The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	7549	59766	4735208	transposase,protease	Acidithiobacillus_phage(16.67%)	38	NA	NA
WP_024744592.1|7549_8386_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024744593.1|8570_9377_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024744594.1|9653_10847_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_053513954.1|11000_11669_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_014501265.1|11753_12515_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12561_12984_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743315.1|12987_13401_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_024743314.1|13696_14464_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_024743313.1|14474_14744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743312.1|14818_16279_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_158525106.1|17100_17250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490027.1|17424_18801_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.9e-76
WP_107490028.1|19029_19998_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_024744007.1|20086_21214_-	PA0069 family radical SAM protein	NA	NA	NA	NA	NA
WP_024744008.1|22284_23625_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_010364746.1|23842_24535_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_008572943.1|24651_24972_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_024744009.1|26269_27793_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	29.2	1.0e-25
WP_033003570.1|27897_29133_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_024744011.1|29293_29950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053512972.1|30112_31924_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_024744014.1|32071_32422_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_024744015.1|32728_33859_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003577.1|34641_35694_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_033003579.1|36394_37468_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_024744018.1|37776_38835_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.9e-77
WP_101807021.1|41242_41872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053502200.1|41921_42953_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	1.0e-74
WP_024744291.1|43034_44516_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024744290.1|44710_49183_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_024744289.1|49384_49765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324081.1|49911_51099_+	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.3	1.3e-41
WP_024744287.1|51301_51607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324376.1|52793_53933_+	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_024744284.1|54246_55032_-	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_033003662.1|55042_57631_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744282.1|57803_58961_+	ROK family protein	NA	NA	NA	NA	NA
WP_101807022.1|59003_59766_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	486729	611586	4735208	transposase,integrase,head,portal,holin,tail,plate,terminase,capsid,tRNA	Stenotrophomonas_phage(39.22%)	100	512345:512389	556856:556900
WP_024745935.1|486729_487293_-|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein RimN	tRNA	NA	NA	NA	NA
WP_024745936.1|487303_489796_-	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.3	1.9e-114
WP_024745937.1|489978_491253_-	RDD family protein	NA	NA	NA	NA	NA
WP_024745938.1|492067_492541_-	DUF494 family protein	NA	NA	NA	NA	NA
WP_107490033.1|492583_493726_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_024745940.1|493797_494934_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_024745941.1|495066_495579_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_024745942.1|495972_496896_+|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_024745943.1|496895_498209_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_024745944.1|498259_499981_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024745945.1|500145_501423_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_024745946.1|501620_502445_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745947.1|502445_503504_+	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_024745948.1|503670_505176_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_053513469.1|505172_505682_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_019302641.1|505791_506925_-	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_014504872.1|507167_507689_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033004404.1|507887_508802_-	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_024745951.1|508902_509343_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_014504870.1|509451_511326_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_024745952.1|511518_511839_+	hypothetical protein	NA	NA	NA	NA	NA
512345:512389	attL	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_082330806.1|512458_513733_-|integrase	tyrosine-type recombinase/integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.5	1.1e-110
WP_011257520.1|513866_514073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075243253.1|514069_514342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745956.1|514338_514584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745957.1|514580_514856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745958.1|515017_515428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|515653_515932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|515928_516147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330809.1|516455_519128_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.7	0.0e+00
WP_011258450.1|519161_519374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|519370_519649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745959.1|519659_519980_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	56.5	6.3e-23
WP_053503015.1|519982_520240_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|520311_520749_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|521409_522396_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|522392_522794_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_024745960.1|522806_525677_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	47.5	6.2e-194
WP_011258456.1|525709_525823_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|525831_526134_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|526179_526689_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_011258459.1|526719_527886_-|tail	tail sheath protein	tail	E5FFG9	Burkholderia_phage	62.4	4.6e-132
WP_024745961.1|527897_528257_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	4.3e-36
WP_024745962.1|528253_528817_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	43.7	3.1e-25
WP_024745963.1|528877_529456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745964.1|529463_530969_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.0	2.1e-52
WP_024745965.1|530978_531524_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.7	3.5e-50
WP_024745966.1|531516_532407_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.7	7.2e-85
WP_024745967.1|532488_532938_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	54.7	1.8e-36
WP_024745968.1|532925_533345_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.2	2.0e-40
WP_033004406.1|533341_533830_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	52.8	4.2e-26
WP_011258470.1|533829_534471_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.9e-49
WP_024745970.1|534467_534743_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_024745971.1|534735_535092_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	4.5e-22
WP_024745972.1|535096_535306_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	59.4	5.4e-15
WP_012445486.1|535305_535773_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258475.1|535872_536592_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_024745974.1|536595_537615_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.9	2.1e-136
WP_024745975.1|537661_538504_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_033004409.1|538625_540410_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.1	1.2e-267
WP_024745977.1|540409_541429_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	72.5	4.1e-140
WP_082330810.1|541449_541680_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	54.8	1.9e-13
WP_024745978.1|541612_542317_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.8	3.3e-109
WP_033004412.1|542348_542816_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_024745980.1|542815_543994_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_101807043.1|544724_547484_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.3	1.8e-41
WP_024745590.1|547492_548419_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_101807044.1|548415_551250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743124.1|551277_552009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490034.1|552035_553958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324099.1|554063_555440_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_082324338.1|556967_557201_-	hypothetical protein	NA	V9IQN0	Stenotrophomonas_phage	53.1	4.1e-16
556856:556900	attR	CTCATAATCCTTTGGTTGAAGGTTCGAATCCTTCTGGGCCCACCA	NA	NA	NA	NA
WP_024743230.1|559077_560967_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_011260615.1|561183_561525_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.4	2.3e-15
WP_024743229.1|561723_563448_+	ATP-dependent RNA helicase RhlB	NA	A0A1V0SBR7	Catovirus	29.4	1.4e-47
WP_024743228.1|563523_564210_+	cell division ATP-binding protein FtsE	NA	NA	NA	NA	NA
WP_024743227.1|564206_565157_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082324547.1|565220_566015_+	response regulator	NA	NA	NA	NA	NA
WP_024743225.1|566011_566737_+	uracil-DNA glycosylase	NA	A0A0B5IW78	Pandoravirus	44.3	3.6e-50
WP_024743224.1|566953_567829_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.5	3.6e-44
WP_024743223.1|567907_568468_-	membrane protein	NA	NA	NA	NA	NA
WP_024743222.1|568520_569813_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003483210.1|572104_572392_+	co-chaperone GroES	NA	A0A221S331	uncultured_virus	40.0	5.1e-16
WP_011260602.1|572528_574169_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	63.5	5.1e-177
WP_033003232.1|574471_576748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419031.1|577855_578824_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024745526.1|581950_583024_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	47.9	4.3e-84
WP_024745527.1|583540_585718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745528.1|589409_589928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588033.1|590089_592915_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_024745530.1|593010_593571_-	VUT family protein	NA	A0A2I7SAW6	Vibrio_phage	29.6	5.1e-12
WP_024745119.1|597692_598193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513672.1|599085_600033_-	nucleoside-diphosphate sugar epimerase	NA	NA	NA	NA	NA
WP_024745121.1|600167_600758_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_024745122.1|600968_601712_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_024745365.1|604035_606723_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_024745366.1|606809_607547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807047.1|607557_608934_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_130625305.1|609113_609674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|610483_611586_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
>prophage 3
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	620889	702685	4735208	protease,transposase	Acidithiobacillus_phage(16.67%)	47	NA	NA
WP_107490035.1|620889_622266_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.1e-63
WP_058419174.1|624136_627961_+	avirulence protein	NA	NA	NA	NA	NA
WP_024745997.1|629030_630614_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.5	6.5e-36
WP_082324335.1|631004_631196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745996.1|633696_636021_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_024745994.1|637924_639016_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_024745993.1|639980_640859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324334.1|641047_641932_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024745991.1|642209_643982_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_050588046.1|644379_646080_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_033004419.1|647234_648611_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_024745988.1|648697_649693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745987.1|649938_650850_+	magnesium transporter	NA	NA	NA	NA	NA
WP_024745985.1|651384_651669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745984.1|651998_652445_+	autotransporter	NA	NA	NA	NA	NA
WP_101807049.1|652756_653858_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_107490036.1|654567_655944_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	7.8e-78
WP_024743083.1|657116_658808_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_024743082.1|659060_659846_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_024743081.1|661089_662094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743080.1|662132_663062_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024743079.1|663609_666498_-	insulinase family protein	NA	NA	NA	NA	NA
WP_024743078.1|666750_669333_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	29.2	3.2e-08
WP_101807050.1|669910_670709_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745720.1|673312_674767_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.6	5.2e-48
WP_024745721.1|674974_676462_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	2.4e-125
WP_082324540.1|676741_677695_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	1.7e-15
WP_024745723.1|677863_679513_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_033004321.1|680504_682442_+	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_024745725.1|682593_683262_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_024745726.1|683266_684319_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.4e-18
WP_024745727.1|684349_685087_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745728.1|685117_686032_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_024745729.1|686594_687395_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_024745730.1|687956_688922_+	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745731.1|689030_689600_-	lipocalin family protein	NA	NA	NA	NA	NA
WP_024745732.1|689984_690296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745733.1|690363_692457_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_053513809.1|693051_694236_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_024745735.1|694345_696481_+	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	1.8e-28
WP_024745736.1|696824_697223_+	YbaN family protein	NA	NA	NA	NA	NA
WP_024745737.1|697280_697523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745738.1|697512_698367_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_082324332.1|698354_699035_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_024745740.1|699228_700146_+	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	28.1	1.7e-12
