The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	186	52717	4774500	protease,capsid,portal,integrase,lysis,holin,tail,tRNA,terminase,plate,head	Escherichia_phage(39.02%)	52	19864:19879	43019:43034
WP_159048238.1|186_756_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	57.5	2.1e-45
WP_000613358.1|755_1349_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.4	2.7e-59
WP_000978831.1|1320_1764_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	3.3e-46
WP_107316896.1|2920_3532_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.1e-116
WP_107316897.1|3524_4433_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	1.3e-161
WP_000127173.1|4437_4785_-|plate	baseplate assembly protein W	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_006778005.1|4781_5417_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.6	1.6e-110
WP_001001782.1|5483_5936_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	4.1e-76
WP_053285572.1|5928_6396_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	1.3e-80
WP_107316898.1|6503_6929_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	1.2e-64
WP_107316899.1|6916_7342_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.7	3.6e-58
WP_001144101.1|7356_7854_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|7853_8135_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|8138_8342_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|8341_8851_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_021570157.1|8950_9694_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	99.6	2.1e-125
WP_107316900.1|9697_10771_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	1.9e-201
WP_097755140.1|10829_11684_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.6	1.6e-134
WP_000156872.1|11857_13630_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_107316901.1|13629_14664_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.8	6.0e-200
WP_107316902.1|14856_15858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021530418.1|16327_17872_+	RNA-directed DNA polymerase	NA	Q2P9X0	Enterobacteria_phage	99.0	1.4e-288
WP_107316903.1|18359_20636_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.6	0.0e+00
19864:19879	attL	ACATCACGAATGGCGT	NA	NA	NA	NA
WP_000027672.1|20625_20901_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
WP_001113259.1|20897_21122_-	hypothetical protein	NA	Q858T6	Yersinia_virus	97.3	1.1e-34
WP_001277944.1|21121_21424_-	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	94.0	5.5e-45
WP_021530416.1|21423_21648_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	2.0e-31
WP_000217671.1|21711_22212_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000022051.1|22389_22746_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000072552.1|22850_23162_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023391.1|23255_24251_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067977.1|24282_25080_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190363.1|25161_25752_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_001242678.1|25851_26760_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097492905.1|26760_28191_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|28400_29549_-	MFS transporter	NA	NA	NA	NA	NA
WP_089623817.1|29862_30489_+	hydrolase	NA	NA	NA	NA	NA
WP_089623816.1|30523_31387_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|31388_32006_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|32016_34461_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|34699_35992_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|36082_37426_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_089623815.1|37436_38048_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_073544309.1|38202_42231_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|42365_42860_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|43404_44370_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
43019:43034	attR	ACATCACGAATGGCGT	NA	NA	NA	NA
WP_107316904.1|44492_46259_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001400164.1|46259_47981_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	9.9e-22
WP_001241677.1|48022_48727_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|49011_49230_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934040.1|50089_52366_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
WP_000520781.1|52396_52717_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 2
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	366033	420769	4774500	protease,integrase,lysis,tail,terminase,transposase	Enterobacteria_phage(54.55%)	55	400849:400895	420783:420829
WP_089624135.1|366033_367146_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000956455.1|367222_367375_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_085955856.1|367472_368842_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	1.4e-111
WP_001719814.1|369109_370228_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682514.1|370293_370542_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360951.1|370606_370975_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_097404168.1|371068_371722_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_001153148.1|371829_373077_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000786320.1|373144_374521_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001400043.1|374622_377766_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	21.9	2.2e-59
WP_000717157.1|377777_379001_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709865.1|379016_379349_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074234.1|379506_380880_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|381036_381720_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253805.1|381709_383158_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_107316917.1|383894_385796_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	2.1e-28
WP_001160804.1|385823_386285_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_089624128.1|386304_390822_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.5	3.2e-19
WP_000889443.1|390854_391115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300892.1|391240_391402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420970.1|392366_393503_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_089624123.1|395997_398970_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224575.1|398970_399861_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177481.1|400043_400805_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
400849:400895	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201845.1|401317_402271_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|402520_403270_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_122992210.1|404132_404801_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001598023.1|404855_405440_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_089624121.1|406059_406644_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	97.1	1.3e-87
WP_001309326.1|407032_407266_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|407323_407734_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_016245257.1|408412_408901_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	99.4	1.6e-86
WP_000092271.1|409106_409565_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	95.4	6.2e-72
WP_052916486.1|409561_410059_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	9.3e-90
WP_000839596.1|410058_410274_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_089624070.1|410847_411945_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	2.2e-155
WP_001204791.1|412134_412518_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971057.1|412603_412744_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	7.2e-08
WP_001099522.1|412740_413103_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000028392.1|413474_414107_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618037.1|414103_414508_+	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	4.3e-69
