The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	0	28187	5071057	head,lysis,transposase,tail,terminase,protease,holin	Enterobacteria_phage(51.06%)	49	NA	NA
WP_000198149.1|363_570_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_107235446.1|566_2492_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_101968936.1|2593_4165_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	6.4e-169
WP_000624622.1|4184_4532_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|4531_5209_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_107235447.1|5245_5719_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	79.9	2.9e-64
WP_001663509.1|6106_6340_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|6396_6807_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_021528610.1|7327_7933_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	96.5	2.7e-107
WP_107235448.1|8082_8520_-|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	97.9	6.5e-71
WP_000229397.1|8516_8993_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_000783734.1|8976_9300_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|10359_10983_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_088172464.1|10979_11168_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	1.6e-26
WP_001008180.1|11164_11527_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	100.0	9.2e-63
WP_000247766.1|11523_11814_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	96.9	1.2e-49
WP_107235449.1|11813_12536_-	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	97.9	1.9e-128
WP_107235450.1|12610_13294_-	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	84.6	2.6e-111
WP_107235451.1|13573_13750_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	7.9e-28
WP_061157944.1|13746_14157_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	9.4e-72
WP_001555367.1|14128_14485_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	7.9e-59
WP_107235452.1|14496_14697_-	hypothetical protein	NA	Q716C9	Shigella_phage	98.5	3.9e-31
WP_000796282.1|14693_15020_-	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
WP_107235453.1|15032_15239_-	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	1.2e-30
WP_000145926.1|15311_15602_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788877.1|15598_16300_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_107235454.1|16296_17196_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.3	1.6e-172
WP_000438534.1|17228_17525_-	hypothetical protein	NA	G9L678	Escherichia_phage	98.0	2.0e-47
WP_089631821.1|17676_17904_-	DNA-binding protein	NA	G9L677	Escherichia_phage	97.3	1.1e-34
WP_000250473.1|17981_18689_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_089631820.1|18848_19532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089631819.1|19528_20347_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_089631818.1|20791_21064_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.8	2.4e-39
WP_001430488.1|21066_21429_+	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
WP_000382838.1|21459_21954_-	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_000167585.1|22154_22625_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_025766313.1|22775_23144_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_134232576.1|23216_23381_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	98.1	5.3e-26
WP_000372936.1|23349_23463_+	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.3	7.8e-13
WP_000613347.1|23459_23648_+	hypothetical protein	NA	A0A2D1GM16	Escherichia_phage	100.0	1.7e-28
WP_000536247.1|23656_24337_+	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	100.0	4.5e-127
WP_001535902.1|24333_24921_+	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	8.4e-106
WP_001111298.1|24944_25238_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_016063110.1|25248_25416_+	DUF2737 family protein	NA	K7PJV9	Enterobacteria_phage	100.0	1.0e-24
WP_107235456.1|25412_26228_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	81.0	4.9e-120
WP_107235457.1|26227_26800_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.4	9.6e-107
WP_001093913.1|26836_27109_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	98.9	3.6e-43
WP_000019187.1|27142_27691_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	96.2	6.0e-90
WP_000287252.1|27713_28187_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
>prophage 2
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	32519	33128	5071057		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|32519_33128_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 3
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	42341	43457	5071057		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|42341_43457_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 4
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	68629	72313	5071057		Dickeya_phage(100.0%)	1	NA	NA
WP_107235461.1|68629_72313_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 5
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	88154	89744	5071057		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_107235463.1|88154_89744_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 6
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	95112	96876	5071057		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|95112_95385_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|95571_96162_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|96204_96876_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 7
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	105172	113501	5071057		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|105172_109396_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|109472_113501_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 8
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	117617	120670	5071057		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|117617_118802_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023085.1|119719_120670_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
>prophage 9
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	129093	130938	5071057		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001366808.1|129093_130938_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 10
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	148034	155281	5071057		Serratia_phage(33.33%)	5	NA	NA
WP_063085500.1|148034_150332_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|150382_150703_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004454.1|150717_151797_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_107235468.1|152105_154607_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	3.9e-11
WP_000424838.1|154618_155281_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 11
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	162148	163702	5071057		Pandoravirus(100.0%)	1	NA	NA
WP_107235469.1|162148_163702_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	3.9e-09
>prophage 12
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	175324	179827	5071057		Erwinia_phage(50.0%)	5	NA	NA
WP_001293344.1|175324_176656_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_097504027.1|176722_177649_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001545067.1|177741_178227_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|178311_178557_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|178981_179827_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 13
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	188472	189820	5071057	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_107235474.1|188472_189820_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	7.9e-75
>prophage 14