WP_024745741.1|700661_701213_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024745742.1|701317_702685_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.5	4.7e-43
>prophage 4
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	754409	824893	4735208	transposase	Ralstonia_phage(20.0%)	55	NA	NA
WP_058419161.1|754409_755378_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_107490082.1|755429_755528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743525.1|756406_759115_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_158525109.1|759111_759279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050587990.1|759265_762160_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	2.0e-22
WP_053513077.1|762156_764553_+	alpha-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_024743528.1|764686_765853_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_050587991.1|766067_766835_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743530.1|766879_768157_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_024743531.1|768197_769265_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743532.1|769271_770300_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_024743533.1|770302_771457_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_024743534.1|771961_772567_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_024743535.1|772563_773817_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_024743536.1|773818_775717_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_024743537.1|775718_777761_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_024743539.1|778974_780207_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.5	2.3e-73
WP_058419068.1|780427_781396_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_107490031.1|786817_787849_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_024744857.1|787843_788587_-	endonuclease	NA	NA	NA	NA	NA
WP_053513041.1|788636_789452_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_024744859.1|789543_790194_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_082324537.1|790287_791028_-	cytochrome c4	NA	NA	NA	NA	NA
WP_024744861.1|791229_791853_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744862.1|791946_792642_-	VIT family protein	NA	NA	NA	NA	NA
WP_024744863.1|792857_794222_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_024712624.1|796644_797130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744626.1|798072_798993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513043.1|799025_800525_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.1	3.6e-12
WP_082324328.1|800521_801241_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024744866.1|801379_802480_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.5	9.8e-15
WP_024744868.1|803615_803891_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024744869.1|803955_805065_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.4	3.8e-35
WP_024744870.1|805133_805709_+	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_024744871.1|805768_806599_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_024744872.1|806728_806938_+	DUF4386 family protein	NA	NA	NA	NA	NA
WP_101837678.1|806989_807958_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_082324327.1|808131_808608_+	DUF4386 domain-containing protein	NA	NA	NA	NA	NA
WP_082324326.1|808604_808949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743416.1|809124_810786_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.6	1.3e-39
WP_024743415.1|811011_811509_+	RcnB family protein	NA	NA	NA	NA	NA
WP_154221260.1|811689_811971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743413.1|812179_814510_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024712241.1|814695_815949_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	1.6e-101
WP_024743412.1|815962_816478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743411.1|816477_817002_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_024743410.1|816998_817484_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_101807310.1|817495_818590_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.8e-45
WP_024743408.1|818645_819269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743407.1|819829_820432_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.0	3.9e-26
WP_024743406.1|820428_821568_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.3	1.6e-52
WP_024743405.1|821881_822346_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.3	2.2e-24
WP_024743404.1|822342_822813_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_024743403.1|823033_824008_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_101807055.1|824095_824893_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1065195	1127613	4735208	protease,transposase	Leptospira_phage(16.67%)	44	NA	NA
WP_107490031.1|1065195_1066227_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_107490038.1|1067287_1068256_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324317.1|1070158_1071532_-	MFS transporter	NA	NA	NA	NA	NA
WP_024745685.1|1071630_1073670_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_024745686.1|1073877_1074900_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024745687.1|1075315_1076413_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745688.1|1076605_1077115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745689.1|1077134_1077995_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_024745690.1|1077945_1078338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745691.1|1078340_1079549_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	2.9e-20
WP_024745692.1|1079639_1080737_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024745693.1|1080740_1081601_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_024745694.1|1081597_1082551_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_024745695.1|1082558_1083593_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	2.0e-25
WP_024745696.1|1083952_1084666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004302.1|1084735_1085758_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_024745698.1|1085989_1086277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033004295.1|1086273_1088607_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_033004296.1|1091021_1093172_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_024745700.1|1093264_1093909_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_024745701.1|1094879_1096178_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_024745702.1|1096245_1097328_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_033004297.1|1097542_1098283_+	CvpA family protein	NA	NA	NA	NA	NA
WP_024745703.1|1098319_1099786_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.1	8.3e-86
WP_024745704.1|1099924_1100749_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101807070.1|1101468_1102267_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745844.1|1102729_1103149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513157.1|1103328_1104072_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_024745846.1|1104699_1105242_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_053513155.1|1105222_1106359_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_033004364.1|1106563_1108090_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_024745848.1|1108261_1110364_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_082324316.1|1110467_1111811_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	5.0e-29
WP_024745850.1|1111868_1112558_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	35.7	5.9e-34
WP_082324528.1|1112732_1114379_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745852.1|1114528_1114837_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_024745853.1|1114833_1115229_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014502224.1|1115443_1116451_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_014502225.1|1116591_1117353_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_058419165.1|1118559_1119618_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_058419103.1|1120934_1121903_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_024745448.1|1124190_1125483_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1125575_1126202_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1126326_1127613_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
>prophage 6
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1149681	1212091	4735208	protease,transposase	Leptospira_phage(18.18%)	51	NA	NA
WP_101807314.1|1149681_1150793_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	2.6e-84
WP_101807313.1|1150731_1151823_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	9.3e-42
WP_053513140.1|1151820_1152312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513142.1|1152682_1154779_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	3.1e-46
WP_005913896.1|1154785_1155106_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1155203_1155797_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_024743523.1|1155898_1156249_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_024743522.1|1156368_1156902_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_024743521.1|1156901_1158851_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_024743520.1|1158843_1159800_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_024743519.1|1159805_1160759_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_024743518.1|1160796_1162665_+	membrane protein	NA	NA	NA	NA	NA
WP_033003360.1|1162815_1164609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743516.1|1164713_1165289_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_024743515.1|1165401_1165911_+	characterized ACR protein	NA	NA	NA	NA	NA
WP_024743514.1|1166008_1166203_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_024743513.1|1166292_1167270_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_024743512.1|1167501_1167942_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_024743511.1|1168219_1169164_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_024743510.1|1169225_1169969_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	5.2e-12
WP_010368407.1|1170173_1170413_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_024743509.1|1170554_1171790_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_024743508.1|1171960_1173316_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_024743507.1|1173376_1174450_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_024743506.1|1174446_1175406_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_024743505.1|1175402_1175756_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_130625311.1|1176366_1176753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743504.1|1176956_1177283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807072.1|1177519_1179295_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_024743502.1|1179263_1180160_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_024743501.1|1180235_1181390_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_024743500.1|1181578_1184170_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_011407669.1|1184492_1184630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745137.1|1186063_1187287_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_024745136.1|1187791_1190008_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024745135.1|1190085_1191096_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_024745134.1|1192000_1194988_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024745133.1|1195162_1196110_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	36.0	6.5e-07
WP_024745132.1|1197100_1197661_-	bacterioferritin	NA	NA	NA	NA	NA
WP_014502286.1|1198349_1198826_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_014502287.1|1199236_1200136_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	4.5e-18
WP_024745129.1|1200697_1201084_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_101850159.1|1201388_1201583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745128.1|1201709_1202837_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_024745127.1|1202836_1203700_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_024745126.1|1203994_1204180_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_024745125.1|1204518_1205811_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.5	6.4e-74
WP_024745124.1|1206136_1208809_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.2	4.7e-79
WP_058419160.1|1209294_1210326_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082330721.1|1210416_1210764_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_107490046.1|1210989_1212091_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
>prophage 7
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1251170	1312121	4735208	transposase	Bacillus_phage(15.38%)	46	NA	NA
WP_101807077.1|1251170_1251976_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	5.3e-10
WP_024745783.1|1253078_1254317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745784.1|1255142_1257248_-	catalase	NA	A0A2K9L0T1	Tupanvirus	47.7	1.9e-136
WP_050588043.1|1258897_1259545_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	45.5	6.5e-35
WP_024745785.1|1259541_1260093_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745786.1|1260458_1263392_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.0	6.2e-258
WP_024745787.1|1263859_1264051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745788.1|1264481_1265285_+	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.7	9.0e-26
WP_033004344.1|1265373_1266585_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024745790.1|1266581_1268741_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.0	2.2e-34
WP_024745792.1|1269549_1269954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745793.1|1270035_1272054_-	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745794.1|1272165_1273836_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_024745795.1|1273832_1274597_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024745796.1|1274696_1276430_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_024745797.1|1276649_1277366_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	2.8e-23
WP_024745798.1|1277358_1278651_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024745799.1|1278802_1279294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745800.1|1279362_1279620_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024745801.1|1279622_1280432_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_024745802.1|1280467_1281208_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_014502368.1|1281212_1281812_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745803.1|1282056_1283253_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_008574699.1|1283252_1283894_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024745804.1|1284244_1285441_+	polyketide cyclase	NA	NA	NA	NA	NA