WP_000340004.1|414861_415185_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	94.3	1.4e-49
WP_107316918.1|415181_416063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065384.1|416251_416620_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_001198861.1|416692_416857_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372939.1|416825_416990_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.2	3.0e-21
WP_000995439.1|417043_417340_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|417345_418131_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_049022329.1|418161_418308_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	93.8	2.1e-18
WP_089624069.1|418280_418472_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_001443983.1|418482_418764_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|418862_419081_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|419128_419407_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|419378_419750_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|419605_420769_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
420783:420829	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 3
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	654741	739901	4774500	protease,capsid,portal,integrase,tail,holin,terminase,plate,transposase,head	Enterobacteria_phage(33.9%)	92	733298:733347	747559:747608
WP_000131044.1|654741_656775_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|656903_657491_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001399954.1|657504_658977_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|658990_660661_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|660873_661542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|661784_662480_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|662472_663900_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|663910_664630_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|665156_666011_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_107316923.1|666236_667562_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	1.9e-113
WP_000474077.1|667670_667907_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|667918_668512_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_122992209.1|669101_669953_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_089624057.1|670092_674349_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|675464_675566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|675929_676193_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|676192_676333_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|676367_676595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323479.1|677418_677961_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_107316924.1|678035_678623_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001399951.1|678680_679349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089624060.1|681889_683533_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_089624061.1|683501_684212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|684524_684854_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000070699.1|686132_686822_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643326.1|686818_687775_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667017.1|687771_689970_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|689979_690936_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|690914_691325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107316925.1|691943_694145_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_107316926.1|694793_695336_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.1	6.6e-57
WP_107317037.1|695350_695953_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	88.8	1.1e-95
WP_000978830.1|695924_696368_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	63.1	5.1e-47
WP_107316927.1|696367_696991_-	hypothetical protein	NA	U5P0I1	Shigella_phage	69.6	2.9e-64
WP_000383559.1|696994_697579_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_107316928.1|697569_698628_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	9.5e-201
WP_000424737.1|698614_699040_-	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_001259084.1|699039_699588_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999510.1|699587_700667_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_001368756.1|700663_701992_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	1.9e-246
WP_000807177.1|702052_703888_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	1.7e-306
WP_000661054.1|704029_704299_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090997.1|704298_704655_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	9.0e-63
WP_088551291.1|704654_706151_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	99.0	2.0e-276
WP_000497753.1|706134_706305_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000779292.1|706313_706874_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224834.1|706870_707377_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	6.6e-83
WP_088551289.1|707351_707762_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	1.4e-70
WP_000927715.1|707758_708082_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_000601363.1|708084_708285_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_106485385.1|708334_709540_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
WP_001193631.1|709554_710205_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|710182_711424_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605605.1|711423_711606_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_122987458.1|711617_713114_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	8.2e-299
WP_000929175.1|713347_713842_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_106485386.1|713967_714318_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	8.9e-63
WP_107316929.1|714438_716892_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	48.6	2.2e-83
WP_096939913.1|717282_717675_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	85.4	1.6e-52
WP_107316930.1|717658_718135_-	glycoside hydrolase family 104 protein	NA	U5P0A9	Shigella_phage	96.8	1.7e-85
WP_000544528.1|718121_718427_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_039000348.1|718748_719438_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	46.8	1.4e-56
WP_000971094.1|719434_719575_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	1.7e-09
WP_024222012.1|719571_719934_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	9.5e-60
WP_000774473.1|719930_720221_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_000224914.1|720213_720384_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053012.1|720383_720839_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_001309322.1|720835_720937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053265998.1|721113_722532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001697053.1|722583_722838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001697051.1|722902_723190_-	ren protein from phage origin	NA	A0A0N6WES4	Escherichia_phage	96.8	1.5e-44
WP_107316931.1|723186_723888_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.4	6.0e-127
WP_159048239.1|723884_724814_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	8.0e-111
WP_107316933.1|724900_725440_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_000184665.1|725470_725698_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_032316961.1|725808_726501_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.8	3.9e-110
WP_137325925.1|728514_728805_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	2.9e-27
WP_000995455.1|728880_729177_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_105906434.1|729182_729968_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.1e-148
WP_107316935.1|729964_730645_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	6.0e-132
WP_072217314.1|730641_730824_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	95.0	2.6e-26