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	192836	197696	5071057		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|192836_193535_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|193531_194905_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270252.1|195010_195685_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_071892900.1|195833_196778_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|197075_197696_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 15
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	213454	216505	5071057		Escherichia_phage(100.0%)	1	NA	NA
WP_012602895.1|213454_216505_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 16
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	228016	230796	5071057		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|228016_228802_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621642.1|228835_229732_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718901.1|229899_230796_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 17
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	246954	249425	5071057		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|246954_248004_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|248015_249425_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 18
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	253503	256290	5071057		uncultured_virus(100.0%)	1	NA	NA
WP_063085090.1|253503_256290_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 19
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	270072	270687	5071057		Streptococcus_phage(100.0%)	1	NA	NA
WP_107235487.1|270072_270687_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 20
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	279476	282763	5071057		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|279476_280253_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459600.1|280255_280771_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|280774_281044_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_107235490.1|281122_282763_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	1.1e-41
>prophage 21
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	297401	299231	5071057		Catovirus(100.0%)	1	NA	NA
WP_063085302.1|297401_299231_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 22
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	306618	310477	5071057		Bacillus_phage(100.0%)	3	NA	NA
WP_000383407.1|306618_308781_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|308864_309581_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|309580_310477_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 23
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	320807	322463	5071057		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001521762.1|320807_322463_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	8.0e-45
>prophage 24
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	330482	334722	5071057		uncultured_marine_virus(33.33%)	4	NA	NA
WP_000612044.1|330482_331613_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145185.1|331617_332292_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_001521756.1|332332_333595_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.3e-23
WP_107235494.1|333591_334722_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
>prophage 25
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	338750	344164	5071057		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|338750_339080_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_096321359.1|339210_340476_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001445788.1|340611_342096_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001521748.1|342142_344164_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	4.9e-113
>prophage 26
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	352492	354139	5071057		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001600750.1|352492_354139_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	3.1e-65
>prophage 27
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	367521	373374	5071057		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|367521_368412_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|368436_369402_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387770.1|369406_370912_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|370919_371339_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102332.1|371505_373374_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	2.3e-64
>prophage 28
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	376542	377535	5071057		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|376542_377535_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 29
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	389487	392849	5071057		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_001521725.1|389487_390858_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	6.9e-34
WP_053889731.1|391019_392849_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.0	9.5e-132
>prophage 30
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	398383	402223	5071057		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|398383_399424_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|399509_400469_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|400468_401359_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|401449_402223_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 31
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	411229	412567	5071057		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|411229_412567_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 32
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	425237	432606	5071057		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|425237_425495_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|425458_425818_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|425834_425975_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|426204_426285_-	protein YsdD	NA	NA	NA	NA	NA
WP_107235505.1|426581_427985_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|427989_429090_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|429089_430163_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_001521708.1|430191_432606_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 33
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	437310	438459	5071057		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|437310_438459_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 34
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	442885	443839	5071057		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|442885_443299_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|443410_443839_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 35
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	450699	459721	5071057		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087161.1|450699_452415_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	3.3e-41
WP_000828514.1|452411_453905_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.3	2.5e-29
WP_001596321.1|453951_454401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703955.1|454509_454857_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113437.1|454846_455209_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_107235509.1|455205_455703_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001306726.1|455710_456895_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000060506.1|457174_457264_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001300753.1|457828_457927_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_107235510.1|458032_459721_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.4	1.3e-55
>prophage 36
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	470418	471753	5071057		Moraxella_phage(100.0%)	1	NA	NA
WP_001586450.1|470418_471753_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	3.0e-66
>prophage 37
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	488319	489592	5071057	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_089638411.1|488319_489592_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.0e-176