WP_024745805.1|1285522_1285909_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_024745806.1|1285911_1286586_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_024745807.1|1286649_1287447_-	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_024745808.1|1287577_1287757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745809.1|1287753_1288038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745812.1|1288653_1289856_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_131112933.1|1289952_1290165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490040.1|1290260_1290677_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024745813.1|1290832_1291564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745814.1|1291763_1292642_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	34.5	3.9e-06
WP_024745815.1|1292749_1293010_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024745816.1|1293069_1294551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745817.1|1294566_1298304_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024745818.1|1298300_1299284_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_033004345.1|1299280_1300075_+	OmpA family protein	NA	NA	NA	NA	NA
WP_024745820.1|1300127_1301198_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_107490041.1|1302142_1304962_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.4	4.7e-53
WP_101807316.1|1305467_1306484_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	7.3e-49
WP_058419153.1|1307591_1308968_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	3.0e-77
WP_058419152.1|1309111_1310488_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_058419050.1|1311152_1312121_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 8
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1316384	1385220	4735208	transposase,plate	Ralstonia_phage(27.27%)	52	NA	NA
WP_011259947.1|1316384_1317719_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743027.1|1317870_1318479_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_033003111.1|1318864_1319353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1319399_1319900_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011409204.1|1319903_1321400_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1321541_1322039_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011409203.1|1322186_1322675_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743026.1|1322677_1324513_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743025.1|1324476_1325568_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_053513684.1|1325653_1328386_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	7.1e-91
WP_014502423.1|1328416_1328770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490042.1|1328862_1331637_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	4.0e-41
WP_024743438.1|1331611_1332484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101837937.1|1332503_1335371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744615.1|1335382_1336408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743437.1|1336720_1337785_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_024743436.1|1337799_1338051_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_024743435.1|1338350_1339463_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_024743434.1|1339459_1340002_-	shikimate kinase	NA	NA	NA	NA	NA
WP_024743433.1|1340168_1340768_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1340948_1341365_+	YjfI family protein	NA	NA	NA	NA	NA
WP_024743432.1|1341377_1342151_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_024743431.1|1342176_1343259_+	potassium channel protein	NA	NA	NA	NA	NA
WP_082324520.1|1343261_1343933_+	YjfK family protein	NA	NA	NA	NA	NA
WP_024743429.1|1343970_1344375_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_024743428.1|1344387_1344960_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	28.1	6.4e-10
WP_024743427.1|1344961_1346128_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	41.6	6.4e-73
WP_050587989.1|1346490_1346952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743426.1|1348749_1350756_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_082324305.1|1351805_1354952_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743423.1|1355283_1356036_+	SapC family protein	NA	NA	NA	NA	NA
WP_024743422.1|1356046_1357093_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024743421.1|1357133_1358651_+	tryptophan 7-halogenase	NA	A0A1D7SF58	Cyanophage	31.8	5.8e-50
WP_024743420.1|1358688_1359693_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_024743419.1|1359837_1360236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324518.1|1360367_1361744_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	1.1e-60
WP_024745604.1|1362331_1363729_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_024745603.1|1364170_1365553_-	APC family permease	NA	NA	NA	NA	NA
WP_024745602.1|1365745_1366510_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745601.1|1366823_1367765_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_053513783.1|1368520_1369909_+	amino acid permease	NA	NA	NA	NA	NA
WP_101807086.1|1371858_1373313_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	41.0	9.0e-93
WP_033004264.1|1373269_1374172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588037.1|1374171_1375413_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	34.7	3.2e-54
WP_101807087.1|1375645_1376614_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_024744440.1|1377734_1378751_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_082324517.1|1378811_1379606_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_024744438.1|1379765_1381127_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744437.1|1381414_1383145_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.0e-10
WP_005913389.1|1383203_1383473_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003487850.1|1383465_1383858_-	PTS fructose IIA component family protein	NA	NA	NA	NA	NA
WP_107490043.1|1384251_1385220_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	3.3e-99
>prophage 9
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1410655	1519008	4735208	protease,transposase,tRNA	Acidithiobacillus_phage(18.75%)	87	NA	NA
WP_107490044.1|1410655_1411687_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	6.0e-75
WP_058419036.1|1411753_1412722_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_011258205.1|1413025_1413355_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_024743872.1|1413351_1413891_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082324130.1|1414435_1415452_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_024743209.1|1416260_1417505_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.7	5.0e-92
WP_024743208.1|1417501_1418764_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_024743207.1|1418763_1419528_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.5	2.0e-11
WP_024743206.1|1419785_1421243_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024743205.1|1421258_1421717_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1421888_1422356_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_033003226.1|1422460_1422679_+	peptidase	NA	NA	NA	NA	NA
WP_024743204.1|1423285_1423882_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_033003224.1|1423937_1424480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743203.1|1424537_1424879_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_024743202.1|1424936_1425578_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_024743201.1|1425682_1426108_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_024743200.1|1426663_1427524_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024743199.1|1427567_1428260_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_101807090.1|1428325_1429091_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743682.1|1429441_1430479_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_024743681.1|1430592_1431723_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_082324514.1|1432012_1432669_+	YitT family protein	NA	NA	NA	NA	NA
WP_024743679.1|1433771_1434344_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_024743678.1|1434340_1434775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003404.1|1434771_1435653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743677.1|1435620_1436187_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_024743676.1|1436179_1436647_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_024743675.1|1436660_1437608_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_024743674.1|1438044_1438479_+	OsmC family protein	NA	NA	NA	NA	NA
WP_024743673.1|1438631_1439231_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743672.1|1439528_1440410_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_024743669.1|1441502_1444112_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_024743668.1|1444095_1444554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743667.1|1444550_1445906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743666.1|1445886_1447293_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_053512934.1|1447609_1448431_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_058419088.1|1448525_1449494_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_024743020.1|1449748_1450747_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_024743021.1|1451022_1451556_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	60.9	1.9e-32
WP_024743022.1|1451838_1453323_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.5	5.0e-14
WP_024743023.1|1453616_1454324_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_154221304.1|1454932_1455094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324511.1|1456835_1457513_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_158500229.1|1457634_1458081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016904074.1|1458049_1458274_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_024745822.1|1458273_1460346_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_050588044.1|1460629_1461436_+	pirin family protein	NA	NA	NA	NA	NA
WP_101807093.1|1461522_1461894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419141.1|1462297_1465114_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.6	4.7e-53
WP_024745912.1|1465113_1466010_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024745911.1|1466006_1466471_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324298.1|1466494_1466974_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324297.1|1467123_1467603_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082324296.1|1467689_1469426_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_082324203.1|1470206_1471583_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743650.1|1472233_1472830_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_058419169.1|1473255_1474632_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_024712501.1|1477528_1477990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625317.1|1479305_1479962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024742990.1|1480229_1480943_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_024742991.1|1481046_1481796_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_082324510.1|1483237_1484359_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_082324295.1|1484373_1485201_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_024743606.1|1485184_1486468_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_024743605.1|1486494_1487010_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743604.1|1487020_1489177_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.5	1.4e-09
WP_024743603.1|1489245_1491249_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1491267_1491597_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_131091743.1|1491627_1491855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743602.1|1492086_1495551_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1495944_1496487_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_033003388.1|1496911_1497820_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_024743600.1|1499350_1500163_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_024743598.1|1501108_1501720_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743597.1|1501838_1502723_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024743596.1|1502744_1503836_+	DUF3616 domain-containing protein	NA	NA	NA	NA	NA
WP_024743595.1|1503904_1505308_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_019302800.1|1505321_1505828_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743594.1|1506230_1506689_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743593.1|1507466_1507670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807094.1|1507833_1508977_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.9	1.2e-84
WP_082324507.1|1509086_1510103_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_107490045.1|1510388_1511765_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	8.9e-74
WP_033004102.1|1511792_1512683_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_024743817.1|1513369_1513966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490031.1|1517976_1519008_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
>prophage 10
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1568760	1630516	4735208	transposase,protease,tRNA	Staphylococcus_phage(25.0%)	50	NA	NA
WP_024744647.1|1568760_1571403_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.0	4.7e-172
WP_024744646.1|1571916_1572552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259823.1|1572574_1573603_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_024744645.1|1573599_1574499_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259822.1|1574555_1574972_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_024744644.1|1574983_1576099_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_024744641.1|1577188_1577659_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_033003769.1|1578096_1578771_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024744639.1|1579081_1582192_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024744638.1|1582658_1583393_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_024744637.1|1583531_1584104_+	Maf-like protein	NA	NA	NA	NA	NA
WP_024744636.1|1584103_1585603_+	ribonuclease G	NA	NA	NA	NA	NA
WP_024744635.1|1585743_1589664_+	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_024744634.1|1589669_1590422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744633.1|1590520_1591966_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_024744632.1|1592222_1592804_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_024744631.1|1592949_1594317_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_082324502.1|1594391_1594796_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744630.1|1594847_1595309_+	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_024744629.1|1595378_1596476_-|protease	protease	protease	NA	NA	NA	NA
WP_101807075.1|1596882_1597680_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024745348.1|1597792_1598668_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_024745349.1|1598669_1598930_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_024745350.1|1598961_1600266_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_024745351.1|1600299_1602006_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_024745352.1|1602148_1603489_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_024745353.1|1603498_1604335_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_133285949.1|1604344_1604569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745354.1|1604581_1605073_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024745355.1|1605280_1606030_-	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_024745356.1|1606139_1606676_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_024745357.1|1606786_1607266_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_024745358.1|1607494_1608739_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024745359.1|1608746_1609997_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_053514015.1|1609993_1611364_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.8	2.4e-34