WP_000548531.1|730796_730988_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_077871858.1|730998_731280_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	3.6e-46
WP_000763385.1|731378_731597_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|731644_731923_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446900.1|731894_732245_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	96.6	8.6e-58
733298:733347	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
WP_024046444.1|733435_734509_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.0	1.9e-47
WP_024046445.1|734526_735924_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_024046447.1|736153_736366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024046448.1|736435_737830_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_107316936.1|738017_738674_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_085947771.1|738739_739901_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
747559:747608	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAATGCG	NA	NA	NA	NA
>prophage 4
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	2812978	2820118	4774500		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2812978_2813617_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|2813613_2814876_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|2814872_2815781_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|2815976_2816744_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|2816794_2817451_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_089623946.1|2817556_2820118_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	1.0e-30
>prophage 5
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	2899839	2909407	4774500	capsid,integrase	Enterobacteria_phage(83.33%)	12	2899406:2899423	2909422:2909439
2899406:2899423	attL	AAACGTGTACCAATTATG	NA	NA	NA	NA
WP_107316983.1|2899839_2902173_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.5	0.0e+00
WP_097433382.1|2902187_2902508_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_107316984.1|2902504_2902732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107316985.1|2902728_2903277_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	65.8	1.2e-29
WP_000556587.1|2903273_2903540_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024134649.1|2903859_2904048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107316986.1|2903960_2904821_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_000468229.1|2904824_2905064_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	61.7	1.7e-20
WP_058663597.1|2905079_2905646_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	3.9e-60
WP_061353170.1|2906026_2906872_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_061353169.1|2906873_2908211_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_061353168.1|2908213_2909407_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.8	2.8e-108
2909422:2909439	attR	CATAATTGGTACACGTTT	NA	NA	NA	NA
>prophage 6
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	3199749	3205503	4774500		Enterobacteria_phage(69.23%)	13	NA	NA
WP_001163428.1|3199749_3199950_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_089623919.1|3200361_3200715_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	90.4	3.0e-34
WP_089623920.1|3200711_3201095_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	73.3	1.6e-41
WP_089623921.1|3201608_3202064_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	98.2	1.4e-55
WP_001214446.1|3202060_3202225_-	DUF2737 family protein	NA	K7P716	Enterobacteria_phage	100.0	6.5e-24
WP_021560265.1|3202235_3202532_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	89.8	4.3e-42
WP_040075010.1|3202555_3202939_-	hypothetical protein	NA	K7P7R8	Enterobacteria_phage	99.2	6.5e-67
WP_000031367.1|3202938_3203544_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_001243355.1|3203800_3203953_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|3203937_3204072_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_089623923.1|3204442_3204742_-	hypothetical protein	NA	K7PH98	Enterobacteria_phage	96.9	2.1e-49
WP_089623924.1|3204794_3205244_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.2	6.2e-69
WP_089623925.1|3205302_3205503_-	restriction endonuclease	NA	A0A0K2FJE6	Enterobacteria_phage	97.0	2.7e-32
>prophage 7
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	3208620	3216640	4774500	integrase	Enterobacteria_phage(66.67%)	6	3213689:3213702	3216140:3216153
WP_000614033.1|3208620_3209076_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	99.3	6.7e-87
WP_089623926.1|3211478_3212810_-	hypothetical protein	NA	U5P0I5	Shigella_phage	36.9	2.1e-64
WP_089623927.1|3212806_3213727_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	90.2	3.8e-161
3213689:3213702	attL	TTCTTCATTGAAGA	NA	NA	NA	NA
WP_000915536.1|3213723_3214086_-	GtrA family protein	NA	U5P0S6	Shigella_phage	91.7	4.1e-55
WP_000958665.1|3214238_3215396_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	3.7e-222
WP_000368131.1|3215707_3216640_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3216140:3216153	attR	TTCTTCATTGAAGA	NA	NA	NA	NA
>prophage 8
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	3460421	3469863	4774500		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|3460421_3461348_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|3461352_3462084_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3462064_3462172_-	protein YohO	NA	NA	NA	NA	NA
WP_069357594.1|3462231_3462963_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	3.7e-111
WP_001295431.1|3463184_3464870_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3464866_3465586_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_089623786.1|3465632_3466103_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001296231.1|3466143_3466605_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001400642.1|3466729_3468730_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.7	0.0e+00
WP_001292770.1|3468726_3469863_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 9
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	3560918	3567229	4774500		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001515525.1|3560918_3562313_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
WP_000183060.1|3562487_3563381_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001515524.1|3563752_3564838_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_001515523.1|3564837_3565737_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_001515522.1|3565794_3566673_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.4	1.3e-105
WP_001515521.1|3566677_3567229_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	6.8e-49
>prophage 10
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	4289998	4306273	4774500	lysis,transposase,terminase	Escherichia_phage(33.33%)	23	NA	NA
WP_000837924.1|4289998_4291132_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|4291272_4291707_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001157925.1|4291971_4292145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|4292484_4292598_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4292666_4292900_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|4293216_4293807_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_089624087.1|4293904_4294555_-	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	69.9	8.2e-54
WP_089624085.1|4294580_4295675_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	2.0e-113
WP_089624086.1|4295678_4295888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053287080.1|4295865_4296798_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	2.4e-83
WP_085947771.1|4297236_4298398_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_107317027.1|4298426_4298840_-	ParB N-terminal domain-containing protein	NA	A0A2I7RQE2	Vibrio_phage	53.5	7.8e-34