>prophage 38
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	511824	513216	5071057		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|511824_513216_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 39
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	518336	536622	5071057	integrase	Morganella_phage(27.27%)	22	533595:533608	537386:537399
WP_000280488.1|518336_520445_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|520463_520739_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001366734.1|520793_521417_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_033870290.1|521674_523357_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	4.6e-24
WP_000924289.1|523353_523971_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001315077.1|524261_525086_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.6	5.8e-97
WP_024046891.1|525558_526269_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	54.6	8.1e-71
WP_103755426.1|526265_526751_+	hypothetical protein	NA	Q71TB7	Escherichia_phage	37.9	2.7e-25
WP_107235520.1|527117_527297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107235521.1|527601_528129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000773311.1|528227_528500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053884059.1|528774_529062_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_107235522.1|529058_529589_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	37.5	9.5e-08
WP_107235523.1|530065_531478_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	56.6	2.2e-112
WP_004027526.1|531474_531765_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_096960302.1|531769_531970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107235524.1|531962_532328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031625006.1|532320_532686_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_107235526.1|533320_534121_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	41.4	3.2e-23
533595:533608	attL	TTTTTACCCAGTTC	NA	NA	NA	NA
WP_000795879.1|534198_534417_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001529476.1|534529_535312_-	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	23.9	3.5e-06
WP_024046890.1|535368_536622_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	77.3	6.0e-186
537386:537399	attR	TTTTTACCCAGTTC	NA	NA	NA	NA
>prophage 40
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	539963	544526	5071057		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|539963_540419_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|540399_541620_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298959.1|541791_542460_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|542676_542913_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|542933_543101_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_063086435.1|543198_544008_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.4	3.4e-25
WP_001171873.1|544046_544526_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
>prophage 41
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	551963	552992	5071057		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_063086429.1|551963_552992_+	galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 42
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	557151	566658	5071057		Synechococcus_phage(16.67%)	9	NA	NA
WP_063086425.1|557151_558084_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
WP_001213834.1|558297_559494_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|559503_560529_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982098.1|560767_561802_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_032281840.1|561788_562748_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|562751_564035_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|564044_565589_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_107235529.1|565833_566265_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|566406_566658_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 43
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	588598	603517	5071057	tRNA	Acinetobacter_phage(33.33%)	10	NA	NA
WP_107235533.1|588598_592729_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	7.4e-23
WP_000779785.1|592957_593566_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_107235534.1|593663_595055_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_001590867.1|595051_596896_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
WP_000741494.1|597086_598238_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_107235535.1|598368_599664_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	1.4e-20
WP_025210980.1|599771_601310_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032140338.1|601350_602424_-	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.7	2.1e-62
WP_000833473.1|602904_603090_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
WP_000499746.1|603106_603517_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	1.1e-19
>prophage 44
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	624989	626531	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_107235538.1|624989_626531_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 45
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	631848	632844	5071057		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_025210967.1|631848_632844_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.2	7.0e-12
>prophage 46
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	637073	637286	5071057		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|637073_637286_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 47
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	640940	643274	5071057		Escherichia_phage(100.0%)	1	NA	NA
WP_074150237.1|640940_643274_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	5.4e-71
>prophage 48
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	653383	655368	5071057		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196484.1|653383_654367_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000103580.1|654363_655368_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 49
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	702268	703738	5071057		Bacillus_virus(50.0%)	2	NA	NA
WP_059341077.1|702268_702916_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.7	6.1e-17
WP_000622315.1|702967_703738_-	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	1.7e-18
>prophage 50
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	716808	723902	5071057		uncultured_Caudovirales_phage(75.0%)	7	NA	NA
WP_000065800.1|716808_717234_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.5e-51
WP_001590850.1|717246_718536_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	1.7e-172
WP_025210949.1|718590_718944_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	52.9	4.8e-24
WP_001295215.1|719253_719337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210948.1|719390_720743_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_000954225.1|720814_721657_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_001298719.1|721859_723902_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 51
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	737312	740048	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_107235550.1|737312_740048_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 52
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	743561	749206	5071057		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_107235553.1|743561_747791_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	7.6e-23
WP_053888681.1|747993_748395_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173690.1|748399_749206_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.0e-17
>prophage 53
