The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	980830	1053670	4889200	plate,tRNA,transposase,protease	Emiliania_huxleyi_virus(11.11%)	58	NA	NA
WP_001295561.1|980830_982183_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|982212_984645_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|984766_985252_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|985255_986281_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|986385_986841_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|986844_987633_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|987632_988781_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|988777_989374_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|989410_992893_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|992905_993865_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|993963_996105_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|996161_996551_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|996615_997914_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|997962_998223_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|998209_998410_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|998575_999121_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|999117_999540_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|999553_1000264_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|1000463_1001288_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|1001341_1003060_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|1003171_1003879_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|1003875_1004280_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|1004397_1005213_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|1005252_1005906_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|1005898_1006930_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|1007117_1007693_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|1013451_1014255_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|1014251_1015166_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1015406_1016207_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|1016210_1016834_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|1016881_1018240_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|1018311_1019067_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|1019100_1019823_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1019819_1020287_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|1020351_1021083_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|1021619_1022405_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236653.1|1022541_1023021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|1023030_1023945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|1023988_1024471_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|1024494_1025847_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|1025857_1029292_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|1029400_1030813_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|1030817_1031561_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|1031557_1034323_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|1034331_1035093_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|1035097_1036429_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|1036431_1036956_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113709.1|1036952_1038233_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|1038257_1039340_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|1039303_1041154_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|1041157_1041571_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|1041577_1043053_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1043103_1043328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|1043362_1043863_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1044557_1045076_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032329316.1|1045285_1047427_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_001101841.1|1051711_1051930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|1052533_1053670_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	1745295	1782518	4889200	integrase,transposase,protease	Stx2-converting_phage(42.86%)	29	1735032:1735047	1764451:1764466
1735032:1735047	attL	TCAATCAGCGTATCAG	NA	NA	NA	NA
WP_000520781.1|1745295_1745616_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1745646_1747923_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279872.1|1748440_1749643_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_042002566.1|1749828_1751646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1752756_1753053_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032141622.1|1753297_1753495_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_072165262.1|1753713_1754826_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001300563.1|1754985_1756098_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_032180014.1|1757317_1757881_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001333439.1|1758555_1763514_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000622487.1|1763510_1764947_+	hypothetical protein	NA	NA	NA	NA	NA
1764451:1764466	attR	TCAATCAGCGTATCAG	NA	NA	NA	NA
WP_024167628.1|1765051_1765258_+	methyltransferase	NA	NA	NA	NA	NA
WP_000757210.1|1765426_1767316_-	enterotoxin	NA	NA	NA	NA	NA
WP_032180015.1|1767329_1768505_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000192271.1|1768516_1770088_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000195940.1|1770201_1770606_-	aldolase	NA	NA	NA	NA	NA
WP_000072197.1|1770788_1771613_+	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001335688.1|1771675_1772113_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_032180018.1|1772194_1772830_-	galactarate dehydratase	NA	NA	NA	NA	NA
WP_154761740.1|1772992_1773130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976704.1|1773432_1774660_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
WP_001387298.1|1775273_1775372_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|1775373_1776156_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|1776461_1777382_+	ribokinase	NA	NA	NA	NA	NA
WP_000998346.1|1777409_1778726_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107485.1|1778737_1779751_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_021566758.1|1780205_1780586_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000612601.1|1780582_1780930_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_032180022.1|1780979_1782518_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
>prophage 3
NZ_CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	2080263	2137615	4889200	tail,portal,tRNA,protease,head,terminase,integrase,holin,capsid,transposase	Escherichia_phage(46.51%)	60	2075358:2075372	2081838:2081852
2075358:2075372	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074971.1|2080263_2081382_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
WP_000003742.1|2081350_2081620_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|2081681_2084123_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
2081838:2081852	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001070255.1|2084216_2084408_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|2084404_2084593_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|2084993_2085197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2085161_2085380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|2085472_2085673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|2086104_2086443_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000693850.1|2087058_2087484_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|2087555_2088626_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|2088666_2089089_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000403785.1|2089146_2089503_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|2089596_2089779_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001013636.1|2090813_2091026_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_032155008.1|2091193_2091472_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|2091473_2092532_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|2092532_2092913_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|2092909_2093731_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|2094125_2094212_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|2094700_2094913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|2094983_2095319_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|2095579_2095768_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_000372595.1|2096075_2096291_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|2096295_2096646_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|2096709_2097243_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|2097459_2097642_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|2097732_2098