The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	165241	263900	4754025	portal,tail,holin,lysis,tRNA,plate,protease,capsid,transposase,integrase,terminase,head	Escherichia_phage(35.56%)	98	180120:180139	274613:274632
WP_000560983.1|165241_165679_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|165723_166665_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001357065.1|166728_167637_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|167865_168177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|168177_168468_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|168826_169105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314326.1|169500_169719_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000027710.1|169942_170872_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001357064.1|170868_171504_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|171500_172403_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077627280.1|172415_175466_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753585.1|175659_176493_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|177488_178883_+	glycoporin	NA	NA	NA	NA	NA
WP_001357063.1|178923_179238_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179744.1|179247_180072_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
180120:180139	attL	CGATCTGTAGGCCGGATAAG	NA	NA	NA	NA
WP_001357062.1|180164_181424_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144110.1|181420_182890_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217156.1|183177_184014_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001357061.1|183997_184936_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063508.1|184932_185967_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001298417.1|186252_186873_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	8.4e-64
WP_107629864.1|187151_188117_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270239.1|188265_188940_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001357059.1|189044_190418_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|190414_191113_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001357058.1|191262_191763_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|191949_192930_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|192999_193293_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|193429_193702_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|193871_194372_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|194435_194660_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001357057.1|194659_194962_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	97.0	5.0e-46
WP_001113264.1|194961_195186_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|195182_195458_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001357056.1|195447_197763_+	replication endonuclease	NA	Q858T4	Yersinia_virus	96.2	0.0e+00
WP_001357055.1|197777_198824_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	2.9e-08
WP_000038148.1|201706_202741_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	3.2e-201
WP_001357052.1|202740_204513_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085978.1|204686_205541_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.6	6.2e-134
WP_001248578.1|205599_206673_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.2	3.3e-201
WP_024262840.1|206676_207420_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	98.8	6.2e-122
WP_000988636.1|207519_208029_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846399.1|208028_208232_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|208235_208517_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001357049.1|208516_209014_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
WP_001357048.1|209028_209454_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.3e-60
WP_001357047.1|209441_209867_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.0	6.8e-65
WP_000917180.1|209974_210442_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
WP_001001807.1|210434_210887_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	4.1e-76
WP_000127163.1|211584_211932_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121474.1|211936_212845_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001357046.1|212837_213368_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.9	4.3e-101
WP_001357045.1|213378_215307_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	71.3	1.0e-224
WP_001357044.1|215310_215838_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	94.3	4.4e-90
WP_032301962.1|216059_216653_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	94.9	9.7e-102
WP_001286703.1|216983_218174_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_001251408.1|218186_218705_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|218761_219037_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|219069_219189_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001357042.1|219181_221629_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.2	0.0e+00
WP_000978910.1|221643_222123_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_000882980.1|222122_223286_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	6.3e-206
WP_000468308.1|223367_223586_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|223821_224724_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001318165.1|224904_225867_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758727.1|226186_227176_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001357041.1|227282_228038_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|228092_228860_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802217.1|228967_229567_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|229667_230108_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|230319_230619_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|230645_231074_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|231078_231825_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|231921_232932_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|233102_234611_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|234633_235479_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|235903_236149_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|236233_236719_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|236811_237738_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|237804_239136_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|239145_239676_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|239768_240728_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|240819_241845_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001340148.1|242000_244199_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|244401_244614_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000702302.1|244674_245283_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|245342_245660_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_001357040.1|245936_247097_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110759.1|247099_249532_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000275563.1|249749_250610_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001357039.1|250686_252306_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000105532.1|254118_255243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694066.1|255375_256929_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.0e-09