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	757087	761220	5071057		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|757087_757753_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130615.1|757973_758219_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_107235556.1|758321_760520_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.6	7.2e-118
WP_000964718.1|760593_761220_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 54
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	764226	769917	5071057	transposase	Staphylococcus_phage(33.33%)	5	NA	NA
WP_000617723.1|764226_764895_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|764887_765946_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|766190_767045_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001310131.1|767316_768441_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_107235474.1|768569_769917_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	7.9e-75
>prophage 55
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	774237	775720	5071057		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|774237_775005_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|775006_775720_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 56
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	779340	781151	5071057		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907829.1|779340_780411_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073565.1|780407_781151_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	2.2e-10
>prophage 57
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	801169	803617	5071057		Dickeya_phage(100.0%)	1	NA	NA
WP_000993440.1|801169_803617_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 58
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	817241	818477	5071057		Ralstonia_phage(100.0%)	1	NA	NA
WP_107235562.1|817241_818477_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.6	6.4e-132
>prophage 59
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	822855	825249	5071057		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_107235565.1|822855_825249_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 60
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	831218	832097	5071057		Sodalis_phage(100.0%)	1	NA	NA
WP_063085696.1|831218_832097_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	7.2e-69
>prophage 61
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	838679	842447	5071057		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|838679_839399_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253708.1|839395_840748_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_107235568.1|840824_842447_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.1	2.6e-141
>prophage 62
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	859424	860261	5071057		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|859424_860261_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 63
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	879186	888733	5071057		Acinetobacter_phage(25.0%)	9	NA	NA
WP_033870493.1|879186_879750_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	1.0e-60
WP_107235576.1|879835_881056_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|881122_883213_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|883263_883896_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_096936416.1|884197_884602_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274675.1|884656_885526_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|885579_885798_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_107235577.1|885791_886814_-	hydrolase	NA	NA	NA	NA	NA
WP_001551739.1|886813_888733_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	3.3e-74
>prophage 64
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	894304	899878	5071057		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_001209693.1|894304_894691_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	2.5e-18
WP_107235581.1|894690_895050_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	4.0e-10
WP_000903377.1|895057_895345_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|895470_895845_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|895941_896412_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|896508_898623_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|898693_899878_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 65
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	919755	921227	5071057	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004456.1|919755_920703_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114986.1|920717_921227_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 66
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	931732	935886	5071057		Bacillus_virus(50.0%)	4	NA	NA
WP_032185228.1|931732_932491_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.5e-19
WP_063085197.1|932498_933602_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001603881.1|933611_934793_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738584.1|934860_935886_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	4.0e-71
>prophage 67
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	942390	943275	5071057		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001579058.1|942390_943275_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.6	4.6e-23
>prophage 68
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	948612	953125	5071057		Escherichia_phage(50.0%)	4	NA	NA
WP_000843960.1|948612_949443_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_042003667.1|949784_950639_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_062875423.1|950674_951565_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048972096.1|951625_953125_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	7.5e-18
>prophage 69
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	962412	963456	5071057		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|962412_963456_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 70
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	980663	983188	5071057	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|980663_981731_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|981820_983188_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 71
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	987154	987652	5071057	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|987154_987652_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 72
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	991357	996090	5071057		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108458.1|991357_992848_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_044805609.1|992895_993585_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_001559999.1|993581_994457_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979887.1|994453_994918_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445130.1|994977_996090_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	89.2	1.2e-73
>prophage 73
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1002839	1017633	5071057		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|1002839_1003769_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|1003864_1006201_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001300411.1|1006430_1007084_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047064.1|1007080_1007809_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|1007805_1008438_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|1008650_1008923_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|1008919_1009774_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|1009819_1010311_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|1010428_1010716_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|1010738_1012172_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|1012219_1012945_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|1012951_1013509_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|1013477_1014053_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030006.1|1014049_1014616_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