WP_024744748.1|1612921_1613218_+	cysteine methyltransferase	NA	NA	NA	NA	NA
WP_024744749.1|1613258_1613957_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_058419134.1|1614207_1615176_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	9.6e-99
WP_101807103.1|1615759_1616785_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_107490046.1|1616819_1617922_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_133265051.1|1618351_1618699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324203.1|1618767_1620144_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743076.1|1621149_1623165_-	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_082324143.1|1623834_1624851_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_058419036.1|1625247_1626216_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_154221280.1|1626299_1626869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744531.1|1627234_1628086_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_024744530.1|1628181_1628751_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	74.9	4.5e-72
WP_024744529.1|1628785_1628971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419036.1|1629547_1630516_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 11
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1739013	1800743	4735208	integrase,transposase,tRNA	Leptospira_phage(14.29%)	51	1739801:1739821	1799903:1799923
WP_101807110.1|1739013_1739811_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1739801:1739821	attL	AGAAGATCGTGAACAGGTTCT	NA	NA	NA	NA
WP_107490046.1|1740006_1741108_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024744617.1|1741528_1741996_-	TonB family protein	NA	NA	NA	NA	NA
WP_058419031.1|1742426_1743395_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_082324283.1|1743516_1744284_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743448.1|1744290_1745682_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.6	1.0e-93
WP_024743447.1|1746142_1746727_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024743446.1|1746826_1747843_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082324494.1|1748466_1749885_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017154976.1|1749980_1750223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324282.1|1750216_1750558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107490048.1|1752428_1756022_-	avirulence protein	NA	NA	NA	NA	NA
WP_024743886.1|1757396_1759508_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.2	1.3e-15
WP_107490049.1|1760003_1760969_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_024743086.1|1761900_1762245_-	response regulator	NA	NA	NA	NA	NA
WP_024743087.1|1762547_1764065_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_024743088.1|1764051_1766124_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_033003148.1|1766268_1766970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743090.1|1766969_1767467_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_024743091.1|1767466_1768009_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_024743092.1|1768005_1769994_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_024743093.1|1770057_1770528_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_024743094.1|1770524_1770731_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_024743095.1|1770727_1771486_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_053513343.1|1771496_1772822_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.7	4.0e-23
WP_082324281.1|1772818_1773580_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_014503710.1|1773471_1774053_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_033004056.1|1774116_1774905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745140.1|1775348_1775741_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_024745141.1|1775765_1777106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745142.1|1777189_1777720_-	cytochrome-c oxidase	NA	NA	NA	NA	NA
WP_024745143.1|1778114_1778546_+	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_024745144.1|1778542_1779214_+	acetyltransferase	NA	NA	NA	NA	NA
WP_024745145.1|1779217_1780171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745146.1|1780157_1781090_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033004058.1|1781089_1782202_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	28.1	1.9e-29
WP_024745148.1|1782198_1783452_+	O-antigen translocase	NA	NA	NA	NA	NA
WP_024745149.1|1783448_1784399_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024745150.1|1784395_1785529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745151.1|1785574_1786426_+	chain-length determining protein	NA	NA	NA	NA	NA
WP_024745152.1|1786706_1787549_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024745153.1|1787561_1788797_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_024745154.1|1788793_1789492_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024745155.1|1789613_1790744_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_024745156.1|1790740_1791853_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_053513340.1|1791956_1793171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745158.1|1793260_1794781_-	radical SAM protein	NA	NA	NA	NA	NA
WP_053513339.1|1794913_1795972_+	serine kinase	NA	NA	NA	NA	NA
WP_024745160.1|1796065_1797787_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.6	1.8e-10
WP_024745161.1|1798095_1799511_-	MFS transporter	NA	NA	NA	NA	NA
WP_101807075.1|1799945_1800743_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
1799903:1799923	attR	AGAACCTGTTCACGATCTTCT	NA	NA	NA	NA
>prophage 12
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1831919	1841807	4735208	tRNA	Micromonas_sp._RCC1109_virus(16.67%)	7	NA	NA
WP_024745488.1|1831919_1833596_+	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.3	2.8e-37
WP_011408885.1|1833684_1834326_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_019300309.1|1834498_1835533_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.0	1.6e-112
WP_024745487.1|1835834_1836323_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_024745486.1|1836424_1839073_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.4e-83
WP_003481884.1|1839212_1839425_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_101807119.1|1841315_1841807_+	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.7	4.6e-57
>prophage 13
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	1968026	2049117	4735208	transposase,tRNA	uncultured_Caudovirales_phage(38.1%)	48	NA	NA
WP_024745402.1|1968026_1969544_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.5	8.6e-86
WP_024745401.1|1969685_1970822_+	two-component system response regulator	NA	NA	NA	NA	NA
WP_024745399.1|1971186_1973364_+	response regulator	NA	A0A1V0SGX0	Hokovirus	33.1	1.3e-47
WP_019299970.1|1973375_1974245_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_024745398.1|1974421_1976104_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	2.1e-32
WP_024745396.1|1976753_1979522_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_003486316.1|1979669_1979918_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259444.1|1979914_1980325_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_024745395.1|1980390_1982982_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_024745394.1|1983335_1984151_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_101807130.1|1984806_1987050_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024745392.1|1987158_1988235_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_010365269.1|1988231_1988828_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_019302811.1|1988824_1989691_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_082324264.1|1989936_1992327_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.3	3.9e-08
WP_082324486.1|1992405_1992750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002806488.1|1993104_1993587_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_082324263.1|1993722_1994520_-	flagellar brake protein	NA	NA	NA	NA	NA
WP_107490050.1|1995561_1997823_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_053513167.1|1998234_2000496_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	2.5e-12
WP_024742986.1|2001087_2003562_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	47.4	1.9e-10
WP_107490031.1|2003607_2004639_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_053514012.1|2007666_2009910_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.4e-14
WP_082324099.1|2010419_2011796_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_053513639.1|2012077_2014291_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	1.9e-09
WP_053513641.1|2014488_2016858_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.7	2.7e-09
WP_024744836.1|2016871_2017633_-	transporter	NA	NA	NA	NA	NA
WP_024744835.1|2023140_2025402_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	61.4	2.8e-08
WP_082324130.1|2025520_2026537_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_107490051.1|2026513_2027300_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_154221295.1|2027753_2027918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490052.1|2027984_2029016_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	8.7e-74
WP_024743066.1|2029319_2031329_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002806565.1|2031362_2031728_-	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_010375641.1|2031724_2032033_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_024743067.1|2032133_2033156_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024743068.1|2033152_2033935_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	1.7e-13
WP_024743069.1|2033936_2034911_-	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_014503259.1|2034917_2035658_-	flagellar motor protein	NA	NA	NA	NA	NA
WP_024743070.1|2035746_2036100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003138.1|2038386_2039094_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.4e-51
WP_082330725.1|2039096_2040041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130625354.1|2039673_2040609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743072.1|2040610_2042830_-	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	28.6	3.7e-05
WP_024743073.1|2043084_2043537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330727.1|2044428_2047470_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082324483.1|2047714_2047993_-	hypothetical protein	NA	A0A0P0ZG22	Escherichia_phage	70.3	9.0e-34
WP_058419068.1|2048148_2049117_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
>prophage 14
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	2136150	2217462	4735208	transposase,protease,tRNA	Ralstonia_phage(16.67%)	55	NA	NA
WP_024744408.1|2136150_2137287_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024744409.1|2137283_2137742_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024744410.1|2137992_2138313_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.3e-12
WP_024744411.1|2138455_2140738_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	5.1e-175
WP_002813418.1|2140945_2141164_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024744412.1|2141244_2141997_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024744413.1|2142130_2142760_-	cinnamoyl-CoA reductase	NA	NA	NA	NA	NA
WP_154221278.1|2142951_2143173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744414.1|2143435_2144557_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024744415.1|2144614_2145583_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	1.2e-64
WP_053513572.1|2145866_2148224_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_024744416.1|2148386_2150315_+	DUF3857 domain-containing protein	NA	NA	NA	NA	NA
WP_082324480.1|2150421_2151051_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_033003706.1|2151163_2155330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744419.1|2155566_2156943_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	4.0e-74
WP_024744420.1|2156974_2157301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324256.1|2157297_2157705_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	7.5e-21
WP_024744422.1|2157736_2158087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744423.1|2158083_2159415_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	4.3e-41
WP_024744424.1|2159735_2160941_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_024744425.1|2161105_2163478_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_053513574.1|2163502_2164135_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2164353_2164779_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_024744427.1|2164797_2166003_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_024744428.1|2166013_2166802_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_024744429.1|2166798_2167659_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024744430.1|2167729_2168368_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082324255.1|2168364_2169585_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_024744432.1|2169595_2170993_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_024744433.1|2171307_2172528_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_082330762.1|2173019_2174180_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_107490084.1|2175028_2176045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	2.8e-48
WP_101807143.1|2176382_2176982_-	DUF1264 domain-containing protein	NA	NA	NA	NA	NA
WP_101807144.1|2177127_2178096_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.8e-98
WP_082324479.1|2178244_2178634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744965.1|2178572_2178950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033003964.1|2179155_2180409_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_101807145.1|2180446_2181016_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_024744963.1|2180999_2181362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744960.1|2183736_2184714_-	siroheme synthase	NA	NA	NA	NA	NA
WP_024744957.1|2186035_2186224_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024744956.1|2186236_2186512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019302775.1|2187156_2187414_+	stress-induced protein	NA	NA	NA	NA	NA
WP_101807146.1|2187639_2188608_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_024744883.1|2189249_2189735_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_024744882.1|2189841_2190762_+	M14 family metallocarboxypeptidase	NA	NA	NA	NA	NA