WP_000007515.1|257310_258201_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001296626.1|258529_260710_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001271242.1|260803_261709_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647862.1|261735_262353_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_106426573.1|262552_263900_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
274613:274632	attR	CGATCTGTAGGCCGGATAAG	NA	NA	NA	NA
>prophage 2
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	647510	661491	4754025	integrase,transposase	Enterobacteria_phage(72.73%)	15	642544:642559	667782:667797
642544:642559	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000772677.1|647510_648779_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.1e-73
WP_001357997.1|648885_649680_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	28.6	8.3e-08
WP_001357996.1|649707_650775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000931915.1|650777_651179_-	protein gop	NA	NA	NA	NA	NA
WP_000446132.1|651589_652162_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|652235_652736_-	transactivation protein	NA	NA	NA	NA	NA
WP_024262875.1|652732_653467_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	2.6e-128
WP_001149160.1|654018_654285_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_024262874.1|654281_654872_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|654864_655152_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_001357995.1|655144_655600_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001357994.1|655735_656056_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001357993.1|656070_658404_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
WP_044815386.1|658758_658953_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_085948128.1|660277_661491_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	6.8e-102
667782:667797	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 3
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	1043578	1055053	4754025	integrase	Enterobacteria_phage(88.89%)	11	1042758:1042771	1060528:1060541
1042758:1042771	attL	TAAAAACATCGCTG	NA	NA	NA	NA
WP_001356950.1|1043578_1044754_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.7	2.5e-141
WP_001356949.1|1044754_1046455_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001356948.1|1046451_1048074_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	24.4	8.2e-10
WP_000446132.1|1048274_1048847_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_032340366.1|1048920_1049421_-	transactivation protein	NA	NA	NA	NA	NA
WP_001356946.1|1049417_1050152_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.8e-129
WP_001356944.1|1050704_1050971_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
WP_032340365.1|1050967_1051522_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	79.3	1.2e-40
WP_001356942.1|1051514_1051802_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	95.8	4.3e-47
WP_001356941.1|1051794_1052250_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001356939.1|1052719_1055053_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
1060528:1060541	attR	CAGCGATGTTTTTA	NA	NA	NA	NA
>prophage 4
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	1293485	1348339	4754025	portal,tail,lysis,tRNA,protease,capsid,integrase,terminase,head	Enterobacteria_phage(55.17%)	70	1287955:1287970	1349483:1349498
1287955:1287970	attL	GCGCCTGGCGTAACGC	NA	NA	NA	NA
WP_000912345.1|1293485_1294871_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143520.1|1294906_1295428_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1295535_1295748_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|1295749_1296616_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001357000.1|1296978_1298142_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	2.4e-197
WP_000446905.1|1297997_1298369_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|1298340_1298619_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|1298666_1298885_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001386642.1|1298983_1299265_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_001356999.1|1299275_1299833_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|1299825_1299987_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186833.1|1299983_1300664_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|1300660_1301446_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|1301451_1301748_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|1301823_1302030_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|1302626_1303316_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1303420_1303651_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|1303719_1304259_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001551200.1|1304345_1305275_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_000788815.1|1305271_1305973_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
WP_000145915.1|1305969_1306272_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|1306339_1306672_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001299444.1|1306719_1306869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356996.1|1306926_1308453_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	28.0	7.9e-31
WP_001445652.1|1308917_1309469_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1309478_1310276_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1310392_1310494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356995.1|1310490_1310946_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224914.1|1310945_1311116_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1311108_1311399_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001356994.1|1311395_1311758_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
WP_001307651.1|1311754_1311895_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	8.5e-09
WP_001204780.1|1311980_1312364_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001356992.1|1312552_1313635_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	2.0e-153
WP_000839596.1|1314223_1314439_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|1314438_1314936_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_077628513.1|1315152_1315335_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_000738423.1|1315425_1315719_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001307652.1|1316078_1316273_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453611.1|1316661_1317207_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027269.1|1317181_1319107_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198153.1|1319103_1319310_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001357874.1|1319306_1320908_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	6.1e-308
WP_001357873.1|1320888_1322208_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	1.0e-231
WP_001357872.1|1322217_1322550_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	8.4e-55