WP_107235589.1|1014636_1015623_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922881.1|1015636_1016614_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438239.1|1016823_1017633_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	3.7e-19
>prophage 74
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1021701	1023179	5071057		Vibrio_phage(50.0%)	2	NA	NA
WP_000445407.1|1021701_1021980_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
WP_096977902.1|1022207_1023179_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.7e-07
>prophage 75
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1029797	1032670	5071057	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|1029797_1031732_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|1031821_1032670_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 76
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1036750	1043389	5071057		Dickeya_phage(50.0%)	4	NA	NA
WP_000207680.1|1036750_1038094_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|1038724_1039177_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|1039204_1040692_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|1040716_1043389_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 77
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1048865	1054482	5071057	transposase	Chrysochromulina_ericina_virus(50.0%)	3	NA	NA
WP_001295553.1|1048865_1050755_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
WP_107235591.1|1050908_1052153_+	tryptophan permease	NA	NA	NA	NA	NA
WP_107235592.1|1053269_1054482_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	4.9e-100
>prophage 78
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1058998	1066803	5071057		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|1058998_1059301_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_063086235.1|1059351_1059795_+	YhbP family protein	NA	NA	NA	NA	NA
WP_001559988.1|1059774_1060293_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_107235594.1|1060420_1061056_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_107235595.1|1061128_1062169_+	permease	NA	NA	NA	NA	NA
WP_000646047.1|1062290_1062866_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|1062875_1063466_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246828.1|1063485_1063881_-	YraN family protein	NA	NA	NA	NA	NA
WP_107235596.1|1063838_1065875_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809263.1|1065939_1066803_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
>prophage 79
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1084426	1085572	5071057		Streptococcus_phage(100.0%)	1	NA	NA
WP_107235599.1|1084426_1085572_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	4.4e-50
>prophage 80
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1093392	1095687	5071057		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1093392_1095687_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 81
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1116480	1117446	5071057		Escherichia_phage(100.0%)	1	NA	NA
WP_001098823.1|1116480_1117446_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	4.0e-36
>prophage 82
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1130246	1138416	5071057	tRNA	Herpes_simplex_virus(33.33%)	5	NA	NA
WP_107235611.1|1130246_1133339_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.8	1.0e-157
WP_000212456.1|1133522_1134506_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450588.1|1134724_1135057_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_159042815.1|1135098_1136589_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	5.4e-32
WP_000094730.1|1136895_1138416_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
>prophage 83
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1144427	1157673	5071057	terminase,tRNA,head,capsid	Morganella_phage(16.67%)	13	NA	NA
WP_000710147.1|1144427_1146551_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.6	3.1e-174
WP_107235615.1|1146929_1147172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126634.1|1147168_1147591_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_107192856.1|1147808_1148849_+|capsid	capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	6.7e-66
WP_000190777.1|1148858_1149200_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001179422.1|1149211_1149595_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_107235616.1|1149796_1150339_+|terminase	terminase	terminase	O64316	Escherichia_phage	48.1	2.2e-36
WP_000133431.1|1150412_1150694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063086280.1|1151729_1152236_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|1152314_1154156_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|1154350_1156096_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|1156206_1156422_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264352.1|1156659_1157673_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 84
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1163975	1165214	5071057	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708490.1|1163975_1165214_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
>prophage 85
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1170351	1171785	5071057		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001613866.1|1170351_1171785_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 86
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1176072	1176726	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076993.1|1176072_1176726_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 87
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1182618	1194084	5071057		Ralstonia_phage(20.0%)	10	NA	NA
WP_000442863.1|1182618_1183779_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.4	2.0e-87
WP_000831543.1|1183784_1184456_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735289.1|1184603_1186085_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|1186289_1186919_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|1186919_1187342_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|1187366_1188194_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|1188193_1188775_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|1188803_1190696_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_085562192.1|1190759_1192901_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_107235619.1|1193274_1194084_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	2.3e-13
>prophage 88
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1201190	1213321	5071057		Stx_converting_phage(25.0%)	10	NA	NA
WP_000712658.1|1201190_1201583_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183492.1|1201635_1202118_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_063085111.1|1202226_1203834_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001281890.1|1203971_1206230_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_000965711.1|1206463_1207201_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|1207275_1208688_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_094338239.1|1208798_1211018_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	1.3e-103
WP_000848528.1|1211059_1211317_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_107235621.1|1211367_1212294_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013130.1|1212493_1213321_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.9	2.8e-62
>prophage 89
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1219875	1220760	5071057		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_063085221.1|1219875_1220760_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.5	3.4e-66
>prophage 90
