The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	89966	131426	3031937	portal,integrase,tail,plate,terminase,holin	Listeria_phage(96.36%)	64	91041:91085	131526:131570
WP_003734164.1|89966_90923_+	NAD(P)-binding domain-containing protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	29.6	1.6e-29
91041:91085	attL	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
WP_010990188.1|91189_92392_-|integrase	site-specific integrase	integrase	A0A059T666	Listeria_phage	99.2	1.9e-221
WP_003734807.1|92486_93023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003737372.1|93071_93239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003734808.1|93396_93873_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	62.7	1.2e-41
WP_023546301.1|94028_94271_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727743.1|94267_94534_+	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
WP_003733635.1|94757_94952_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	93.8	6.9e-25
WP_010991179.1|94963_95230_+	hypothetical protein	NA	A0A059T5E9	Listeria_phage	69.7	1.8e-23
WP_023552476.1|95383_95626_-	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	83.8	2.8e-31
WP_010991177.1|95689_96460_+	phage repressor protein/antirepressor Ant	NA	A8ATY0	Listeria_phage	71.7	7.4e-102
WP_010991176.1|96582_97116_+	hypothetical protein	NA	A0A0B5D173	Listeria_phage	87.3	2.3e-78
WP_010991175.1|97112_97328_+	hypothetical protein	NA	Q9T176	Listeria_phage	91.5	2.2e-27
WP_010989962.1|97435_97624_+	hypothetical protein	NA	Q9T175	Listeria_phage	79.0	2.0e-21
WP_077915310.1|97855_98815_+	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	99.1	5.1e-177
WP_010990196.1|98814_99630_+	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	98.5	1.7e-149
WP_034172800.1|99650_100565_+	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	92.8	1.7e-142
WP_020830759.1|100561_100816_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	91.5	7.4e-35
WP_003743364.1|100833_101811_+	DNA cytosine methyltransferase	NA	D2IZY5	Enterococcus_phage	40.2	8.3e-50
WP_003735028.1|101807_102002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003743367.1|102028_102634_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	77.6	3.8e-85
WP_003735032.1|102630_102810_+	hypothetical protein	NA	A0A059T5G0	Listeria_phage	93.2	3.5e-23
WP_003743369.1|102988_103492_+	hypothetical protein	NA	A0A0B5CYR4	Listeria_phage	44.8	9.3e-29
WP_003743371.1|103491_104193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003735015.1|104205_104475_+	hypothetical protein	NA	A0A059T7S7	Listeria_phage	89.5	5.8e-38
WP_003735014.1|104471_104657_+	hypothetical protein	NA	A0A059T5G1	Listeria_phage	98.4	1.2e-26
WP_003735013.1|104653_104944_+	hypothetical protein	NA	Q8W5X0	Listeria_phage	90.6	5.0e-43
WP_003743374.1|104943_105129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003743375.1|105129_105357_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	96.0	1.9e-34
WP_003743377.1|105367_105769_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	83.5	1.3e-54
WP_058831697.1|105768_106251_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.9	3.9e-77
WP_039382681.1|106282_106588_+	hypothetical protein	NA	A8ATZ8	Listeria_phage	83.2	1.9e-37
WP_003759675.1|106584_106725_+	BH0509 family protein	NA	A8ATZ9	Listeria_phage	87.0	4.7e-15
WP_031644573.1|106690_107095_+	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	98.5	2.7e-71
WP_031644575.1|107223_107388_+	hypothetical protein	NA	A8ASQ0	Listeria_phage	94.4	7.4e-20
WP_003735131.1|107406_107841_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
WP_003727778.1|108101_108641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003743392.1|108686_109229_+|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.3	1.2e-90
WP_020830818.1|109197_110529_+|terminase	PBSX family phage terminase large subunit	terminase	A0A059T5E2	Listeria_phage	99.5	1.3e-263
WP_003743397.1|110541_112041_+|portal	phage portal protein	portal	A0A059T657	Listeria_phage	100.0	1.0e-277
WP_003734943.1|112046_113186_+	hypothetical protein	NA	A0A059T7W2	Listeria_phage	100.0	1.7e-208
WP_003734944.1|113264_113855_+	scaffold protein	NA	A0A059T7N8	Listeria_phage	100.0	2.5e-86
WP_003734945.1|113854_114856_+	hypothetical protein	NA	A0A059T6D4	Listeria_phage	100.0	7.4e-187
WP_003734946.1|114874_115270_+	hypothetical protein	NA	A0A059T5E3	Listeria_phage	100.0	5.1e-67
WP_003743399.1|115269_115632_+	hypothetical protein	NA	A0A059T658	Listeria_phage	100.0	8.3e-64
WP_003743401.1|115631_115970_+	hypothetical protein	NA	A0A059T7W4	Listeria_phage	100.0	2.9e-58
WP_003743402.1|115969_116377_+	hypothetical protein	NA	A0A059T7P0	Listeria_phage	100.0	2.4e-67