WP_024744881.1|2191951_2193763_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024744880.1|2194513_2203942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259043.1|2204219_2204831_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024744879.1|2204827_2205850_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024744878.1|2205968_2207453_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744877.1|2207449_2210542_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_033003914.1|2210534_2211650_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_101838178.1|2212139_2214875_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_107490085.1|2216361_2217462_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	3.2e-42
>prophage 15
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	2235000	2373419	4735208	transposase,plate	Tupanvirus(35.71%)	51	NA	NA
WP_082324252.1|2235000_2235960_-|transposase	transposase	transposase	A0A0M5M147	Mycobacterium_phage	33.8	5.7e-11
WP_133260223.1|2236012_2240005_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.7	4.6e-54
WP_130625348.1|2240008_2240491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743561.1|2240401_2243041_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	4.1e-67
WP_024743560.1|2242968_2243676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159056199.1|2243906_2263316_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.1	9.2e-132
WP_107490057.1|2263393_2285806_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	1.1e-133
WP_107490058.1|2285802_2300289_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	24.9	6.2e-125
WP_024744003.1|2300820_2301915_+	type III polyketide synthase	NA	NA	NA	NA	NA
WP_024744002.1|2301954_2302698_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024744001.1|2302694_2303972_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_024744000.1|2303959_2305315_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743999.1|2305311_2306109_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_024743998.1|2306185_2307892_+	cyclic peptide export ABC transporter	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	22.4	2.0e-06
WP_003468470.1|2307990_2308209_+	MbtH family NRPS accessory protein	NA	NA	NA	NA	NA
WP_024743997.1|2308591_2310175_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_101807146.1|2312107_2313076_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.1e-99
WP_024743719.1|2314978_2318104_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_024743718.1|2318155_2319268_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024743717.1|2319391_2319970_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053512987.1|2322518_2324606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743837.1|2326547_2329637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003488.1|2331921_2332629_+	response regulator	NA	NA	NA	NA	NA
WP_101807160.1|2332625_2333618_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_033003485.1|2333614_2336074_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_033003483.1|2336187_2337168_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743831.1|2337176_2338205_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_024743830.1|2338377_2338704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743829.1|2338700_2341604_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	5.6e-09
WP_024743828.1|2341600_2342323_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_024743827.1|2342319_2342967_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_024743826.1|2342963_2346422_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_024743825.1|2346425_2347742_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_024743824.1|2347743_2349081_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_024743823.1|2349077_2350466_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_024743822.1|2350462_2351002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743821.1|2351010_2352948_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	7.7e-39
WP_024743820.1|2353211_2353673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743819.1|2353775_2353979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324173.1|2355023_2356400_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419068.1|2356562_2357531_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_024743894.1|2357972_2360744_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.2e-77
WP_024743895.1|2360776_2361787_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024743896.1|2361750_2363628_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_024743897.1|2363631_2364135_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_024743898.1|2364122_2364956_-	ImpE protein	NA	NA	NA	NA	NA
WP_024743899.1|2364991_2365495_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_024743900.1|2365594_2367109_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024743901.1|2367101_2367608_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_101807075.1|2367952_2368750_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058419105.1|2372450_2373419_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.1e-98
>prophage 16
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	2598715	2700239	4735208	protease,transposase,tRNA	Ralstonia_phage(18.75%)	60	NA	NA
WP_058419031.1|2598715_2599684_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_053513013.1|2600064_2601900_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	9.5e-23
WP_024744752.1|2602171_2603263_+	ribonuclease D	NA	NA	NA	NA	NA
WP_082324230.1|2605312_2605477_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_024744755.1|2605701_2606103_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024744756.1|2606913_2607999_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_024744757.1|2608041_2608551_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_024744758.1|2608562_2610221_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.6	2.7e-08
WP_082324229.1|2613281_2613698_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_014503014.1|2614269_2614710_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.0	7.1e-25
WP_024744763.1|2614788_2615424_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_082324468.1|2615820_2616564_-	cytochrome c1	NA	NA	NA	NA	NA
WP_024744765.1|2616571_2617831_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_024744766.1|2617830_2618475_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_024744767.1|2619002_2619989_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.0	1.3e-29
WP_050588012.1|2621341_2621635_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024744770.1|2621930_2623385_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_024744771.1|2623808_2624795_+	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	47.7	4.8e-45
WP_033003832.1|2625225_2625870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744772.1|2625924_2626410_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_024744773.1|2626409_2626928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744774.1|2627022_2627901_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024744775.1|2627897_2629178_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_024744776.1|2629193_2630195_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033003835.1|2630346_2631711_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024744778.1|2632185_2633034_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744779.1|2633030_2633942_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024744780.1|2634070_2635204_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	7.4e-26
WP_082324228.1|2635349_2636861_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744782.1|2636847_2638434_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_024744783.1|2638430_2639633_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_058419102.1|2640481_2641450_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_024743152.1|2644069_2645455_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024743150.1|2646101_2647481_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_033003186.1|2647480_2648797_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_082330729.1|2648933_2650178_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	1.9e-19
WP_024743147.1|2650483_2651764_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_082324226.1|2652065_2652374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743145.1|2652333_2654682_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_024743144.1|2654678_2655524_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_024743143.1|2655530_2657210_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_024743142.1|2657738_2659091_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024743141.1|2659151_2662283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743140.1|2662447_2663302_+	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_024743139.1|2663472_2664777_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_024743138.1|2664918_2669013_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	5.0e-56
WP_058419204.1|2670105_2671074_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_024743589.1|2671560_2676570_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_101807175.1|2676847_2677507_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743591.1|2677521_2678829_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024743592.1|2678841_2682012_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_107490059.1|2683522_2684554_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.8e-74
WP_024744846.1|2684702_2685698_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024744845.1|2685858_2688375_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_024744844.1|2688371_2689328_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_024744843.1|2689486_2691229_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_082324465.1|2691547_2692684_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_058419101.1|2693078_2695841_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.4	3.6e-42
WP_024712661.1|2696111_2696837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324130.1|2699222_2700239_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
>prophage 17
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	2899229	3043314	4735208	protease,transposase,coat,tRNA	Ralstonia_phage(12.5%)	103	NA	NA
WP_058419036.1|2899229_2900198_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
WP_050587988.1|2901702_2902605_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_024743339.1|2902802_2904170_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.7	4.8e-112
WP_024743338.1|2904421_2904934_+	DUF3060 domain-containing protein	NA	NA	NA	NA	NA
WP_082324207.1|2904863_2905103_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743337.1|2905445_2906945_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024743336.1|2906941_2907874_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024743335.1|2908054_2910883_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_024743334.1|2910925_2912128_+	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_014502759.1|2912369_2913806_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	3.7e-38
WP_024743333.1|2914004_2914598_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.5	2.1e-11
WP_082324453.1|2914862_2915456_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	41.2	8.1e-16
WP_024743331.1|2915452_2917222_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.5	5.2e-58
WP_024743330.1|2917464_2918319_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024743329.1|2918315_2919719_+	TolC family protein	NA	NA	NA	NA	NA
WP_024743328.1|2920070_2920265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743327.1|2920544_2921666_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_024743326.1|2921662_2922580_-	pyridoxal kinase	NA	NA	NA	NA	NA
WP_024743325.1|2923107_2924238_-	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.3	1.4e-24
WP_024743324.1|2924397_2926323_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	2.2e-147
WP_011258741.1|2926464_2926983_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_082324206.1|2927083_2928136_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_024743322.1|2928252_2929917_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_082324204.1|2930359_2930785_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_011258737.1|2930874_2931270_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_024743320.1|2931616_2931892_-	RnfH family protein	NA	NA	NA	NA	NA
WP_024743319.1|2931905_2932337_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_010366344.1|2932397_2932901_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	41.9	5.8e-23
WP_024743318.1|2933065_2935513_-	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	26.7	2.6e-15
WP_058419096.1|2937262_2938231_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_101807198.1|2938453_2939830_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	7.3e-60
WP_033003395.1|2940598_2941291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625332.1|2941409_2941835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490060.1|2942988_2944091_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_033003338.1|2945103_2945352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082330739.1|2945628_2946783_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_024743456.1|2946782_2948105_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_024743457.1|2948131_2949172_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_082324452.1|2949189_2950050_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_024743458.1|2950085_2950685_+	LysE family translocator	NA	NA	NA	NA	NA
WP_082324200.1|2950751_2951687_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_082324199.1|2951752_2953105_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_058419055.1|2953653_2955030_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_158525112.1|2955026_2956124_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	1.5e-76
WP_101807049.1|2956172_2957274_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_024743394.1|2960624_2961599_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.0	2.6e-19
WP_024743393.1|2963461_2964187_-	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.8e-09
WP_101807075.1|2964649_2965447_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082324197.1|2965455_2966910_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.5	4.4e-47
WP_024743064.1|2966976_2968407_-	replicative DNA helicase	NA	O80281	Escherichia_phage	53.6	3.8e-120
WP_024743063.1|2968628_2969183_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	34.1	1.2e-18
WP_024743062.1|2969399_2971340_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.8	2.6e-26
WP_024743061.1|2971515_2972154_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_012444392.1|2976220_2977012_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_024743060.1|2977157_2977373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743059.1|2977372_2978140_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_024743058.1|2978201_2979032_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_024743057.1|2979104_2979533_+	cytochrome c	NA	NA	NA	NA	NA
WP_024743056.1|2979664_2980144_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|2980394_2980610_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_024743055.1|2980837_2981323_+	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_024744839.1|2983941_2986173_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	59.7	1.5e-09
