The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	1024973	1038156	4719625		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1024973_1025735_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1025728_1026355_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1026494_1027634_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1027696_1028689_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1028782_1030147_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1030235_1031012_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1031016_1031655_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1031651_1032914_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1032910_1033819_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1034014_1034782_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1034832_1035489_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1035594_1038156_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	1684100	1693541	4719625		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569315.1|1684100_1685027_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1685031_1685763_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1685743_1685851_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1685910_1686642_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1686863_1688549_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1688545_1689265_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1689311_1689782_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1689821_1690283_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001375261.1|1690407_1692408_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001333512.1|1692404_1693541_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
NZ_CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	2235751	2260899	4719625	lysis,integrase	Enterobacteria_phage(40.0%)	36	2231041:2231056	2254971:2254986
2231041:2231056	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000041675.1|2235751_2238178_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|2238376_2238682_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2238789_2239500_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2239502_2240063_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2240097_2240439_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2240573_2240900_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2241105_2242320_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2242331_2243351_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2243408_2243519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|2243538_2244819_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|2244853_2245090_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_061362252.1|2245177_2247649_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2247741_2247933_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2247929_2248118_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001329848.1|2248517_2248682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2248685_2248904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2249063_2249219_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000448564.1|2249385_2249793_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_061362251.1|2249876_2250104_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001047135.1|2250787_2251540_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2251817_2251907_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2251961_2252174_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2252474_2252690_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2253443_2253659_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2253663_2253975_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2253971_2254505_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2254501_2254999_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2254971:2254986	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2255361_2255574_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2255584_2255773_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2255775_2255841_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2255920_2256076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2256247_2256421_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2256572_2256983_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2257040_2257274_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|2257662_2258208_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_000078177.1|2260308_2260899_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
>prophage 4
NZ_CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	2923754	2982193	4719625	portal,tRNA,terminase,tail,protease	Salmonella_phage(21.74%)	52	NA	NA
WP_000886683.1|2923754_2925047_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2925137_2926481_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2926491_2927103_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|2927261_2931251_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2931385_2931880_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2932424_2933390_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043592.1|2933512_2935279_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_001202175.1|2935279_2937001_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|2937042_2937747_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2938031_2938250_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2938934_2941211_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2941241_2941562_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2941884_2942109_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188144.1|2942181_2944128_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746443.1|2944124_2945240_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|2945390_2946347_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599825.1|2946343_2948002_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|2948427_2949123_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|2949617_2950517_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|2950660_2952313_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178676.1|2952324_2953293_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815337.1|2953425_2955144_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000566376.1|2955180_2956182_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|2956192_2957623_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|2957721_2958735_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001252135.1|2958731_2959562_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|2959558_2959882_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|2960007_2960523_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|2960740_2961469_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|2961486_2962218_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|2962224_2962941_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|2962940_2963609_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001352074.1|2963899_2964631_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149682.1|2964829_2965957_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_000389260.1|2965997_2966486_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|2966545_2967391_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|2967387_2968341_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|2968350_2969484_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126072.1|2969578_2970691_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|2971041_2971518_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|2971605_2972508_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_061362179.1|2972568_2973291_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|2973274_2973562_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|2973721_2973979_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|2974008_2974386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|2974655_2976341_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|2976576_2976795_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_032258247.1|2976885_2977986_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.8	3.4e-177
WP_032258246.1|2977982_2978468_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_032258252.1|2978464_2979217_-|tail	tail protein	tail	E5G6Q1	Salmonella_phage	75.0	2.8e-90