026_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135104.1|2098551_2098902_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_001333563.1|2099049_2099532_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|2099531_2101289_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000923134.1|2101436_2102663_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000999828.1|2102655_2103255_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000766109.1|2103269_2104487_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719064.1|2104563_2104881_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_001147814.1|2104889_2105228_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|2105224_2105674_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206700.1|2105670_2106015_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000097535.1|2106075_2106780_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001324129.1|2106779_2107166_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_077253127.1|2107207_2107468_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000224003.1|2107514_2110742_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|2110719_2111076_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152457.1|2111075_2111774_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_000090843.1|2112458_2113067_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_000515345.1|2113127_2116607_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_107188772.1|2116674_2117274_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	5.9e-107
WP_032143699.1|2123043_2123415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042047081.1|2124148_2124679_+	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_085948620.1|2124901_2126114_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_000241001.1|2126229_2126898_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|2127452_2128316_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2128299_2129436_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|2129685_2130912_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|2130960_2132082_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|2132157_2133618_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|2133617_2134289_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|2134457_2135828_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|2135831_2136473_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|2136508_2137615_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	3049110	3055539	4889200		Escherichia_phage(33.33%)	6	NA	NA
WP_000704810.1|3049110_3050277_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.5	7.0e-112
WP_001021401.1|3050457_3051012_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	3.3e-51
WP_000698222.1|3051026_3051917_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.6	5.6e-29
WP_000676430.1|3051948_3052818_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	3.4e-111
WP_000699390.1|3052844_3053909_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	7.5e-105
WP_000043542.1|3054132_3055539_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 5
NZ_CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	3143306	3150237	4889200	transposase	Enterobacteria_phage(66.67%)	9	NA	NA
WP_103758571.1|3143306_3144004_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	98.7	1.1e-131
WP_000741419.1|3144045_3144516_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	3.6e-75
WP_000950409.1|3144555_3145026_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|3145072_3145792_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3145788_3147474_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3147695_3148427_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3148486_3148594_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3148574_3149306_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569356.1|3149310_3150237_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 6
NZ_CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	3652498	3767517	4889200	tail,lysis,portal,tRNA,plate,head,terminase,integrase,capsid,transposase	Erwinia_phage(21.15%)	111	3649437:3649452	3729996:3730011
3649437:3649452	attL	ATTTTTATCCCGGCAA	NA	NA	NA	NA
WP_001521090.1|3652498_3653536_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3653742_3654162_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001308860.1|3654230_3654929_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001521091.1|3654960_3657621_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3657734_3659090_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001696047.1|3659135_3659459_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3659455_3660754_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_100190661.1|3661062_3662411_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	5.1e-74
WP_024176393.1|3667991_3670565_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	1.2e-127
WP_001520329.1|3670694_3671426_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|3671422_3672403_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197689.1|3672537_3673275_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3673545_3673887_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3673990_3674038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020233815.1|3674136_3675297_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225220.1|3675339_3676461_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3676471_3677542_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001314943.1|3677751_3678117_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001520332.1|3678266_3678785_+	YfiR family protein	NA	NA	NA	NA	NA
WP_021523227.1|3678774_3680001_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001520334.1|3680016_3680499_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3680575_3680923_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264781.1|3680964_3681732_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3681762_3682311_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3682329_3682578_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3682826_3684188_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3684354_3685146_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3685166_3686453_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3686507_3687101_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001520335.1|3687223_3688102_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001520336.1|3688187_3689849_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3689997_3690339_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3690400_3690691_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|3690680_3691157_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001520337.1|3691288_3691771_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
WP_001120794.1|3697146_3697266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001521105.1|3698015_3699470_-	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_052935640.1|3700515_3701979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052935639.1|3701989_3702994_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.6	2.2e-191
WP_052935638.1|3702993_3703569_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	1.2e-67
WP_001630878.1|3703701_3703965_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_052935637.1|3703995_3704505_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	1.2e-89
WP_052935636.1|3704512_3704740_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	92.0	1.6e-33
WP_052935635.1|3704726_3704927_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	89.4	1.1e-28
WP_052935634.1|3704996_3705224_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	90.7	2.3e-27
WP_052935633.1|3705223_3705451_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	70.7	4.8e-25
WP_071940768.1|3705447_3705756_+	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	43.2	1.6e-07
WP_052935632.1|3705769_3708010_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.5	0.0e+00
WP_071940803.1|3708153_3708336_+	Tum protein	NA	A0A218M4I0	Erwinia_phage	75.9	3.2e-16
WP_107188784.1|3708624_3708837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159041942.1|3708848_3709841_+	acyltransferase family protein	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	28.0	3.5e-19
WP_052935790.1|3710307_3711345_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.0	5.9e-163
WP_052935789.1|3711344_3713114_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	80.5	1.9e-286
WP_052935788.1|3713278_3714142_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	66.2	3.4e-103
WP_052935787.1|3714163_3715324_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.1	2.5e-130
WP_052935786.1|3715327_3716086_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	66.3	1.3e-79
WP_000177981.1|3716183_3716684_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	2.9e-59