WP_003735047.1|116379_116817_+	hypothetical protein	NA	A0A059T6D6	Listeria_phage	100.0	2.5e-78
WP_074384949.1|116746_117079_+	Ig domain-containing protein	NA	A0A059T5E4	Listeria_phage	100.0	1.7e-42
WP_003743404.1|117131_117554_+	hypothetical protein	NA	A8ASK4	Listeria_phage	100.0	3.1e-70
WP_003735021.1|117559_118165_+	hypothetical protein	NA	A0A059T7W8	Listeria_phage	99.5	2.9e-109
WP_107355015.1|118175_123542_+	tape measure protein	NA	A8ASK6	Listeria_phage	88.5	0.0e+00
WP_058831695.1|123538_124366_+|tail	phage tail family protein	tail	A8ASK7	Listeria_phage	96.4	4.0e-154
WP_077946996.1|124380_125403_+	hypothetical protein	NA	A8ASK8	Listeria_phage	97.1	1.7e-191
WP_058831694.1|125403_126429_+	hypothetical protein	NA	A8ASK9	Listeria_phage	87.1	2.5e-166
WP_058831693.1|126425_127505_+|plate	BppU family phage baseplate upper protein	plate	A0A0B5CTW3	Listeria_phage	78.2	9.7e-100
WP_058831692.1|127501_127783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003722524.1|127787_127946_+	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_058831691.1|127986_128289_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	94.0	7.7e-39
WP_058831690.1|128288_128552_+|holin	phage holin	holin	A8ATB7	Listeria_phage	66.3	1.0e-23
WP_058831689.1|128544_129489_+	hypothetical protein	NA	Q8W5Y8	Listeria_phage	78.7	3.2e-147
WP_031673620.1|129847_130747_+	Abi family protein	NA	NA	NA	NA	NA
WP_031673622.1|130989_131223_+	hypothetical protein	NA	A0A059T6E1	Listeria_phage	98.7	4.3e-37
WP_003734973.1|131219_131426_+	hypothetical protein	NA	A0A059T5E7	Listeria_phage	100.0	1.8e-31
131526:131570	attR	ACTCTTAATCAGCGGGTCGGGGGTTCGAAACCCTCACAACCCATA	NA	NA	NA	NA
>prophage 2
NZ_CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	170934	177461	3031937	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|170934_171387_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|171392_171728_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003724946.1|171944_172373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003728213.1|172384_172801_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	3.2e-19
WP_003728212.1|173080_173470_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|173482_173995_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|174042_174345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|174386_174791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731178.1|174777_176646_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003734720.1|176642_177461_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 3
NZ_CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	1270212	1367738	3031937	portal,integrase,tail,plate,terminase,holin,protease,capsid,head,tRNA	Listeria_phage(82.61%)	112	1274455:1274471	1327040:1327056
WP_003721619.1|1270212_1271265_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_003730983.1|1271264_1273673_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003721621.1|1273833_1274535_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.0e-33
1274455:1274471	attL	ATTATTGAAATTAATAA	NA	NA	NA	NA
WP_003730984.1|1274548_1277959_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003724750.1|1278056_1278509_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003734678.1|1278524_1281725_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_003724752.1|1281828_1282503_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	3.4e-50
WP_012681263.1|1282540_1283467_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1283620_1283884_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003726937.1|1283883_1284426_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003734677.1|1284517_1286230_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.5	1.9e-17
WP_003734676.1|1286252_1288610_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1288690_1289002_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003726544.1|1289077_1290889_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003734675.1|1291069_1292284_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012681265.1|1292339_1292834_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1292981_1293782_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003726032.1|1293794_1294541_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003726033.1|1294544_1295156_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003726034.1|1295192_1295717_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003734674.1|1296002_1297157_-|integrase	site-specific integrase	integrase	Q8W5Y3	Listeria_phage	100.0	2.9e-219
WP_038330222.1|1297290_1297722_-	hypothetical protein	NA	R4IBV3	Listeria_phage	100.0	3.8e-71
WP_038330224.1|1297772_1298225_-	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	100.0	1.2e-83