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1242920	1244093	5071057		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524987.1|1242920_1244093_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 91
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1276751	1277417	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_016238547.1|1276751_1277417_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.6e-07
>prophage 92
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1294373	1295357	5071057		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001298261.1|1294373_1295357_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 93
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1300575	1303410	5071057		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001079776.1|1300575_1301220_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	34.1	4.1e-29
WP_000692293.1|1301233_1301455_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186710.1|1301523_1302000_-	RadC family protein	NA	NA	NA	NA	NA
WP_000206661.1|1302014_1302500_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.4	8.1e-14
WP_001234706.1|1302591_1303410_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	3.6e-46
>prophage 94
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1314472	1329509	5071057	integrase,transposase	Escherichia_phage(28.57%)	9	1309753:1309767	1330281:1330295
1309753:1309767	attL	ATTCTGAATAAAAGA	NA	NA	NA	NA
WP_085947772.1|1314472_1315686_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_097423569.1|1315833_1316616_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	2.2e-138
WP_001295213.1|1316612_1317635_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_000366617.1|1318489_1320547_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.4	4.9e-36
WP_000005571.1|1320539_1321826_+	McrC family protein	NA	NA	NA	NA	NA
WP_001034306.1|1322511_1325508_+	N-6 DNA methylase	NA	A0A2R2ZGH5	Clostridioides_phage	23.4	3.8e-21
WP_000668951.1|1325577_1327203_-	N-6 DNA methylase	NA	A0A2I6UHU5	Bacillus_phage	27.7	2.5e-14
WP_001051770.1|1327192_1327381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089639920.1|1328243_1329509_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	1.8e-81
1330281:1330295	attR	ATTCTGAATAAAAGA	NA	NA	NA	NA
>prophage 95
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1355318	1356473	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1355318_1356473_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 96
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1365008	1365917	5071057		Yersinia_phage(100.0%)	1	NA	NA
WP_000646928.1|1365008_1365917_-	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	1.5e-53
>prophage 97
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1387125	1388358	5071057		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1387125_1388358_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 98
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1397205	1401676	5071057		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_063085787.1|1397205_1400079_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	6.3e-263
WP_032281563.1|1400242_1401676_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
>prophage 99
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1405481	1421584	5071057	tRNA,transposase	Brevibacillus_phage(14.29%)	15	NA	NA
WP_000806652.1|1405481_1406378_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.9e-30
WP_000715213.1|1406402_1407113_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_107235651.1|1407118_1408852_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.4e-60
WP_001701073.1|1408942_1410040_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003071.1|1410050_1411568_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_000526135.1|1411758_1412217_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001192788.1|1412321_1412870_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|1412924_1412996_+	protein YqfH	NA	NA	NA	NA	NA
WP_001050745.1|1412992_1413118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|1413119_1414568_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_107235652.1|1415003_1416923_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838433.1|1416922_1417411_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_107235653.1|1417446_1418814_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_159042845.1|1418849_1420166_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280198.1|1420183_1421584_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 100
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1445864	1446617	5071057		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|1445864_1446617_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 101
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1478346	1480841	5071057		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603518.1|1478346_1479108_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|1479422_1480841_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 102
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1490472	1497245	5071057		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|1490472_1491186_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|1491254_1491944_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|1492628_1493159_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_063086157.1|1493171_1495418_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.7	1.0e-10
WP_000204658.1|1495568_1496444_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|1496450_1497245_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 103
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1502722	1517997	5071057	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138160.1|1502722_1505611_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	4.0e-68
WP_107235674.1|1505603_1509146_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001600422.1|1509145_1510972_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_107235675.1|1511033_1512365_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|1512596_1513850_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|1514318_1515416_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117726.1|1515491_1516298_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	1.7e-16
WP_000184256.1|1516348_1516792_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_063086167.1|1516791_1517997_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	4.6e-74
>prophage 104
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1529523	1530279	5071057		Bacillus_phage(100.0%)	1	NA	NA
WP_001309702.1|1529523_1530279_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	3.8e-10
>prophage 105
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1535136	1535985	5071057		Vibrio_phage(100.0%)	1	NA	NA
WP_000100411.1|1535136_1535985_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	3.6e-41
>prophage 106
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1543418	1547533	5071057		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|1543418_1546175_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_107235681.1|1546231_1547533_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	4.4e-38
>prophage 107
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1550929	1555850	5071057		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_000210878.1|1550929_1552567_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|1552654_1553953_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001199976.1|1555178_1555850_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.3e-14
>prophage 108
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1560138	1560924	5071057		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021318.1|1560138_1560924_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	8.5e-21
>prophage 109
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1585206	1587239	5071057		Hokovirus(50.0%)	2	NA	NA
