870247.1|3569631_3569949_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_057064441.1|3569969_3570299_+	toxin	NA	NA	NA	NA	NA
WP_023306741.1|3570983_3571910_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	44.4	2.9e-68
WP_023306742.1|3572059_3573784_-	flagellin	NA	NA	NA	NA	NA
WP_108168720.1|3577578_3578547_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	40.8	6.5e-55
WP_023306746.1|3578550_3580158_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	68.9	3.7e-212
WP_023306747.1|3580204_3581431_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.2	2.3e-129
WP_108168721.1|3581444_3582749_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.5	1.8e-233
WP_105322832.1|3582748_3584485_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.7	0.0e+00
WP_022650844.1|3584484_3584958_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	2.3e-85
WP_047353046.1|3585115_3585466_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	82.8	2.4e-52
WP_032671403.1|3585465_3586056_-	hypothetical protein	NA	S4TR53	Salmonella_phage	84.1	1.0e-95
WP_023305918.1|3586221_3586479_+	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	95.1	2.7e-32
WP_023306752.1|3586779_3588237_-	hypothetical protein	NA	K7PKP3	Enterobacterial_phage	92.8	1.2e-273
WP_032671404.1|3588427_3588718_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	6.3e-30
WP_032671652.1|3588828_3589113_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	67.0	1.1e-26
WP_096216658.1|3589179_3589362_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	83.7	2.1e-15
WP_023306756.1|3590029_3590299_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	90.8	4.8e-32
WP_023306757.1|3590306_3590936_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	97.6	1.4e-114
WP_023306758.1|3590935_3591214_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	87.4	9.6e-36
WP_023306759.1|3591203_3591593_-	phage membrane protein	NA	G8C7V8	Escherichia_phage	94.5	2.3e-59
WP_105322835.1|3591673_3591901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570940.1|3591947_3592433_-	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
WP_023306760.1|3592727_3593510_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	9.4e-113
WP_108168722.1|3593506_3593815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186531.1|3593816_3595688_-	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	61.3	4.5e-230
WP_023306764.1|3595791_3596814_-	hypothetical protein	NA	V5URT9	Shigella_phage	55.6	4.0e-47
WP_023306765.1|3596806_3597016_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_024176468.1|3597017_3597242_-	transcriptional regulator	NA	G8C7U2	Escherichia_phage	59.7	1.3e-19
WP_023150198.1|3597354_3598053_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	62.5	3.0e-78
WP_006811077.1|3598254_3598686_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_108168723.1|3598752_3599139_+	peptidase S24	NA	F1C5A0	Cronobacter_phage	59.7	1.9e-37
WP_006811079.1|3599245_3599470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296234.1|3599462_3599870_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.1e-47
WP_108168724.1|3599823_3600435_+	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	47.2	6.6e-37
WP_023306768.1|3600424_3600847_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	66.4	1.6e-45
WP_023306770.1|3600950_3601262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050710.1|3601251_3601461_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	97.1	4.4e-33
WP_023306771.1|3601415_3602588_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.0	8.3e-206
>prophage 6
NZ_CP028538	Enterobacter hormaechei strain SCEH020042 chromosome, complete genome	4776104	4052564	4103691	4776104	protease,lysis,tail,portal,tRNA,terminase,head,integrase,plate,capsid	Erwinia_phage(37.29%)	71	4058653:4058703	4103871:4103921
WP_022649449.1|4052564_4053578_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	5.3e-108
WP_001144069.1|4053814_4054030_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003862574.1|4054145_4055891_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_071530993.1|4055908_4056028_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_006812010.1|4056044_4057889_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_023306981.1|4057991_4058498_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4058653:4058703	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
WP_023135249.1|4058855_4059074_-	phage late control gene	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
WP_096185612.1|4059140_4060310_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	100.0	5.6e-210
WP_001630830.1|4060306_4060792_-|tail	Phage-related tail protein	tail	S4TUC3	Salmonella_phage	98.1	2.6e-84
WP_096185610.1|4060804_4063246_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	95.2	0.0e+00
WP_032159022.1|4063238_4063376_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	97.8	1.2e-18
WP_096185608.1|4063390_4063726_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	99.1	1.8e-52
WP_001550210.1|4063788_4064310_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	100.0	1.7e-94
WP_096185606.1|4064325_4065504_-|tail	phage tail protein	tail	Q37844	Escherichia_phage	95.4	5.4e-213
WP_096185603.1|4065632_4066088_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	47.8	6.0e-27
WP_096185600.1|4066054_4068076_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	53.9	3.2e-104
WP_079825733.1|4068082_4068616_-|tail	phage tail protein I	tail	Q37841	Escherichia_phage	92.6	2.1e-95
WP_096185597.1|4068608_4069517_-|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	94.4	2.8e-153
WP_089620308.1|4069523_4069871_-|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	98.3	9.4e-57
WP_044068232.1|4069867_4070503_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	96.2	4.3e-108
WP_096185595.1|4070571_4071021_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	96.6	8.7e-71
WP_016243398.1|4071013_4071481_-	hypothetical protein	NA	A0A218M4K6	Erwinia_phage	99.4	4.2e-84
WP_001384078.1|4071443_4071617_-	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_096185593.1|4071588_4071999_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	75.7	1.7e-49
WP_096185591.1|4071998_4072430_-	lysA protein	NA	A0A218M4L6	Erwinia_phage	83.2	4.4e-64
WP_063408324.1|4072426_4072939_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	97.6	3.0e-91
WP_001437784.1|4072922_4073144_-	primosomal protein	NA	A0A218M4L5	Erwinia_phage	98.6	8.4e-35
WP_042325371.1|4073134_4073338_-|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	97.0	2.6e-30
WP_044068245.1|4073337_4073847_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	98.8	1.1e-90