WP_058419090.1|2986316_2987693_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_058419089.1|2988811_2989780_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	5.6e-99
WP_101836935.1|2990101_2991175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807200.1|2991347_2992316_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_033004173.1|2993406_2994042_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_053513872.1|2994177_2995695_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_024745369.1|2996029_2997910_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.9	5.2e-24
WP_024745370.1|2998098_2998878_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011259009.1|2998959_2999445_-	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_082330790.1|3001902_3002142_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_024745371.1|3002391_3003105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745372.1|3004618_3005125_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024745373.1|3005286_3005865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745374.1|3005956_3006457_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024745375.1|3006523_3007369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588027.1|3007419_3007698_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_024745377.1|3007917_3008106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014503886.1|3008519_3009128_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_024745379.1|3010324_3012142_+	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745380.1|3012270_3014460_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_101807204.1|3014905_3015703_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024744163.1|3015889_3016105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744160.1|3017569_3019150_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_024744159.1|3019156_3020350_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_033003622.1|3020372_3021878_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_024744158.1|3021874_3022315_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744157.1|3022437_3023289_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024744156.1|3023349_3025593_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.6	7.2e-81
WP_011408338.1|3026038_3026524_-	bacterioferritin	NA	NA	NA	NA	NA
WP_024744154.1|3026670_3029088_+	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_024744153.1|3029670_3031797_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_154221274.1|3031933_3032071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324194.1|3032244_3033351_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_024744151.1|3033419_3035114_-	asparagine synthase B	NA	A0A0P0C1V4	Ostreococcus_lucimarinus_virus	38.8	1.3e-87
WP_024744149.1|3036543_3037059_-	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	36.9	1.6e-20
WP_024744148.1|3037055_3037412_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_024744147.1|3037408_3037879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744146.1|3037875_3039072_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_024744145.1|3039088_3041698_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_024744144.1|3041694_3042471_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_033003618.1|3042789_3043314_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 18
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	3537735	3558501	4735208	transposase,tRNA	Ralstonia_phage(60.0%)	15	NA	NA
WP_058419069.1|3537735_3538704_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	1.6e-98
WP_130625388.1|3538798_3538990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745347.1|3539062_3539455_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_130625389.1|3541240_3542131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419068.1|3542598_3543567_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_082324099.1|3543811_3545188_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_107490060.1|3546190_3547293_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_101807338.1|3548153_3549156_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	4.2e-97
WP_024744854.1|3552240_3552441_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_024744855.1|3552803_3553598_+	thiazole synthase	NA	NA	NA	NA	NA
WP_014504352.1|3553899_3554658_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014504353.1|3554733_3556596_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_024744856.1|3556653_3556995_-	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_014504356.1|3557253_3557529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101807223.1|3557702_3558501_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	3646144	3706141	4735208	protease,transposase	Ralstonia_phage(25.0%)	45	NA	NA
WP_058419065.1|3646144_3647521_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_011407794.1|3647785_3648436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743468.1|3648808_3650098_-	citrate synthase	NA	NA	NA	NA	NA
WP_005911911.1|3650332_3650575_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_024743469.1|3650645_3651584_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_024743470.1|3651716_3653870_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_024743471.1|3653890_3654271_-	RidA family protein	NA	NA	NA	NA	NA
WP_024743472.1|3654350_3656522_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_002812428.1|3656650_3656950_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_024743473.1|3657218_3657830_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	31.5	1.8e-10
WP_024743474.1|3657945_3658806_-	YicC family protein	NA	NA	NA	NA	NA
WP_024743475.1|3658915_3659641_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_082324150.1|3660002_3660626_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.2	2.0e-12
WP_024743477.1|3660641_3661799_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_024743478.1|3661965_3664386_+	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_024743479.1|3664382_3664730_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_024743480.1|3664928_3666254_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_024743481.1|3667140_3668481_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_011407785.1|3668491_3669034_-	YecA family protein	NA	NA	NA	NA	NA
WP_024743482.1|3669271_3669493_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_019300828.1|3669489_3669789_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_024743483.1|3670399_3670990_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_024743484.1|3670986_3671457_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_024743485.1|3671548_3672196_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_024743486.1|3672350_3672800_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_024743487.1|3672949_3673831_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011257965.1|3673880_3674120_-	rubredoxin	NA	NA	NA	NA	NA
WP_024743488.1|3674143_3674767_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_024743490.1|3678674_3679964_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_024743491.1|3680491_3683263_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_024743492.1|3683341_3683791_-	azurin	NA	NA	NA	NA	NA
WP_024743493.1|3685234_3685738_-	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_101807228.1|3686186_3687153_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	2.5e-99
WP_024744368.1|3689734_3690352_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_024744369.1|3690597_3691824_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.4	4.4e-16
WP_101807229.1|3693993_3694791_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024743791.1|3694838_3695498_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_024743790.1|3695649_3697737_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_024743789.1|3698459_3699344_-	membrane protein	NA	NA	NA	NA	NA
WP_024743788.1|3699490_3700087_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_033003466.1|3700086_3701445_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_019303282.1|3701809_3702373_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	2.1e-13
WP_024743786.1|3702532_3703789_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_058419161.1|3704088_3705057_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	2.3e-100
WP_058419062.1|3705178_3706141_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	3804710	3872547	4735208	protease,transposase,tRNA	Staphylococcus_phage(14.29%)	46	NA	NA
WP_058419057.1|3804710_3805679_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	3.0e-100
WP_024744620.1|3805880_3806303_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	62.2	1.0e-41
WP_024744619.1|3806889_3807279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744618.1|3807271_3808924_+|protease	serine protease	protease	NA	NA	NA	NA
WP_107490066.1|3809375_3810181_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.1	9.1e-10
WP_024745219.1|3810233_3811412_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	6.9e-51
WP_050588023.1|3811798_3812728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324136.1|3812892_3814293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745216.1|3814240_3816148_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_101807234.1|3816160_3817183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745214.1|3817312_3818152_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024745213.1|3818762_3819920_+	phosphotransferase	NA	NA	NA	NA	NA
WP_024745212.1|3819955_3822118_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024745211.1|3822492_3823068_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_024745210.1|3823173_3823902_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_024745209.1|3824311_3825151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745208.1|3825147_3827451_-	type II secretion system secretin GspD	NA	A7BJX1	Enterobacteria_phage	24.4	1.5e-09
WP_053513838.1|3827447_3828266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745206.1|3828255_3828909_-	general secretion pathway protein GspM	NA	NA	NA	NA	NA
WP_024745205.1|3828892_3830014_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011407644.1|3830010_3830862_-	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_024745204.1|3830858_3831494_-	type II secretion system protein J	NA	NA	NA	NA	NA
WP_024745203.1|3831490_3831907_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_024745202.1|3831903_3832413_-	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_011407642.1|3832422_3832854_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_011257722.1|3833121_3834339_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_082324135.1|3834338_3834518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324134.1|3834514_3836254_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_024745200.1|3836371_3838255_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.7	7.0e-21
WP_053513836.1|3838475_3844556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745197.1|3845533_3849586_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	56.9	5.8e-121
WP_024745196.1|3850001_3850799_-	DsbC family protein	NA	NA	NA	NA	NA
WP_024745195.1|3851282_3852254_-	site-specific tyrosine recombinase XerD	NA	A0A0K0N6I5	Gordonia_phage	30.3	1.9e-14
WP_024745194.1|3852679_3853147_+	RDD family protein	NA	NA	NA	NA	NA
WP_082324133.1|3853244_3853556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745193.1|3853560_3854667_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_053513834.1|3854663_3855746_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_024745191.1|3855853_3857326_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	9.0e-48
WP_024745189.1|3857681_3858107_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_082324132.1|3858117_3859350_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324131.1|3859352_3860000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745188.1|3860128_3863071_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.2	2.2e-130
WP_053513831.1|3863793_3865767_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	1.3e-14
WP_107490046.1|3866967_3868069_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_082324130.1|3869160_3870177_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
WP_082324130.1|3871530_3872547_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.5e-49
>prophage 21
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	3892346	3898716	4735208		Enterobacteria_phage(50.0%)	6	NA	NA
WP_011407616.1|3892346_3893693_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_024743259.1|3893738_3895142_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.8	1.6e-41
WP_024743260.1|3895258_3896167_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	33.8	5.4e-27
WP_024743261.1|3896163_3896721_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	1.7e-44
WP_011407613.1|3896717_3897605_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|3897660_3898716_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
>prophage 22
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	4088761	4226753	4735208	integrase,head,portal,protease,tail,terminase,transposase,capsid,tRNA	Xanthomonas_phage(12.82%)	120	4092828:4092847	4232586:4232605
WP_107490031.1|4088761_4089793_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_024745220.1|4090676_4091453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745221.1|4091449_4092766_+	amino acid permease	NA	NA	NA	NA	NA
4092828:4092847	attL	TAAGAGCGGCTAACAAAACG	NA	NA	NA	NA
WP_024745222.1|4092978_4093260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745223.1|4093432_4093765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745224.1|4093819_4094254_-	membrane protein	NA	NA	NA	NA	NA
WP_024745225.1|4094438_4095617_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_024745226.1|4096156_4098328_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_024745227.1|4098556_4098913_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_053513894.1|4098992_4100057_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.4	5.1e-101
WP_002808376.1|4100336_4100552_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_024745386.1|4101084_4101531_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.5	3.9e-23
WP_107490031.1|4102578_4103610_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_024743721.1|4104149_4105112_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_024743720.1|4105200_4106949_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.8	6.5e-45
WP_101807049.1|4107226_4108328_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_133260305.1|4108342_4108624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743275.1|4108953_4110000_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_024743274.1|4110183_4111764_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_033003251.1|4112162_4113050_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_024743273.1|4113052_4114216_-	heme A synthase	NA	NA	NA	NA	NA