WP_021553823.1|1585206_1586634_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|1586633_1587239_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 110
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1590351	1600372	5071057		uncultured_Mediterranean_phage(33.33%)	10	NA	NA
WP_001295182.1|1590351_1591113_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1591106_1591733_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1591872_1593012_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1593074_1594067_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001208077.1|1594186_1594594_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000767723.1|1594740_1595334_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_021513182.1|1595333_1596761_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000562982.1|1596771_1597008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001590575.1|1597048_1597705_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272905.1|1597810_1600372_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	6.6e-30
>prophage 111
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1619477	1620491	5071057		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001551541.1|1619477_1620491_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 112
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1627904	1628870	5071057		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|1627904_1628870_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 113
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1634336	1640433	5071057	tRNA,transposase	Pseudomonas_phage(25.0%)	6	NA	NA
WP_000132231.1|1634336_1634834_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|1634913_1635975_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000526135.1|1636164_1636623_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_107235698.1|1636754_1637255_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_107235699.1|1637382_1640013_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1640247_1640433_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 114
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1654081	1659379	5071057		Bacillus_virus(20.0%)	5	NA	NA
WP_000985490.1|1654081_1655284_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777951.1|1655640_1656600_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	1.3e-132
WP_000246569.1|1656609_1658754_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	3.2e-195
WP_000080947.1|1658726_1659137_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1659133_1659379_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 115
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1665185	1669237	5071057		Clostridium_phage(50.0%)	4	NA	NA
WP_000522413.1|1665185_1665635_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
WP_000156811.1|1665635_1666298_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|1666318_1667719_-	GABA permease	NA	NA	NA	NA	NA
WP_000097652.1|1667956_1669237_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	2.1e-32
>prophage 116
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1678794	1679004	5071057		Salmonella_phage(100.0%)	1	NA	NA
WP_072146303.1|1678794_1679004_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	74.5	2.0e-09
>prophage 117
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1684654	1685137	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|1684654_1685137_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 118
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1694693	1764218	5071057	head,transposase,plate,portal,capsid,terminase,tail,integrase,tRNA,holin	Enterobacteria_phage(78.0%)	76	1690899:1690915	1767739:1767755
1690899:1690915	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_000264776.1|1694693_1695461_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1695502_1695850_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1695925_1696408_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000526135.1|1697073_1697532_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001212388.1|1698350_1698869_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001353010.1|1699018_1699384_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168043.1|1699593_1700664_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	5.3e-90
WP_000225210.1|1700674_1701796_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_064226296.1|1701838_1702999_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1703098_1703146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974887.1|1703313_1704303_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_001242988.1|1704369_1704672_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001001394.1|1704767_1705094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813365.1|1705112_1705454_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_023486737.1|1705464_1705743_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	8.1e-35
WP_000514277.1|1705754_1705997_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|1705993_1706107_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000985157.1|1706633_1706837_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|1706833_1707100_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|1707096_1707396_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_157896070.1|1707407_1708025_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	39.3	3.4e-09
WP_000599378.1|1708021_1708387_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	5.1e-61
WP_159042821.1|1708393_1711222_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.2	0.0e+00
WP_000686533.1|1711298_1712258_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	7.6e-181
WP_086259090.1|1712262_1712574_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	93.2	6.1e-47
WP_050901162.1|1712637_1713237_+	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	63.6	9.0e-31
WP_053897043.1|1713233_1713773_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	59.3	2.8e-23
WP_107235708.1|1714339_1714864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|1714879_1715926_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_107235709.1|1715925_1717677_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_107235710.1|1717831_1718668_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	1.0e-149
WP_107235711.1|1718691_1719744_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	3.3e-193
WP_000632322.1|1719789_1720590_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_107235712.1|1720693_1721188_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.6	5.1e-88
WP_000864897.1|1721187_1721388_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|1721390_1721714_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1721710_1722103_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_013009205.1|1722099_1722507_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	1.6e-63
WP_000920594.1|1722644_1723112_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356339.1|1723104_1723740_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_107235713.1|1723736_1724318_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	6.1e-101
WP_047647273.1|1724314_1724665_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	6.6e-58
WP_105494731.1|1724668_1725565_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	4.3e-154
WP_107235714.1|1725557_1726085_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	88.3	2.1e-84
WP_107235715.1|1726095_1728753_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.3	4.6e-284
WP_107235716.1|1728752_1729370_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.3e-85
WP_107236321.1|1729333_1729879_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_159042822.1|1730067_1730556_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	6.8e-85
WP_107235718.1|1730568_1733376_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.0	0.0e+00