WP_096185588.1|4073940_4074690_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	87.6	6.9e-113
WP_096185585.1|4074693_4075761_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	99.4	2.9e-197
WP_096185582.1|4075836_4076691_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	96.8	4.1e-154
WP_096185580.1|4076856_4078626_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	99.7	0.0e+00
WP_096185578.1|4078625_4079672_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	95.1	1.2e-190
WP_096185576.1|4079692_4079893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096185573.1|4079806_4079989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096185570.1|4079974_4080160_+	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	75.0	7.3e-08
WP_047721256.1|4080156_4080888_-	hypothetical protein	NA	Q37850	Escherichia_phage	95.1	3.6e-130
WP_053004566.1|4080969_4081410_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	99.3	5.5e-70
WP_096185562.1|4081528_4083745_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.6	0.0e+00
WP_096185560.1|4083746_4083968_-	hypothetical protein	NA	A0A218M4I6	Erwinia_phage	79.5	2.2e-27
WP_047721253.1|4083967_4084195_-	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	78.7	3.4e-23
WP_001550179.1|4084264_4084465_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	92.4	3.7e-29
WP_047721252.1|4084451_4084679_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	93.3	3.9e-35
WP_096185558.1|4084686_4085196_-	hypothetical protein	NA	Q6K1F8	Salmonella_virus	86.4	9.9e-79
WP_024138324.1|4085226_4085490_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	72.4	7.4e-30
WP_096185556.1|4085582_4086212_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	56.6	7.9e-62
WP_047721250.1|4086211_4087255_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	96.8	6.3e-197
WP_108168786.1|4088174_4088513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108168744.1|4088521_4089136_-|tail	phage tail protein	tail	K7PM97	Enterobacterial_phage	68.2	1.0e-66
WP_108168745.1|4089149_4090811_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.5	0.0e+00
WP_108168746.1|4090794_4091151_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	98.3	1.2e-59
WP_108168747.1|4091108_4091300_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_108168748.1|4091426_4091870_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.1	1.4e-76
WP_108168749.1|4091869_4092163_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	81.4	1.2e-41
WP_023304516.1|4092155_4092494_-	hypothetical protein	NA	A0A2H4JHK5	uncultured_Caudovirales_phage	48.6	5.1e-23
WP_108168787.1|4092490_4093717_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	9.9e-234
WP_108168750.1|4093727_4094288_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.0e-100
WP_108168751.1|4094339_4095506_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.0	2.6e-215
WP_108168752.1|4095749_4096523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168788.1|4096565_4096802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108168753.1|4097169_4098534_-	hypothetical protein	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	96.0	2.7e-256
WP_014072026.1|4098530_4098899_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	98.4	1.8e-61
WP_048288911.1|4098895_4099123_-	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	87.8	1.0e-27
WP_039274485.1|4099115_4099301_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	96.7	4.7e-23
WP_023304529.1|4099293_4099506_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	5.3e-10
WP_023304530.1|4099699_4099894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168754.1|4100407_4101187_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	52.0	4.3e-41
WP_071882736.1|4101195_4101405_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_108168789.1|4101547_4101907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108168790.1|4102269_4103691_-|integrase	integrase	integrase	H7BV31	unidentified_phage	27.2	8.8e-08
4103871:4103921	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAATTT	NA	NA	NA	NA
>prophage 1
NZ_CP028536	Enterobacter hormaechei strain SCEH020042 plasmid pNDM5_020042, complete sequence	45048	0	11322	45048		Streptococcus_phage(33.33%)	11	NA	NA
WP_004221702.1|3651_3837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004221700.1|3794_4007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557557.1|4069_4345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510385.1|4362_4617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196235.1|4726_5548_-	sprT domain-containing protein	NA	NA	NA	NA	NA
WP_023408316.1|5544_5724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000351937.1|5996_6647_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001293458.1|6684_7140_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004199098.1|7151_9479_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_000517490.1|9482_10745_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_001215543.1|10827_11322_-	hypothetical protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
>prophage 2
NZ_CP028536	Enterobacter hormaechei strain SCEH020042 plasmid pNDM5_020042, complete sequence	45048	29953	30469	45048		Tupanvirus(100.0%)	1	NA	NA
WP_001025390.1|29953_30469_-	molecular chaperone DnaJ	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 3
NZ_CP028536	Enterobacter hormaechei strain SCEH020042 plasmid pNDM5_020042, complete sequence	45048	35069	39522	45048	transposase	Escherichia_phage(40.0%)	6	NA	NA
WP_000516402.1|35069_35732_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|36112_36775_+	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000343760.1|36863_38084_-|transposase	ISL3 family transposase ISKox3	transposase	NA	NA	NA	NA
WP_001549892.1|38185_38425_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_004199403.1|38427_38784_+	hypothetical protein	NA	A0A222YZE2	Escherichia_phage	46.6	5.5e-20
WP_001067855.1|38817_39522_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP028536	Enterobacter hormaechei strain SCEH020042 plasmid pNDM5_020042, complete sequence	45048	42784	43955	45048	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001310555.1|42784_43801_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_094888173.1|43838_43955_-	sugar kinase	NA	Q6QLL3	Human_immunodeficiency_virus	97.4	1.1e-14
>prophage 1
NZ_CP028537	Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence	328828	61632	158696	328828	transposase	Salmonella_phage(25.81%)	98	NA	NA