WP_001357871.1|1322605_1323631_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_000158875.1|1323672_1324068_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|1324079_1324433_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_001357870.1|1325018_1325414_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	2.9e-70
WP_001357869.1|1325421_1326162_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	1.6e-130
WP_001357868.1|1326177_1326600_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_000459457.1|1326581_1327016_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001357867.1|1327008_1329570_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.0	0.0e+00
WP_000847347.1|1329566_1329896_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001357866.1|1329895_1330594_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_000194779.1|1330599_1331343_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090917.1|1331279_1331912_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_001230378.1|1335436_1336036_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	4.4e-110
WP_024262868.1|1336100_1339127_+|tail	tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_001357863.1|1339126_1339702_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	4.2e-102
WP_000086527.1|1339799_1340390_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836772.1|1340706_1340940_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_120795384.1|1341008_1341122_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239881.1|1341487_1342156_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|1343018_1343768_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001357862.1|1344017_1344971_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001695516.1|1345445_1345754_-|integrase	tyrosine-type recombinase/integrase	integrase	Q76H30	Enterobacteria_phage	69.3	1.8e-38
WP_001695517.1|1345773_1346073_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	82.4	5.0e-30
WP_000239877.1|1346485_1347154_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001357859.1|1347385_1348339_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
1349483:1349498	attR	GCGTTACGCCAGGCGC	NA	NA	NA	NA
>prophage 5
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	1919949	1973798	4754025	portal,holin,tail,tRNA,protease,integrase,terminase	Enterobacteria_phage(45.45%)	61	1915044:1915058	1921524:1921538
1915044:1915058	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074983.1|1919949_1921068_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|1921036_1921306_-	excisionase	NA	NA	NA	NA	NA
WP_001356839.1|1921367_1923839_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
1921524:1921538	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|1923931_1924123_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1924119_1924308_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|1924707_1924872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|1924875_1925094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1925253_1925409_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000787428.1|1925614_1926022_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|1926098_1926326_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|1926309_1926861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001357499.1|1926832_1927873_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.6	6.9e-87
WP_159065192.1|1927865_1928327_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	2.9e-85
WP_001357497.1|1928361_1929108_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.9	3.9e-108
WP_122368318.1|1929104_1929269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032340380.1|1929967_1930726_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1931008_1931221_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001357494.1|1931441_1931702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032340379.1|1931768_1932047_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001357493.1|1932048_1933107_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	9.8e-89
WP_001357492.1|1933107_1933488_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	4.1e-37
WP_001357491.1|1933484_1934306_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.3	1.1e-79
WP_001341380.1|1934945_1935377_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_001357487.1|1935869_1936040_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.4	9.7e-23
WP_000411802.1|1936506_1936713_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075159.1|1936712_1937210_+	lysozyme	NA	A5LH83	Enterobacteria_phage	100.0	1.3e-91
WP_134235334.1|1937426_1937612_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	1.9e-19
WP_000232224.1|1937695_1938058_+	hypothetical protein	NA	A5LH85	Enterobacteria_phage	99.2	8.9e-66
WP_000421824.1|1938509_1939049_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	3.0e-94
WP_024262851.1|1939057_1941157_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|1941153_1941366_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001357481.1|1941365_1942874_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.5e-287
WP_077627454.1|1942818_1944846_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_001097050.1|1944932_1945256_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1945248_1945524_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677112.1|1945535_1946114_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_001079419.1|1946110_1946512_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211123.1|1946522_1947266_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1947326_1947713_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|1947721_1948051_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000447253.1|1951086_1951416_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152388.1|1951425_1952124_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	8.6e-134
WP_071987287.1|1952128_1952872_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	5.7e-152
WP_032340378.1|1952769_1953417_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	5.0e-112
WP_001357476.1|1953477_1956873_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
WP_001357475.1|1956940_1957540_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.8e-101
WP_024262850.1|1957604_1958918_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_001023999.1|1958919_1959189_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	1.7e-42
WP_077627453.1|1959460_1960096_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	75.3	1.8e-61
WP_024262848.1|1961378_1962005_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.8	5.9e-25
WP_024262847.1|1962188_1962779_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001357468.1|1963238_1963403_+|tail	phage tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	87.2	8.5e-16
WP_000799402.1|1963635_1964499_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1964482_1965619_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1965868_1967095_+	peptidase T	NA	NA	NA	NA	NA
WP_001357466.1|1967143_1968265_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000734671.1|1968340_1969801_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1969800_1970472_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_001357465.1|1970640_1972011_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	3.6e-107