WP_024743272.1|4114226_4114802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743271.1|4114829_4115552_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_012443949.1|4115612_4115831_+	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_024743270.1|4115923_4116799_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_024743269.1|4116837_4117434_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_010374673.1|4117430_4117604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743268.1|4117584_4119189_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_024743267.1|4119227_4120181_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_082324408.1|4120197_4120629_-	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_024743265.1|4120950_4124151_+	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_107490046.1|4126051_4127153_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_024743210.1|4133662_4134874_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024743211.1|4135044_4136463_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	37.9	6.9e-13
WP_024743212.1|4136833_4137967_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_024743213.1|4138004_4138232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324407.1|4138290_4139511_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743215.1|4139905_4140706_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	29.0	3.1e-26
WP_154221257.1|4140868_4141033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050587987.1|4141029_4141305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743216.1|4141748_4142006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265059.1|4141969_4143172_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_082330731.1|4143350_4143614_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	9.8e-06
WP_107490070.1|4143610_4145308_-	DUF2875 family protein	NA	NA	NA	NA	NA
WP_024745781.1|4145304_4147455_-	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	3.0e-28
WP_107490071.1|4147523_4150247_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	2.6e-69
WP_033003665.1|4150629_4150830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744292.1|4150924_4151719_-	DNA adenine methylase	NA	B7SYF3	Stenotrophomonas_phage	79.9	2.9e-125
WP_107490072.1|4151834_4152566_-	DUF2793 domain-containing protein	NA	A0A1V0DY81	Dinoroseobacter_phage	40.7	4.3e-35
WP_107490073.1|4152567_4156428_-	hypothetical protein	NA	A0A1I9L2F3	Xanthomonas_phage	53.7	0.0e+00
WP_024744296.1|4156852_4157728_-	DUF2163 domain-containing protein	NA	A0A1I9L2F1	Xanthomonas_phage	50.7	3.7e-81
WP_024744297.1|4157724_4158327_-	hypothetical protein	NA	A0A1I9L2F0	Xanthomonas_phage	52.7	2.3e-50
WP_024744298.1|4158329_4161875_-|tail	phage tail tape measure protein	tail	A5H1M1	Xanthomonas_virus	39.7	4.0e-33
WP_024744299.1|4162030_4163176_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_024744300.1|4163419_4163638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744301.1|4163739_4164090_-	hypothetical protein	NA	G9FHI3	Rhodococcus_phage	50.4	1.5e-22
WP_024711926.1|4164093_4164546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744302.1|4164611_4164947_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024711928.1|4164943_4165345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744303.1|4165337_4165670_-|head	phage head closure protein	head	C7BGH2	Burkholderia_phage	38.9	4.3e-06
WP_024744304.1|4165666_4166083_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	37.7	3.5e-05
WP_024744305.1|4166086_4166311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744306.1|4166368_4167613_-|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	45.9	8.6e-92
WP_024744307.1|4167678_4168407_-|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	54.9	1.1e-49
WP_024744308.1|4168369_4169689_-|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	37.8	2.8e-61
WP_024744309.1|4169688_4171365_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	71.5	6.1e-234
WP_024744310.1|4171367_4171748_-	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	53.2	8.8e-32
WP_107490087.1|4171849_4172248_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	42.7	2.4e-11
WP_024745476.1|4172819_4173095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745477.1|4173091_4173508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745478.1|4173590_4173812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745479.1|4173808_4174153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082330794.1|4174149_4174584_-	glycoside hydrolase family 104 protein	NA	D5LH07	Escherichia_phage	67.6	1.4e-49
WP_024745481.1|4174746_4175025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712687.1|4175166_4175721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004216.1|4175713_4175902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050588030.1|4176005_4177361_-	AAA family ATPase	NA	O80281	Escherichia_phage	36.0	2.9e-53
WP_024745483.1|4177357_4177657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745184.1|4178241_4178523_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024745182.1|4178920_4179208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745181.1|4179299_4179992_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033004080.1|4180254_4180632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745179.1|4180698_4180887_+	carbon storage regulator	NA	NA	NA	NA	NA
WP_024745178.1|4181090_4181321_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_024745177.1|4181247_4182447_-|integrase	site-specific integrase	integrase	B7SYF8	Stenotrophomonas_phage	36.2	1.4e-62
WP_024745176.1|4182781_4183441_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_050588022.1|4183463_4184222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745174.1|4184259_4185057_+	ParA family protein	NA	Q8JL10	Natrialba_phage	30.3	9.5e-20
WP_024745173.1|4185056_4185983_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.9	1.0e-12
WP_024745172.1|4186018_4186327_+	mitomycin resistance protein	NA	NA	NA	NA	NA
WP_024745171.1|4186531_4187497_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	30.5	1.6e-29
WP_024745170.1|4187863_4188586_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010374733.1|4188585_4188927_+	membrane protein	NA	NA	NA	NA	NA
WP_033004077.1|4189344_4189893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053513868.1|4190000_4192349_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.5	4.5e-49
WP_024745166.1|4192362_4192830_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	96.1	1.1e-79
WP_024745165.1|4192826_4194101_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.2	5.8e-35
WP_033004073.1|4194197_4194875_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_024745163.1|4194962_4196651_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_101807257.1|4196830_4197712_+	sporulation protein	NA	NA	NA	NA	NA
WP_033004066.1|4197718_4198198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745162.1|4198289_4199045_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107490076.1|4200424_4204327_-	avirulence protein	NA	NA	NA	NA	NA
WP_024743689.1|4206848_4208735_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_024743690.1|4208973_4209831_+	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	32.5	2.2e-14
WP_011257189.1|4210269_4210881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743691.1|4211073_4211886_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_082324405.1|4212564_4213101_+	kinase	NA	NA	NA	NA	NA
WP_024743693.1|4213449_4215435_-	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_033003410.1|4216048_4216387_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_024743695.1|4216576_4216855_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_024743696.1|4216871_4218392_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_101807261.1|4218472_4219271_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_024744211.1|4219718_4220228_+	lipocalin family protein	NA	A0A167RLA9	Powai_lake_megavirus	35.4	5.3e-16
WP_082324403.1|4220382_4220520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744210.1|4220941_4222504_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024744209.1|4222569_4223691_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_082324113.1|4223700_4224795_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_024744207.1|4224870_4225518_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_058419050.1|4225784_4226753_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
4232586:4232605	attR	CGTTTTGTTAGCCGCTCTTA	NA	NA	NA	NA
>prophage 23
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	4284482	4361266	4735208	transposase	Acidithiobacillus_phage(21.43%)	56	NA	NA
WP_101807275.1|4284482_4285451_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_050588016.1|4285894_4286365_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024744929.1|4287049_4289182_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_082324401.1|4289668_4290031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744927.1|4290032_4290884_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_024744926.1|4290936_4291818_+	TolB-like protein	NA	NA	NA	NA	NA
WP_024744925.1|4292483_4295045_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_101807267.1|4295277_4296030_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.3	2.8e-21
WP_053513030.1|4296157_4297072_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024744922.1|4297164_4298142_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_014505063.1|4298329_4299322_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_033003934.1|4299542_4299791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744920.1|4299996_4300467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024744919.1|4300567_4302358_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_024744918.1|4302562_4304800_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_101807344.1|4306393_4307410_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	3.3e-49
WP_082324203.1|4307580_4308957_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_024743126.1|4311375_4312386_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_024743127.1|4312786_4313980_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024712051.1|4313976_4314723_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	5.2e-20
WP_024743128.1|4314754_4316356_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4316416_4316617_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024743129.1|4316613_4317201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743130.1|4317649_4317922_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024743131.1|4317987_4318977_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_082324107.1|4319046_4319808_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_024743133.1|4319910_4320906_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.2	8.5e-26
WP_033003179.1|4320923_4321715_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743135.1|4321716_4322301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033003181.1|4322419_4323358_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_101807269.1|4323471_4323675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807049.1|4323714_4324816_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.0e-43
WP_058419060.1|4325244_4326621_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024744975.1|4327201_4327750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512924.1|4328237_4328522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744977.1|4329106_4330384_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011257407.1|4330663_4330990_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_024744978.1|4330961_4331456_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	36.1	2.7e-17
WP_024744979.1|4331463_4332789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024712257.1|4332863_4333907_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.1	1.1e-151
WP_024744980.1|4334104_4336603_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	67.1	6.4e-304
WP_024744981.1|4337218_4338262_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	4.8e-80
WP_024744982.1|4338368_4341077_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024744983.1|4341363_4341978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4342049_4343417_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024744985.1|4344110_4345934_+	potassium transporter KefB	NA	NA	NA	NA	NA
WP_082330734.1|4347477_4349421_-	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	37.3	2.6e-79
WP_024743306.1|4349270_4351070_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_082324102.1|4351133_4351463_-	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_024743307.1|4351489_4354810_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011407425.1|4354802_4355063_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_024743308.1|4355281_4356481_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_024743309.1|4356480_4357254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743310.1|4357250_4358072_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024743311.1|4358068_4359691_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_101807272.1|4359889_4361266_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	2.2e-64
>prophage 24
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	4398433	4458422	4735208	transposase	Ralstonia_phage(37.5%)	41	NA	NA
WP_101807346.1|4398433_4399810_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	1.3e-61
WP_024743743.1|4400023_4400695_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_024743744.1|4401970_4402993_+	amidohydrolase	NA	NA	NA	NA	NA
WP_002809462.1|4403382_4403550_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002809459.1|4403563_4403800_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_024743745.1|4403984_4404344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743746.1|4406823_4407462_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_024743747.1|4407684_4409313_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_014501576.1|4411086_4411683_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_024743748.1|4411809_4412061_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_024743749.1|4412122_4412560_-	GFA family protein	NA	NA	NA	NA	NA
WP_024743750.1|4412556_4413336_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_024743751.1|4415014_4416742_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_024743752.1|4416738_4417056_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_024743753.1|4418821_4420765_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.8	8.7e-83
WP_014501567.1|4421026_4421695_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024743755.1|4422959_4423163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154221268.1|4424458_4424617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743756.1|4424734_4425745_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_024743757.1|4425741_4426614_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011260809.1|4426610_4427381_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024743758.1|4427550_4428408_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_024743759.1|4428930_4430250_+	L-fuconate dehydratase	NA	NA	NA	NA	NA
WP_101807275.1|4430744_4431713_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_082324392.1|4431838_4432204_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_024743782.1|4432200_4433502_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_024743781.1|4433682_4434459_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024743780.1|4434935_4435520_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_024743779.1|4435712_4439162_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_024743778.1|4439913_4442556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743777.1|4442659_4445059_-	NdvB protein	NA	NA	NA	NA	NA