WP_038330225.1|1298241_1298562_-	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	100.0	1.6e-55
WP_003734670.1|1298828_1299035_+	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	100.0	6.4e-29
WP_003734669.1|1299037_1299280_+	hypothetical protein	NA	Q8W5X8	Listeria_phage	100.0	8.3e-44
WP_003734668.1|1299282_1299468_+	hypothetical protein	NA	Q8W5X7	Listeria_phage	100.0	3.7e-28
WP_015970830.1|1300162_1300414_+	hypothetical protein	NA	Q8W5X5	Listeria_phage	100.0	1.1e-38
WP_015970831.1|1300432_1300723_+	hypothetical protein	NA	Q8W5X4	Listeria_phage	100.0	2.7e-49
WP_038330227.1|1300719_1301532_+	DNA adenine methylase	NA	R4IBV6	Listeria_phage	100.0	1.7e-157
WP_003743915.1|1301528_1302134_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	100.0	9.2e-116
WP_003743918.1|1302293_1302662_+	hypothetical protein	NA	Q8W5X1	Listeria_phage	100.0	2.4e-66
WP_038330162.1|1302658_1303069_+	hypothetical protein	NA	R4ICD6	Listeria_phage	100.0	3.1e-75
WP_038330163.1|1303072_1303255_+	hypothetical protein	NA	R4IBV7	Listeria_phage	100.0	2.3e-30
WP_038330164.1|1303244_1303520_+	hypothetical protein	NA	R4IBL5	Listeria_phage	100.0	8.6e-45
WP_038330165.1|1303506_1303965_+	hypothetical protein	NA	R4IDY1	Listeria_phage	100.0	1.3e-85
WP_052209204.1|1303958_1304183_+	hypothetical protein	NA	R4IBJ7	Listeria_phage	100.0	3.1e-37
WP_038330166.1|1304179_1304425_+	hypothetical protein	NA	R4ICD9	Listeria_phage	100.0	1.2e-42
WP_052209203.1|1304421_1304697_+	DUF1642 domain-containing protein	NA	R4IBV9	Listeria_phage	100.0	2.8e-48
WP_157028680.1|1304697_1304874_+	hypothetical protein	NA	R4IBL7	Listeria_phage	100.0	3.4e-23
WP_038330167.1|1304874_1305309_+	hypothetical protein	NA	R4IDY3	Listeria_phage	100.0	6.2e-74
WP_038330172.1|1305738_1306122_+	hypothetical protein	NA	R4IBW1	Listeria_phage	100.0	3.2e-66
WP_010991283.1|1306123_1306603_+	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	100.0	7.1e-79
WP_010991282.1|1306615_1307305_+	AAA family ATPase	NA	R4IDY8	Listeria_phage	100.0	1.2e-130
WP_010991281.1|1307368_1308625_+	DEAD/DEAH box helicase	NA	R4IBK4	Listeria_phage	100.0	1.4e-230
WP_038330175.1|1308647_1309133_+	DUF669 domain-containing protein	NA	R4ICE5	Listeria_phage	100.0	2.9e-88
WP_107355041.1|1309155_1311429_+	DNA primase	NA	A0A059T6A4	Listeria_phage	98.4	0.0e+00
WP_061725016.1|1311715_1312030_+	VRR-NUC domain-containing protein	NA	A0A059T805	Listeria_phage	99.0	1.3e-52
WP_061725015.1|1312031_1312301_+	hypothetical protein	NA	W0GBM0	Listeria_phage	71.2	4.5e-14
WP_107355087.1|1312411_1312939_+	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	84.1	3.2e-80
WP_107355043.1|1312938_1313166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731654.1|1313178_1313604_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	99.3	1.8e-73
WP_010991275.1|1313701_1314445_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_003734881.1|1314942_1315254_+	HNH endonuclease	NA	Q8W5V3	Listeria_phage	100.0	5.5e-56
WP_038330179.1|1315636_1315999_+|terminase	terminase	terminase	R4IBJ0	Listeria_phage	100.0	1.6e-62
WP_038330181.1|1315982_1317635_+|terminase	terminase large subunit	terminase	R4IDU8	Listeria_phage	100.0	0.0e+00
WP_038330182.1|1317649_1318837_+|portal	phage portal protein	portal	R4IBH4	Listeria_phage	100.0	9.9e-223
WP_038330183.1|1318814_1319567_+|protease	Clp protease ClpP	protease	R4ICB0	Listeria_phage	100.0	2.6e-128
WP_038330185.1|1319563_1320736_+|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	100.0	1.1e-221
WP_157943356.1|1320758_1320878_+	hypothetical protein	NA	R4IBJ4	Listeria_phage	100.0	2.2e-13
WP_038330186.1|1320864_1321164_+	hypothetical protein	NA	R4IDV2	Listeria_phage	100.0	1.2e-47
WP_038330187.1|1321144_1321483_+|head	phage head closure protein	head	R4IBH7	Listeria_phage	100.0	4.4e-59
WP_052209202.1|1321475_1321886_+	hypothetical protein	NA	R4ICB4	Listeria_phage	99.3	8.0e-71
WP_038330190.1|1321875_1322298_+	hypothetical protein	NA	R4IBU7	Listeria_phage	100.0	6.7e-73
WP_038330191.1|1322301_1322880_+	hypothetical protein	NA	R4IBJ8	Listeria_phage	100.0	1.3e-103
WP_038330192.1|1323028_1323391_+	hypothetical protein	NA	R4IBH8	Listeria_phage	100.0	1.6e-59
WP_157943357.1|1323435_1323573_+	hypothetical protein	NA	R4ICB8	Listeria_phage	100.0	1.2e-18
WP_107355045.1|1323572_1326653_+|tail	tail tape measure protein	tail	R4IBU8	Listeria_phage	100.0	0.0e+00
WP_003734895.1|1326649_1327357_+	hypothetical protein	NA	Q8W5Z6	Listeria_phage	100.0	2.5e-136
1327040:1327056	attR	ATTATTGAAATTAATAA	NA	NA	NA	NA
WP_003734896.1|1327356_1329483_+	hypothetical protein	NA	R4IDV9	Listeria_phage	100.0	0.0e+00
WP_038330194.1|1329479_1330601_+|plate	BppU family phage baseplate upper protein	plate	R4IBI1	Listeria_phage	100.0	3.2e-178