WP_001295971.1|1972014_1972656_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|1972691_1973798_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	2707067	2764497	4754025	portal,tail,holin,capsid,transposase,integrase,terminase,head	Enterobacteria_phage(35.29%)	68	2716219:2716278	2764550:2764611
WP_107629894.1|2707067_2708141_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_001357750.1|2709358_2710210_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_001357749.1|2710317_2711676_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_024191816.1|2711675_2712347_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000920127.1|2712479_2712893_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001357747.1|2713001_2714006_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240076.1|2714006_2714642_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007792.1|2714898_2715549_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
2716219:2716278	attL	TGGCGGAGAGAGGGGGATTTGAACCCCCGGTGGAGTTGCCCCCACTCCGGTTTTCGAGAC	NA	NA	NA	NA
WP_000938107.1|2716993_2717563_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_095111390.1|2718692_2718824_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950813.1|2719170_2720151_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101707.1|2720327_2720597_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000268803.1|2720598_2721912_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.3	1.2e-75
WP_024262859.1|2721976_2722600_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	3.9e-69
WP_001357743.1|2722668_2726145_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.6	0.0e+00
WP_000649825.1|2726278_2726806_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	61.0	2.1e-60
WP_097479149.1|2726996_2727629_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	4.9e-104
WP_001357741.1|2727574_2728318_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	5.6e-147
WP_001357740.1|2728323_2729022_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|2729021_2729351_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082334.1|2729347_2731927_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
WP_000533425.1|2731907_2732321_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|2732347_2732779_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001357739.1|2732792_2733545_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000683066.1|2733552_2733948_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|2733944_2734478_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204547.1|2734493_2734847_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201525.1|2734839_2735214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|2735265_2736294_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|2736351_2736699_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253961.1|2736735_2738241_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000831765.1|2738230_2739823_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259002.1|2739819_2740026_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001300238.1|2740009_2741938_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
WP_000235436.1|2741909_2742419_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|2742821_2743046_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|2743127_2743442_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2743969_2744155_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|2744376_2744490_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|2744710_2745244_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|2745403_2745676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|2745931_2746138_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_001358067.1|2746585_2748436_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_001344632.1|2748878_2749010_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000762860.1|2749606_2750428_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000904093.1|2750424_2750799_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.4e-35
WP_001265045.1|2750811_2751861_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	7.9e-107
WP_001410105.1|2751862_2752141_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000813254.1|2752307_2752463_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001358068.1|2752534_2753623_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_001278455.1|2753809_2753914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207995.1|2754029_2754899_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.2	1.0e-120
WP_000224233.1|2754909_2755173_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000256993.1|2755174_2755393_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
WP_000935420.1|2755425_2755638_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001358070.1|2756064_2756490_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.7	2.4e-62
WP_000095671.1|2756530_2757493_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693916.1|2757515_2757941_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2757924_2758248_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948452.1|2758372_2758849_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379593.1|2759167_2759323_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171966.1|2759482_2759701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358071.1|2759704_2759869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2760269_2760458_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2760454_2760646_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001358072.1|2760738_2763210_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.7	1.1e-58
WP_000067202.1|2763268_2763472_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|2763471_2764497_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
2764550:2764611	attR	TGGCGGAGAGAGGGGGATTTGAACCCCCGGTGGAGTTGCCCCCACTCCGGTTTTCGAGACCG	NA	NA	NA	NA
>prophage 7
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	2883804	2937479	4754025	portal,holin,lysis,tRNA,protease,capsid,transposase,integrase,tail,terminase,head	Escherichia_phage(31.71%)	64	2871014:2871031	2927678:2927695
2871014:2871031	attL	GGAAGAGATCGACGCCCG	NA	NA	NA	NA
WP_085948123.1|2883804_2884972_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
WP_100249772.1|2885482_2885539_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001247931.1|2885959_2886658_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_001592261.1|2887126_2888146_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_001358129.1|2888179_2889160_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.2	8.5e-87
WP_001592264.1|2889521_2890100_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	59.0	5.6e-54
WP_001023457.1|2890213_2890483_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	4.2e-44
WP_001592266.1|2890484_2891798_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	97.3	8.8e-79
WP_001228241.1|2891862_2892462_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_085948129.1|2892530_2893744_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.4	2.6e-101