WP_024743776.1|4445061_4446444_-	MFS transporter	NA	NA	NA	NA	NA
WP_024743775.1|4446601_4447186_+	gluconokinase	NA	NA	NA	NA	NA
WP_024743774.1|4448021_4449752_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	36.1	1.7e-82
WP_082324100.1|4450083_4450389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324389.1|4450291_4450732_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_024743773.1|4450751_4451180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107490088.1|4451356_4452458_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.5e-42
WP_107490046.1|4453933_4455035_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807277.1|4455054_4456023_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_058419036.1|4457453_4458422_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	2.5e-99
>prophage 25
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	4469096	4548377	4735208	transposase,tRNA	Acidithiobacillus_phage(20.0%)	50	NA	NA
WP_024743463.1|4469096_4471355_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_024743462.1|4471512_4472421_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_024743461.1|4472510_4474325_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_159056200.1|4474718_4483505_-	hypothetical protein	NA	A0A1S5SDF1	Streptococcus_phage	32.0	1.4e-10
WP_011409712.1|4484129_4484882_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_024745621.1|4484941_4485841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745620.1|4485993_4486749_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_024745619.1|4486745_4487318_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4487333_4487561_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024745618.1|4487633_4488539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745617.1|4488692_4489658_+	ferrochelatase	NA	NA	NA	NA	NA
WP_024745616.1|4489660_4490512_+	alpha/beta hydrolase	NA	R4JP33	Mycobacterium_phage	31.3	1.3e-06
WP_024745615.1|4490592_4491051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745614.1|4491321_4492107_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_024745613.1|4492722_4493628_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	33.2	1.4e-43
WP_024745612.1|4493691_4494609_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	3.1e-83
WP_024745611.1|4495242_4496580_+	xylose isomerase	NA	NA	NA	NA	NA
WP_107490031.1|4496704_4497736_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.2	1.3e-74
WP_024744967.1|4497894_4498962_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024744968.1|4499137_4501333_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_024744969.1|4501329_4503294_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_024744970.1|4503305_4504565_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	7.7e-40
WP_033003968.1|4504564_4506265_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024744973.1|4509333_4510797_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	31.6	2.9e-46
WP_107490078.1|4510848_4511907_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	43.5	1.2e-75
WP_082324355.1|4512062_4513439_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_033003464.1|4513615_4514719_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.4	9.4e-58
WP_024743784.1|4514810_4515185_-	VOC family protein	NA	NA	NA	NA	NA
WP_082324356.1|4515885_4516902_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_058419055.1|4517034_4518411_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024743734.1|4519044_4520100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743735.1|4520326_4521745_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_024743736.1|4521785_4522763_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_082324358.1|4524167_4525649_-	MFS transporter	NA	NA	NA	NA	NA
WP_082324566.1|4525990_4528864_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743740.1|4528962_4530450_+	MFS transporter	NA	NA	NA	NA	NA
WP_024743741.1|4530481_4531516_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_024743742.1|4531857_4532391_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_101807285.1|4532672_4533641_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	6.6e-100
WP_154221296.1|4533692_4534031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807286.1|4534107_4534913_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.0	7.7e-09
WP_024743989.1|4535114_4535687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011349116.1|4535825_4536044_+	YdcH family protein	NA	NA	NA	NA	NA
WP_024743991.1|4536680_4537661_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_024743992.1|4537856_4540520_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_024743993.1|4540519_4541494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324359.1|4541492_4541738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743994.1|4541906_4542959_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513382.1|4543123_4546162_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058419058.1|4547000_4548377_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
>prophage 26
NZ_CP025609	Xanthomonas oryzae pv. oryzae strain MAI1 chromosome, complete genome	4735208	4565840	4723380	4735208	protease,transposase	Acidithiobacillus_phage(26.32%)	116	NA	NA
WP_107490079.1|4565840_4567217_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	2.1e-62
WP_024744511.1|4573695_4575600_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.0e-19
WP_024744510.1|4575596_4576199_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_024744509.1|4576299_4577559_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_024744508.1|4577849_4580012_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_024744507.1|4580164_4580371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082324361.1|4580578_4580968_-	YchJ family protein	NA	NA	NA	NA	NA
WP_082330766.1|4581025_4581847_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_101807292.1|4581971_4583348_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.3	4.3e-60
WP_053513660.1|4583479_4584661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053513661.1|4584758_4588190_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024745665.1|4588337_4589036_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_024745666.1|4589019_4590492_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_024745667.1|4590488_4591076_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_024745668.1|4591075_4592272_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082324363.1|4592345_4592975_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	49.5	4.2e-47
WP_050588040.1|4593068_4593566_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053513662.1|4594979_4595504_+	FUSC family protein	NA	NA	NA	NA	NA
WP_101807339.1|4595475_4596492_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.3	5.6e-49
WP_024744628.1|4596898_4598260_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.1	5.8e-33
WP_058419195.1|4598440_4599817_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	48.1	9.9e-65
WP_082324568.1|4600505_4601219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745343.1|4601249_4601756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745344.1|4602029_4602236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024745345.1|4602222_4603335_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_107490090.1|4603567_4604669_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	3.2e-42
WP_101807295.1|4604731_4605376_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_024743098.1|4605548_4606343_-	EcsC family protein	NA	NA	NA	NA	NA
WP_024743099.1|4606513_4606987_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_024743100.1|4609469_4609799_-	thioredoxin family protein	NA	A0A0K1Y9C9	Streptomyces_phage	32.5	7.2e-06
WP_024743101.1|4609819_4610218_-	host attachment protein	NA	NA	NA	NA	NA
WP_024743102.1|4610309_4611008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743103.1|4611177_4611648_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_058419060.1|4613395_4614772_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_024742954.1|4615296_4615608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742953.1|4615867_4616350_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_024742952.1|4616646_4617816_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_024742951.1|4618057_4618246_+	CsbD family protein	NA	NA	NA	NA	NA
WP_074038671.1|4618890_4619148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742950.1|4619272_4619722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024742949.1|4619878_4620859_+	ATP-binding cassette domain-containing protein	NA	K7PHD1	Enterobacteria_phage	46.4	7.0e-73
WP_082324366.1|4621778_4622135_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024743547.1|4622177_4624958_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_024743548.1|4625244_4626267_+	sugar kinase	NA	NA	NA	NA	NA
WP_154221263.1|4626730_4626871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743549.1|4626894_4628103_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_024743552.1|4630074_4631241_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_154221305.1|4632529_4632898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058419197.1|4633192_4634569_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.0e-77
WP_082324368.1|4634983_4637179_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.6	2.4e-65
WP_024712580.1|4637277_4638480_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_024743645.1|4638750_4639761_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_024743646.1|4640035_4640503_+	DUF4410 domain-containing protein	NA	NA	NA	NA	NA
WP_058419065.1|4641879_4643256_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.0	6.0e-62
WP_082324173.1|4643399_4644776_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	4.6e-78
WP_158500224.1|4644891_4645209_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058419078.1|4645321_4646290_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	4.3e-99
WP_130625425.1|4646714_4646945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625426.1|4647108_4649754_+	protein kinase/lanthionine synthetase C family protein	NA	NA	NA	NA	NA
WP_131085815.1|4649794_4650541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082324171.1|4650562_4651858_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_050587973.1|4651877_4654004_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.3	7.9e-29
WP_107490091.1|4654260_4655490_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	2.0e-61
WP_058419152.1|4655595_4656972_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	46.6	5.1e-61
WP_082324571.1|4658320_4658731_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_033003354.1|4658990_4659446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130625428.1|4659378_4659639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743497.1|4659669_4660557_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_033003355.1|4660890_4662468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743499.1|4662962_4663790_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_058419165.1|4664516_4665575_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.9	2.6e-73
WP_107490046.1|4667318_4668420_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.9e-43
WP_101807300.1|4668657_4669218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807296.1|4669216_4670185_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.9e-99
WP_130625431.1|4670279_4670582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745548.1|4670653_4671391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033004251.1|4671408_4672101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101807103.1|4673294_4674320_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	1.9e-49
WP_024743553.1|4674357_4674690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743554.1|4674682_4675159_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_024743555.1|4675161_4675596_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_024743556.1|4675711_4675957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003482333.1|4676293_4676626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260744.1|4676874_4676973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024743557.1|4677075_4678470_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_024745520.1|4679625_4679904_-	plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	37.0	2.9e-08
WP_024745521.1|4680001_4682263_-	exodeoxyribonuclease V subunit alpha	NA	A0A0N9S864	Staphylococcus_phage	44.9	1.5e-09
WP_053513647.1|4682450_4686512_-	exodeoxyribonuclease V subunit beta	NA	S5MMD7	Bacillus_phage	22.5	3.2e-10
WP_101807301.1|4686508_4689922_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_024745524.1|4690247_4690955_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	22.6	3.5e-05
WP_024745525.1|4690951_4692088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058419050.1|4692227_4693196_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	7.3e-99
WP_107490092.1|4693375_4694371_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.3	1.2e-96
WP_024743890.1|4695947_4696637_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.8e-35
WP_024743891.1|4696649_4697807_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_033003511.1|4697819_4699130_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_107490060.1|4699329_4700431_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.6	1.1e-42
WP_024743439.1|4700756_4701551_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.5	5.8e-09
WP_019302478.1|4701550_4702300_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024743440.1|4702311_4702863_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_024743441.1|4702859_4703522_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_024743442.1|4703511_4703802_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_053513651.1|4703812_4704871_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_082324372.1|4704943_4705465_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_058419058.1|4705552_4706929_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	3.2e-63
WP_130625433.1|4706887_4707268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744442.1|4707297_4707843_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	34.5	2.0e-16
WP_033003711.1|4708982_4710563_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_058419088.1|4710910_4711879_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_033003742.1|4714453_4714939_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_101807302.1|4715040_4716210_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.6	4.9e-41
WP_024744576.1|4716235_4717543_-	MFS transporter	NA	NA	NA	NA	NA
WP_024744577.1|4719394_4719715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024744578.1|4719833_4721000_-	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_024744579.1|4721262_4722219_+	TerC family protein	NA	K4F9T9	Cronobacter_phage	29.9	1.4e-30
WP_024744580.1|4722594_4723380_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