WP_001098431.1|2979392_2981159_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_032258245.1|2981158_2982193_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.0	2.4e-172
>prophage 5
NZ_CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	3530307	3594921	4719625	holin,tail,transposase,integrase	Shigella_phage(44.44%)	56	3547257:3547273	3581736:3581752
WP_000131044.1|3530307_3532341_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3532469_3533057_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3533070_3534543_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3534556_3536227_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3536439_3537108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3537350_3538046_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3538038_3539466_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3539476_3540196_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3540722_3541577_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3541802_3543128_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3543236_3543473_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3543484_3544078_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3544667_3545519_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3547257:3547273	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|3549046_3549148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3549511_3549775_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3549774_3549915_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3549949_3550177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3551000_3551543_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3551617_3552205_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3552262_3552931_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3552956_3555482_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3555471_3557115_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3557083_3557794_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3558106_3558436_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070700.1|3560491_3561181_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3561177_3562134_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|3562130_3564329_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3564338_3565295_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3565273_3565684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061362275.1|3566239_3570694_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
WP_032199983.1|3571231_3571816_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.9e-106
WP_044064314.1|3571815_3573723_-|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	61.2	1.4e-05
WP_001020632.1|3575014_3575707_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|3576409_3576772_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|3576837_3577662_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3577789_3578326_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3578316_3578679_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206737.1|3578678_3578984_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	5.8e-50
WP_000433939.1|3578983_3579334_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051894.1|3579210_3580374_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	4.5e-228
WP_000893278.1|3580578_3581832_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3581736:3581752	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|3581843_3582947_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749867.1|3583234_3584290_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_000174677.1|3584328_3584730_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189532.1|3584787_3586032_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3586123_3586582_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|3586842_3588300_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001326471.1|3588356_3588893_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001295202.1|3588825_3589092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059892.1|3589397_3589850_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263489.1|3589859_3590258_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554758.1|3590260_3590554_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3590605_3591661_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001333407.1|3591731_3592502_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_107328609.1|3592461_3594195_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000006255.1|3594423_3594921_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	3885463	3909765	4719625	lysis,tail,integrase	Escherichia_phage(39.29%)	29	3894190:3894205	3916308:3916323
WP_000490275.1|3885463_3885625_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295410.1|3885751_3886357_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|3886749_3888336_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_021545883.1|3888555_3888804_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	2.0e-37
WP_001378647.1|3889321_3889618_+	hypothetical protein	NA	A0A291AWW6	Escherichia_phage	99.0	6.8e-48
WP_029402452.1|3889953_3890457_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	99.4	1.5e-90
WP_107328611.1|3890982_3891567_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	4.3e-102
WP_072310656.1|3891566_3893294_-|tail	phage tail protein	tail	A0A291AWX1	Escherichia_phage	95.1	1.6e-91
WP_072310655.1|3893394_3893655_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	97.5	2.4e-36
3894190:3894205	attL	AAGGGATATCAGTTAA	NA	NA	NA	NA
WP_001139675.1|3894330_3894483_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001341210.1|3894470_3894938_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|3894934_3895432_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|3895431_3895647_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|3895714_3896767_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|3896917_3897121_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000115362.1|3897344_3897770_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	98.6	1.0e-73
WP_021545867.1|3898050_3898803_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.0e-136
WP_021559678.1|3898816_3899806_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_021545863.1|3900187_3901024_-	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.6	6.7e-149
WP_000515862.1|3901020_3901572_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_000649477.1|3901615_3901816_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|3901906_3902581_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135680.1|3903267_3903630_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081280.1|3903695_3904520_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000008183.1|3904648_3905185_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|3905175_3905538_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_061362270.1|3905537_3906158_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	3.3e-113
WP_061362269.1|3906590_3908291_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	26.0	3.1e-07
WP_021545860.1|3908541_3909765_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.0	1.2e-234
3916308:3916323	attR	TTAACTGATATCCCTT	NA	NA	NA	NA
>prophage 7
NZ_CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	3988680	4060404	4719625	protease,tRNA,transposase,integrase	Vibrio_phage(17.65%)	59	4015398:4015414	4035496:4035512
WP_001254928.1|3988680_3989832_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_032215506.1|3990888_3992886_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	5.7e-21
WP_001375347.1|3992948_3994226_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|3994473_3995130_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001390362.1|3995187_3995292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296706.1|3995310_3995439_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001387298.1|3996537_3996636_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|3996637_3997420_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|3997725_3998646_+	ribokinase	NA	NA	NA	NA	NA
WP_000998347.1|3998673_3999990_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107480.1|4000001_4001015_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_089516276.1|4001159_4002432_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.6e-176