WP_001358132.1|2893764_2894040_-|tail	tail protein	tail	A0A2I6TC77	Escherichia_phage	96.6	1.5e-44
WP_001358133.1|2894047_2894443_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.1e-69
WP_001358134.1|2894439_2894973_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	73.4	3.6e-63
WP_001358135.1|2894984_2895338_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.0e-62
WP_001358136.1|2895349_2895748_-	phage DNA-packaging protein	NA	A0A2R9YJP4	Escherichia_phage	94.7	3.0e-59
WP_001358137.1|2895789_2896554_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.0	2.6e-139
WP_021559942.1|2896699_2896885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358138.1|2896929_2897691_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_001356805.1|2898683_2899292_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.1	5.4e-100
WP_001356806.1|2899371_2899755_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_021559944.1|2899766_2900108_-|head	head decoration protein	head	NA	NA	NA	NA
WP_001356808.1|2900117_2901158_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.4	2.6e-65
WP_001356809.1|2901375_2901825_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001356810.1|2901821_2902079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356812.1|2904115_2904415_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001091145.1|2904432_2904654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|2904654_2904846_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_021559945.1|2904845_2905031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064716654.1|2905023_2905311_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_021559946.1|2905366_2905561_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_021559947.1|2905585_2906311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021559948.1|2906351_2906585_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001365132.1|2907953_2908223_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
WP_001356817.1|2908284_2908617_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	7.1e-54
WP_001356818.1|2908626_2909946_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.4e-233
WP_001356819.1|2909926_2911528_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|2911524_2911731_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_024235691.1|2911727_2913653_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|2913627_2914173_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000881326.1|2914662_2915280_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001357156.1|2915429_2915867_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	2.9e-71
WP_000075143.1|2915863_2916361_-	lysozyme	NA	H6WZK1	Escherichia_phage	98.8	3.8e-91
WP_000284524.1|2916360_2916576_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2916718_2917117_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2917197_2917356_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2917441_2918185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235438.1|2918436_2919060_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	98.1	4.4e-113
WP_021559685.1|2919056_2919722_-	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	97.3	1.4e-128
WP_024229307.1|2919718_2920339_-	recombination protein NinG	NA	Q716C3	Shigella_phage	97.1	3.7e-96
WP_000566997.1|2920331_2920502_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_016063117.1|2920498_2920681_-	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_000814618.1|2920677_2921088_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	2.0e-69
WP_000229808.1|2921095_2921302_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_000145926.1|2921374_2921665_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_085948123.1|2921977_2923145_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
WP_071792051.1|2923185_2924133_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.2	3.3e-168
WP_001357162.1|2924476_2925724_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001197878.1|2925723_2928846_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
2927678:2927695	attR	CGGGCGTCGATCTCTTCC	NA	NA	NA	NA
WP_021541090.1|2928846_2931924_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001357165.1|2931924_2933340_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675178.1|2933336_2934740_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|2934736_2935459_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001300972.1|2935638_2935971_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476019.1|2936117_2937479_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
>prophage 8
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	3209574	3257151	4754025	portal,tail,holin,tRNA,plate,capsid,transposase,integrase,terminase,head	Enterobacteria_phage(75.56%)	56	3212580:3212599	3251210:3251229
WP_001283598.1|3209574_3210387_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|3210386_3211400_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004835.1|3211465_3212623_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	4.6e-23
3212580:3212599	attL	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000023402.1|3212781_3213786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001390705.1|3213882_3214203_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_089627012.1|3214316_3214604_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	53.7	1.9e-23
WP_089627013.1|3214610_3214817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813363.1|3215069_3215411_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	2.3e-55
WP_000158971.1|3215421_3215709_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|3215720_3215963_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|3215959_3216073_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|3216159_3216363_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153676.1|3216359_3216605_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	100.0	6.7e-41
WP_000104308.1|3216601_3216901_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_157839808.1|3216912_3217530_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	44.7	2.2e-11
WP_107629906.1|3217526_3217892_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	3.3e-60
WP_159065193.1|3217898_3220724_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.4	0.0e+00
WP_107629908.1|3220909_3221755_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	26.6	1.6e-09
WP_000588792.1|3221772_3223470_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000087812.1|3224160_3225207_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_107629910.1|3225206_3226958_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262688.1|3227112_3227949_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_001055104.1|3227972_3229025_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001559525.1|3229070_3229871_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	90.2	2.1e-128
WP_000063082.1|3229973_3230468_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|3230467_3230668_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|3230670_3230994_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|3230990_3231383_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780546.1|3231379_3231787_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.1	6.1e-63