WP_001097894.1|4298977_4300435_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|4300631_4300817_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_016261931.1|4301033_4301531_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_000839565.1|4301530_4301746_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|4301997_4302372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|4302543_4302972_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_040062257.1|4304015_4304558_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.1	8.3e-76
WP_040062258.1|4304554_4304845_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	5.3e-45
WP_040062259.1|4304844_4305444_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	2.5e-105
WP_032291366.1|4305908_4306121_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	67.7	1.3e-13
WP_122083109.1|4306165_4306273_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
>prophage 11
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	4311037	4329339	4774500	tRNA,integrase	Escherichia_phage(55.56%)	21	4312374:4312387	4326762:4326775
WP_001676522.1|4311037_4313035_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
4312374:4312387	attL	GCATTCACCTGCAA	NA	NA	NA	NA
WP_001151151.1|4313375_4313798_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|4313838_4314909_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|4314980_4315406_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|4315389_4315671_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|4315771_4316191_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001169151.1|4316590_4316746_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|4316742_4317231_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|4317672_4317894_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|4317893_4318064_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|4318138_4318414_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105089.1|4318515_4321116_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
WP_089623960.1|4321108_4321918_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	1.2e-105
WP_001317028.1|4321974_4322169_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001383994.1|4322161_4322350_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	100.0	1.9e-27
WP_000079604.1|4322449_4322665_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040842.1|4322666_4323902_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	97.8	2.8e-236
WP_001157377.1|4323953_4324889_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123745.1|4325017_4326391_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|4326868_4327852_-	zinc transporter ZntB	NA	NA	NA	NA	NA
4326762:4326775	attR	GCATTCACCTGCAA	NA	NA	NA	NA
WP_000628058.1|4328106_4329339_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 12
NZ_CP019961	Escherichia coli strain HKUOPY1 chromosome, complete genome	4774500	4697864	4774447	4774500	protease,tRNA,tail	Escherichia_phage(39.13%)	66	NA	NA
WP_000156518.1|4697864_4699625_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|4699693_4700212_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|4700281_4700449_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|4700704_4701268_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445533.1|4701264_4702905_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|4702909_4704163_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053089.1|4704292_4706200_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
WP_001086517.1|4706210_4708319_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224273.1|4708562_4709672_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001295353.1|4709668_4710211_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|4710384_4711395_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_032083906.1|4711505_4712216_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919497.1|4712208_4712724_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000730614.1|4712731_4713274_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165668.1|4713285_4714356_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001402987.1|4714346_4716947_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_107317033.1|4716971_4717673_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750304.1|4717755_4718295_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263933.1|4718650_4719226_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244308.1|4719218_4720178_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000056006.1|4720174_4721320_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_089623821.1|4721330_4722122_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|4722118_4722886_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193841.1|4722928_4725541_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|4725806_4727009_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|4727177_4728578_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977907.1|4729179_4730268_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.5	2.8e-99
WP_000462687.1|4730452_4731643_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|4731864_4732512_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|4732538_4733087_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_089623820.1|4733267_4735115_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572670.1|4735375_4739836_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|4739835_4740540_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|4740520_4741843_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001298300.1|4741839_4742625_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|4742760_4743540_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|4743516_4744410_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011603.1|4744563_4745310_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|4745306_4745489_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056538.1|4745540_4746773_-	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000570540.1|4746809_4747796_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|4747792_4749541_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705764.1|4749577_4751842_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|4752049_4752334_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|4752493_4754167_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|4754277_4754961_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|4755133_4755898_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445249.1|4756066_4757350_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057149.1|4757420_4758509_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642849.1|4758707_4759400_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|4759529_4761290_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|4761695_4762553_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|4762607_4764890_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|4765208_4765427_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882975.1|4765508_4766672_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_107317034.1|4766671_4767151_-|tail	phage tail protein	tail	M1TAU1	Escherichia_phage	98.1	7.3e-84
WP_107317035.1|4767165_4769613_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.2	0.0e+00
WP_000785970.1|4769605_4769725_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4769757_4770033_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4770090_4770609_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_033811997.1|4770621_4771812_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_057696600.1|4771871_4772465_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.6e-104
WP_107317036.1|4772495_4773065_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	58.7	2.1e-45
WP_000613358.1|4773064_4773658_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.4	2.7e-59
WP_000978831.1|4773629_4774073_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	3.3e-46
WP_096976489.1|4774072_4774447_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	49.4	4.8e-14