WP_001446914.1|4002818_4003058_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_000345346.1|4003268_4004525_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705931.1|4004537_4004825_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916805.1|4004840_4005284_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416153.1|4005554_4006586_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_001375333.1|4007936_4008371_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001352291.1|4009279_4009606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228394.1|4009815_4010160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981734.1|4010514_4011864_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102863.1|4011884_4012802_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_001041752.1|4012813_4014010_-	CoA transferase	NA	NA	NA	NA	NA
WP_000018562.1|4014246_4016160_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
4015398:4015414	attL	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
WP_000255944.1|4017193_4018216_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001300609.1|4018212_4018995_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000349548.1|4019033_4019237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254928.1|4020185_4021337_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_001352287.1|4021929_4022832_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_001352286.1|4022949_4025130_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001446910.1|4025132_4025507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061362190.1|4025549_4026815_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.4e-73
WP_001352285.1|4027258_4028278_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	4.9e-45
WP_001295681.1|4030070_4031153_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584107.1|4031152_4032253_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|4032519_4034031_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|4034384_4034828_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416382.1|4034827_4037683_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
4035496:4035512	attR	TCCGGAAACCCTGCTGG	NA	NA	NA	NA
WP_000079655.1|4037738_4038935_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059412.1|4039119_4039623_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4039668_4040085_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012907.1|4040246_4041251_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001326836.1|4043023_4043476_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256681.1|4043620_4044214_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500689.1|4044284_4044998_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|4045128_4045524_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4045804_4045939_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|4045942_4046878_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4046890_4047352_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4047424_4047811_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471885.1|4048016_4050713_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.6	8.2e-47
WP_001387276.1|4050853_4050907_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181312.1|4051091_4052039_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001299664.1|4052157_4053579_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001301172.1|4053628_4055284_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187791.1|4055677_4057816_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106226.1|4057973_4058438_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_001232255.1|4058482_4058869_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162171.1|4059051_4060404_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 8
NZ_CP027118	Escherichia coli strain 26561 chromosome, complete genome	4719625	4487631	4496314	4719625	integrase	Escherichia_phage(36.36%)	12	4478424:4478438	4496396:4496410
4478424:4478438	attL	TGTAGGCCTGATAAG	NA	NA	NA	NA
WP_000268627.1|4487631_4489911_-	replication endonuclease	NA	Q858T4	Yersinia_virus	96.6	0.0e+00
WP_000027659.1|4489900_4490176_-	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_001113270.1|4490172_4490397_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277952.1|4490396_4490699_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_000557703.1|4490698_4490923_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4490986_4491487_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|4491656_4491929_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4492065_4492359_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4492428_4493409_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001223800.1|4493595_4494096_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4494245_4494944_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4494940_4496314_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
4496396:4496410	attR	CTTATCAGGCCTACA	NA	NA	NA	NA
>prophage 1
NZ_CP027119	Escherichia coli strain 26561 plasmid unnamed1, complete sequence	86731	0	66228	86731	protease,integrase,transposase	Macacine_betaherpesvirus(35.71%)	48	48035:48094	57520:58288
WP_001066941.1|0_741_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000949004.1|4977_5892_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|5891_6719_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000968139.1|7568_8426_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001318207.1|9668_10049_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000602863.1|11755_13480_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001015721.1|14426_16169_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|16165_17443_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973519.1|17524_19726_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000361402.1|21054_22077_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001034044.1|23698_24115_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001034046.1|28555_28972_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261278.1|28968_29199_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000528931.1|29463_29964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905949.1|29976_30750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151784.1|32082_32595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|33161_33380_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000016982.1|33686_34493_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|35264_36020_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|36607_37774_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|37773_38745_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_072310663.1|40932_41250_+	replication protein RepA	NA	NA	NA	NA	NA
WP_000616807.1|42187_42841_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|42933_43191_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|43123_43525_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000616807.1|44351_45005_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|45097_45355_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|45287_45689_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_061362285.1|46738_48061_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
48035:48094	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000429836.1|48893_49328_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|49399_49750_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|49763_50039_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|50074_50497_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|50548_52243_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|52260_52623_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|52619_52856_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|52852_53560_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|53598_54903_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|54948_55653_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|55842_56658_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|57585_58290_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
57520:58288	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGT	NA	NA	NA	NA
WP_000480968.1|58350_59187_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|59186_59990_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|60050_60866_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|61171_62023_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|62777_63482_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|63528_63930_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|65523_66228_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