WP_031644694.1|1330597_1330939_+	hypothetical protein	NA	R4ICC1	Listeria_phage	100.0	4.2e-57
WP_012581446.1|1330938_1331085_+	XkdX family protein	NA	A0A059T6D9	Listeria_phage	100.0	1.1e-19
WP_003725053.1|1331121_1331487_+	hypothetical protein	NA	A8ASL3	Listeria_phage	100.0	1.3e-11
WP_038330195.1|1331499_1331784_+|holin	holin	holin	R4IDW2	Listeria_phage	100.0	5.7e-44
WP_038330196.1|1331780_1332014_+	hypothetical protein	NA	R4IBI3	Listeria_phage	100.0	1.4e-35
WP_107355046.1|1332016_1332943_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	R4ICC5	Listeria_phage	96.4	4.9e-177
WP_031673620.1|1333301_1334201_+	Abi family protein	NA	NA	NA	NA	NA
WP_038330199.1|1334257_1334467_-	hypothetical protein	NA	R4IBK5	Listeria_phage	100.0	4.2e-28
WP_038330200.1|1334910_1335144_+	hypothetical protein	NA	R4IDW6	Listeria_phage	100.0	7.3e-37
WP_003726037.1|1336024_1336498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003726038.1|1336603_1336966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014929056.1|1337633_1341764_+	LapB repeat-containing protein	NA	NA	NA	NA	NA
WP_003727539.1|1341886_1343245_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003734528.1|1343287_1343881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726044.1|1344017_1344425_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003734527.1|1344589_1345189_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_003726046.1|1345220_1345481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726047.1|1345604_1347017_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|1347041_1347305_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003726049.1|1347472_1347949_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|1347986_1348232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726051.1|1348228_1349434_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726052.1|1349638_1350298_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1350337_1350532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1350598_1351447_-	YitT family protein	NA	NA	NA	NA	NA
WP_003726055.1|1352065_1352779_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_003726056.1|1352809_1354456_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1354474_1355959_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003726723.1|1356076_1356538_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1356576_1357041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003734526.1|1357229_1358144_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003734525.1|1358169_1359417_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.0	2.7e-106
WP_003734524.1|1359400_1360231_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_003734523.1|1360377_1361517_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1361596_1361992_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1362142_1362358_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1362481_1363015_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1363030_1363696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1363957_1364896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1365010_1366294_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1366478_1367738_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
>prophage 4
NZ_CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	1910178	1918464	3031937		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1910178_1910745_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1910741_1911791_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1911809_1913237_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_003731570.1|1913221_1915441_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003734638.1|1915433_1916117_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1916120_1916366_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003734637.1|1916377_1917091_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	6.7e-41
WP_003726215.1|1917171_1918464_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 5
NZ_CP025220	Listeria monocytogenes strain PIR00546 chromosome, complete genome	3031937	2642091	2649935	3031937		Streptococcus_phage(50.0%)	6	NA	NA
WP_003725407.1|2642091_2643063_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003734495.1|2643070_2644039_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2644040_2644916_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003734494.1|2645023_2646754_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	5.6e-174
WP_003725411.1|2647872_2648856_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.1	4.0e-52
WP_003722610.1|2648975_2649935_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