WP_001100637.1|3716683_3716887_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000524754.1|3716877_3717099_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_000534554.1|3717082_3717592_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_052935785.1|3717588_3718002_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	67.2	5.4e-43
WP_052935784.1|3718109_3718577_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.7	1.7e-56
WP_052935783.1|3718569_3719019_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	72.7	8.5e-50
WP_071940771.1|3719024_3720110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052935607.1|3720225_3720867_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	83.1	1.5e-95
WP_052935606.1|3720863_3721211_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	71.3	4.3e-41
WP_052935605.1|3721215_3722124_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	81.5	3.0e-134
WP_052935604.1|3722116_3722728_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	83.1	1.8e-95
WP_052935603.1|3723896_3724310_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	45.7	4.0e-22
WP_052935602.1|3724441_3725629_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.5	2.6e-183
WP_052935601.1|3725641_3726160_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
WP_023223220.1|3726222_3726504_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
WP_000763326.1|3726536_3726656_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_052935600.1|3726648_3729078_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	67.8	7.6e-270
WP_052935599.1|3729089_3729554_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	1.7e-61
WP_052935598.1|3729556_3730750_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.4	1.3e-166
3729996:3730011	attR	TTGCCGGGATAAAAAT	NA	NA	NA	NA
WP_023223216.1|3730789_3731008_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
WP_032145461.1|3733044_3734052_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001521107.1|3734387_3735365_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_020233013.1|3735384_3736653_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000772878.1|3736675_3738124_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000097652.1|3738137_3739418_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
WP_001295173.1|3739655_3741056_+	GABA permease	NA	NA	NA	NA	NA
WP_000156814.1|3741076_3741739_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522417.1|3741739_3742189_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_000508177.1|3742272_3742431_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000137280.1|3742613_3742913_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001229454.1|3742922_3743447_+	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000115383.1|3743493_3743898_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000492658.1|3744564_3745014_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000281320.1|3745050_3745395_-	YgaC family protein	NA	NA	NA	NA	NA
WP_001316582.1|3745546_3745876_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001223227.1|3746123_3746369_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001521113.1|3746365_3746767_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	3.4e-18
WP_106490491.1|3746748_3748893_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.9e-196
WP_001521117.1|3748902_3749862_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	7.0e-134
WP_000985494.1|3750218_3751421_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000774965.1|3751413_3752478_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_001216531.1|3752535_3753528_+	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000165699.1|3753980_3755165_+	MFS transporter	NA	NA	NA	NA	NA
WP_000445658.1|3755288_3756026_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000119745.1|3756015_3756351_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000378442.1|3756441_3756972_+	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_020233875.1|3757098_3758271_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_001295176.1|3758287_3759826_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001130211.1|3759889_3760405_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001521120.1|3760554_3762111_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001287454.1|3762183_3762612_-	DedA family protein	NA	NA	NA	NA	NA
WP_001521122.1|3762608_3763175_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000906486.1|3764466_3764652_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047170.1|3764886_3767517_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
>prophage 7
NZ_CP027701	Escherichia coli strain 675SK2 chromosome, complete genome	4889200	3803818	3810958	4889200		Escherichia_phage(83.33%)	6	NA	NA
WP_001272917.1|3803818_3806380_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	9.2e-32
WP_001141345.1|3806485_3807142_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|3807192_3807960_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|3808155_3809064_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|3809060_3810323_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3810319_3810958_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP027703	Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence	173882	13333	72664	173882	integrase,transposase	Escherichia_phage(46.67%)	50	54875:54934	76934:77755
WP_001066953.1|13333_14074_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_001309252.1|14194_14383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016245172.1|15069_15918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|16764_17037_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001496335.1|18279_20250_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|20256_21048_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_000255956.1|22564_23587_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|24666_25041_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_001067855.1|25065_25770_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|27360_27915_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|28058_28763_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000874189.1|32276_32762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|32786_33272_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|33258_33954_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729219.1|33958_35089_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|35078_36362_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|36364_37744_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|37847_38375_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|38415_40302_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|40648_41464_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|41646_42153_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|42142_42301_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000428546.1|45152_45746_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|45858_47064_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001322387.1|47142_47769_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_106490503.1|47746_48433_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|48440_48827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049802299.1|48819_49083_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000412211.1|50055_50715_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|50915_51293_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|51359_54326_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_021532377.1|54328_54889_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
54875:54934	attL	GCGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|54939_55644_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_126498476.1|55842_56427_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|56395_57409_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|57566_58040_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|58170_58959_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|59164_59512_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|59505_60345_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|60472_60676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|60831_62037_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|62047_62353_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|62579_63344_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|63836_64421_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219391.1|65654_66560_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|66681_67386_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_023408309.1|67944_68757_+	subclass B1 metallo-beta-lactamase NDM-5	NA	NA	NA	NA	NA
WP_004201168.1|69129_69768_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|69778_70810_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_000050481.1|71122_72664_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
76934:77755	attR	GCGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