WP_000255946.1|61632_62655_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001317493.1|62651_63434_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001284313.1|64271_65771_-	kinase	NA	NA	NA	NA	NA
WP_000081622.1|65796_67434_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|67433_68474_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|68559_69198_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|69197_69839_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
WP_024179285.1|69861_70500_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|70962_71430_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|71447_72656_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|72666_73623_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_001182411.1|73622_74702_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040059.1|74703_75477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|75469_76612_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|76621_77680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254136.1|78003_78585_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|78584_79742_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|79764_80220_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_000255079.1|80242_81283_+	tellurium resistance protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|81331_81910_+	chemical-damaging agent resistance protein C	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|81977_82553_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|82981_84223_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|84785_85067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|85116_85308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|85399_85771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|86113_86506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012006596.1|86484_86796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|87109_87403_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|87407_88733_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|88793_89000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|89101_89512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|89524_90340_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|90593_91019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|91567_91876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|91891_92749_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001194555.1|92810_93014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797838.1|93100_93280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202492.1|94469_94811_-	RamA family antibiotic efflux transcriptional regulator	NA	D0R0F8	Streptococcus_phage	29.8	2.0e-06
WP_000608644.1|95397_96660_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001067855.1|97297_98002_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000090707.1|98965_99808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351433.1|99794_101918_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_058657096.1|101917_103366_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|103406_104963_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_108168468.1|104974_105901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|106253_106553_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|107116_108943_+	hypothetical protein	NA	E5E3R2	Burkholderia_phage	22.8	4.7e-14
WP_000647571.1|109111_109462_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	1.8e-18
WP_032192123.1|109609_110041_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555737.1|110291_111767_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697965.1|111759_112440_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	1.2e-31
WP_071624363.1|112441_112567_+	outer-membrane efflux lipo domain protein	NA	NA	NA	NA	NA
WP_038988996.1|112629_114015_+	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
WP_001246155.1|114042_114396_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001398209.1|114509_115802_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011251357.1|115812_118959_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	1.2e-60
WP_000758221.1|119045_119486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038988997.1|119613_122061_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.0	3.8e-83
WP_000843501.1|122101_122299_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287499.1|122332_123070_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_001023231.1|123344_123794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925242.1|124028_125846_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|125845_126742_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_000025662.1|126781_127162_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
WP_000723069.1|128161_128596_+	copper-binding protein	NA	NA	NA	NA	NA
WP_000193209.1|128974_129793_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|129789_130995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121165.1|131058_131262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|131274_132594_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
WP_000833382.1|132844_134272_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|134486_135002_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|135004_135901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|136122_136356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|136401_136656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|136693_136981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|137017_137248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|137584_138046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|138075_138483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|138533_138851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|139227_139578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108168469.1|139687_140068_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	100.0	1.5e-44
WP_108168470.1|139983_142881_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	9.3e-182
WP_000509966.1|142975_143581_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_065313682.1|146325_146775_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	9.0e-60
WP_001067855.1|146833_147538_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000954592.1|148527_148704_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|149033_149849_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|149935_150238_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|150131_150383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|150413_151907_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|152018_152324_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058100717.1|152351_153566_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001447541.1|153782_154667_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_015344975.1|154697_156191_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|156401_156626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|156622_157360_-	resolvase	NA	NA	NA	NA	NA