WP_107629912.1|3231924_3232392_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	1.4e-84
WP_000356339.1|3232384_3233020_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271925.1|3233016_3233598_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-102
WP_000213447.1|3233594_3233945_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_089648569.1|3233948_3234845_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	2.1e-156
WP_107629914.1|3234837_3235368_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	5.6e-93
WP_107629916.1|3235370_3237530_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	62.8	6.1e-194
WP_107629918.1|3237531_3238056_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	95.4	7.5e-90
WP_107629919.1|3238084_3238618_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	97.7	6.7e-94
WP_021513639.1|3239645_3240233_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	1.7e-103
WP_000979945.1|3240268_3240757_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_107629921.1|3240769_3243577_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.9	0.0e+00
WP_000333503.1|3243563_3243719_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_040090535.1|3243727_3244102_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	72.5	9.0e-37
WP_000290462.1|3244157_3244670_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005386.1|3244669_3245854_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_000132855.1|3246011_3247121_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000604994.1|3247243_3248029_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|3248224_3248485_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_107629922.1|3248625_3249714_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.0e-08
WP_032140709.1|3249777_3249918_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
WP_001353016.1|3250167_3250365_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000215754.1|3250309_3251101_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.6	5.1e-66
WP_001357240.1|3251330_3252326_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
3251210:3251229	attR	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_001357241.1|3252322_3253501_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817183.1|3253765_3254986_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_001357242.1|3255144_3257151_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	3627933	3635073	4754025		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3627933_3630495_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141304.1|3630600_3631257_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001298167.1|3631307_3632075_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_001357574.1|3632270_3633179_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	7.3e-117
WP_000590411.1|3633175_3634438_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|3634434_3635073_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 10
NZ_CP027103	Escherichia coli strain RM14723 chromosome, complete genome	4754025	3849215	3910323	4754025	protease,transposase,tRNA,integrase	Enterobacteria_phage(25.0%)	50	3850912:3850927	3890690:3890705
WP_032155039.1|3849215_3849713_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001305312.1|3849807_3850515_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3850594_3851326_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
3850912:3850927	attL	CATTACGCCACTTTTT	NA	NA	NA	NA
WP_000593259.1|3851338_3852289_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3852397_3852961_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3852960_3853377_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_021560029.1|3853550_3854531_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3854548_3855253_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3855270_3855837_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3855833_3856124_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|3856131_3856725_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001357634.1|3856717_3857854_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001357635.1|3857918_3858926_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394107.1|3859042_3860089_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3860264_3860984_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107565.1|3861167_3861494_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786907.1|3861493_3862213_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001357636.1|3862373_3863426_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3863453_3863729_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3863793_3864873_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3865074_3866331_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001357637.1|3866379_3868515_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234491.1|3868913_3869621_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001219010.1|3869961_3871224_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	35.1	4.3e-67
WP_001228211.1|3871495_3872377_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000193312.1|3873019_3873235_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.2	2.5e-15
WP_000201180.1|3873231_3873702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001357638.1|3874372_3876568_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000109324.1|3876767_3877385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001357639.1|3877384_3878446_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_100199205.1|3880129_3881478_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001357643.1|3883688_3885884_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_021560034.1|3886808_3888047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000895362.1|3888046_3888670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021560035.1|3888669_3892335_-	ATP-binding protein	NA	NA	NA	NA	NA
3890690:3890705	attR	AAAAAGTGGCGTAATG	NA	NA	NA	NA
WP_001178367.1|3892606_3893653_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	2.9e-08
WP_001357644.1|3893857_3894409_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_001357645.1|3894410_3895589_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001357646.1|3895585_3896563_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_021560036.1|3896559_3897165_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820077.1|3897161_3897533_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001357648.1|3897529_3898093_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001087289.1|3898096_3898552_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001357649.1|3898568_3899792_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001357650.1|3899791_3901285_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_000498844.1|3901284_3903345_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_001357651.1|3903374_3904334_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001298257.1|3904351_3904762_-	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_001357652.1|3904827_3905637_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001357653.1|3905766_3910323_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