WP_001550559.1|157466_157958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|157991_158696_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP028537	Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence	328828	164823	189293	328828	integrase,transposase	Escherichia_phage(50.0%)	26	173114:173173	176706:177527
WP_001067855.1|164823_165528_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012291484.1|165473_165683_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	89.5	8.9e-10
WP_063102497.1|165721_166108_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_108168472.1|166427_166820_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067855.1|167154_167859_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002914189.1|168178_169354_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|169377_172530_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|172599_173079_-	transcriptional regulator	NA	NA	NA	NA	NA
173114:173173	attL	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067855.1|173167_173872_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023145375.1|174100_174415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845048.1|174353_175367_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|175524_175998_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_001067855.1|176759_177464_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071525219.1|177454_177643_+	hypothetical protein	NA	NA	NA	NA	NA
176706:177527	attR	TTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_000105383.1|177730_179167_+	glutathione synthase	NA	NA	NA	NA	NA
WP_021546935.1|179584_180589_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_108168473.1|180770_181043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032193599.1|181087_181792_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067855.1|181821_182526_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040178261.1|182550_183801_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_042973484.1|184040_184682_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_039819674.1|184922_185273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|185504_186308_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|186307_187144_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000018321.1|187479_188295_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_001067855.1|188588_189293_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP028537	Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence	328828	233337	262135	328828	integrase,transposase	Escherichia_phage(46.15%)	34	243421:243480	260596:261416
WP_000219087.1|233337_234576_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_000589001.1|234997_236338_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000137794.1|236768_237374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|237590_237872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|238247_238559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|238781_238982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|239021_239246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781547.1|239300_239504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143014.1|239683_239977_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	38.6	4.1e-05
WP_001371932.1|240056_240548_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_001165367.1|240552_240864_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_024181853.1|241065_241284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071366.1|241380_241701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|241879_242110_-	hypothetical protein	NA	NA	NA	NA	NA
243421:243480	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|243483_244188_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000842134.1|244677_245787_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001039466.1|245881_247066_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_000113282.1|247161_247818_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|247829_248534_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550559.1|248567_249059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|249165_249903_+	resolvase	NA	NA	NA	NA	NA
WP_000743213.1|249899_250124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954592.1|250245_250422_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|250603_251608_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_042863651.1|251686_254653_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.8	0.0e+00
WP_001067855.1|254773_255478_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_108168476.1|255514_256534_-|integrase	integrase/recombinase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.1e-71
WP_032488579.1|256710_257265_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_012695455.1|257492_258233_-	hypothetical protein	NA	U5N3V8	Enterobacteria_phage	41.7	4.4e-43
WP_077249983.1|258219_259728_-|transposase	IS21-like element ISCfr8 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	32.7	9.9e-26
WP_001067855.1|259887_260592_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|260667_261168_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|261186_261366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|261295_262135_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
260596:261416	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCCCGAACGGACGTTAGATTTCGAGTTCTAGGCGTTCTGCGATGAAGGTTGGATCCCAGCCGGGATTGAAAGTGTCGACGTGGGTGAATCCGAGCCGCTCGTATAGGCCACGCAGGTTCGGGTGGCAGTCGAGCCGCAGCTTGGCGCACCCCTGCGTTCGCGCGGCATGGCGGCAAGCCTCGATCAGCGCGGAGCTGACACCCCGGCCCGCATGTGTCCGTCGCACCGCGAGCTTGTGCAGATATGCGGCCTCCCCCTTGAGGGCGTCGGGCCAGAACTCGGGATCCTCGGCCGACAAGGTGCAACAGCCGACGATGCCGTCGCTGCAACTCGCGACTAGGAGCTCGGATCTCAGGACGAAGGTCTCCGCGAATGTCCGGTCGATCCGCGCGACGTCCCAGGCGGGCGTTCCCTTGGCGGACATCCACGCCGCAGCGTCGTGCATCAGCCGCACAACCTCGTCGATATCACCCGAGCAGGCGACCCGAACGTTCGGAGGCTCCTCGCTGTCCATTCGCTCCCCTGGCGCGGTATGAACCGCCGCCTCATAGTGCAGTTTGATCCTGACGAGCCCAGCATGTCTGCGCCCACCTTCGCGGAACCTGACCAGGGTCCGCTAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCTCGGTCTCTGGCGTCGCGACTGCGAAATTTCGCGAGGGTTTCCGAGAAGGTGATTGCGCTTCGCAGATCTCCAGGCGCGTGGGTGCGGACGTAGTCAGCGCCA	NA	NA	NA	NA