WP_000333503.1|1733362_1733518_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_040035748.1|1733526_1733892_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	84.3	5.5e-47
WP_000290456.1|1733946_1734459_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_099548378.1|1734458_1735643_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	1.3e-222
WP_099548381.1|1735800_1736910_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	95.7	7.9e-198
WP_000488107.1|1736952_1737213_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032140709.1|1737404_1737545_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
WP_071529674.1|1737755_1737992_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000215751.1|1737936_1738743_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.2e-65
WP_000178456.1|1738893_1739235_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1739502_1740240_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079108.1|1740374_1741355_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_107235720.1|1741351_1742083_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1742212_1744786_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_097309867.1|1750675_1751974_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
WP_001221086.1|1751970_1752294_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1752339_1753695_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001544854.1|1753808_1756469_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_063085883.1|1756500_1757199_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1757267_1757687_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_025210768.1|1757893_1758931_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262720.1|1758978_1759668_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000627804.1|1759972_1760356_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189223.1|1760410_1760998_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_107236322.1|1761100_1761982_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1762014_1763349_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001295363.1|1763480_1764218_+|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
1767739:1767755	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
>prophage 119
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1769120	1772863	5071057		Tupanvirus(50.0%)	3	NA	NA
WP_001521085.1|1769120_1770920_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1770935_1771910_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1772182_1772863_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 120
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1776322	1776583	5071057		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196285.1|1776322_1776583_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 121
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1780702	1792010	5071057		Bacillus_phage(50.0%)	7	NA	NA
WP_001308856.1|1780702_1784590_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	5.9e-131
WP_063085826.1|1785165_1786593_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	2.0e-15
WP_001590522.1|1786757_1787471_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_107235721.1|1787460_1788795_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|1788855_1789194_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883115.1|1789238_1790429_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919149.1|1790756_1792010_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.0e-100
>prophage 122
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1797775	1799287	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_107235722.1|1797775_1799287_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	4.0e-11
>prophage 123
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1814422	1820946	5071057		Faustovirus(20.0%)	8	NA	NA
WP_001316526.1|1814422_1815637_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|1815664_1816051_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|1816067_1816391_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_001357290.1|1816486_1817002_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_063085846.1|1817018_1818869_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124471.1|1818870_1819206_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|1819217_1819418_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133570.1|1819662_1820946_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
>prophage 124
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1830833	1831265	5071057		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1830833_1831265_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 125
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1851733	1858036	5071057		Escherichia_phage(60.0%)	6	NA	NA
WP_021551967.1|1851733_1853110_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.3e-42
WP_001296289.1|1853271_1854738_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|1854806_1856384_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001521044.1|1856478_1857018_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	96.6	1.6e-42
WP_000669412.1|1857033_1857549_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001344399.1|1857862_1858036_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 126
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1864471	1868473	5071057		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028615.1|1864471_1865110_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|1865109_1866147_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|1866471_1867098_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|1867183_1868473_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 127
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1889740	1890454	5071057		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1889740_1890454_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 128
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1907721	1908672	5071057		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1907721_1908672_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 129
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1927278	1931564	5071057	transposase	Deep-sea_thermophilic_phage(50.0%)	7	NA	NA
WP_000102892.1|1927278_1928148_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_107235738.1|1928361_1928787_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_107235739.1|1928773_1928926_+	DUF2919 family protein	NA	NA	NA	NA	NA
WP_001298448.1|1928874_1929222_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|1929282_1929858_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000526135.1|1930083_1930542_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000084589.1|1930664_1931564_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
>prophage 130
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1935217	1950599	5071057		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517442.1|1935217_1936009_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
WP_107235740.1|1936179_1937196_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458420.1|1937195_1938029_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|1938028_1938904_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021036.1|1938893_1939991_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001445870.1|1940124_1941036_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	7.7e-58
WP_000719926.1|1941038_1941407_-	YfeK family protein	NA	NA	NA	NA	NA
WP_107235741.1|1941511_1942363_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|1942404_1942914_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|1942954_1944682_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|1944726_1944984_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|1945367_1946339_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254839.1|1946523_1947285_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_107235742.1|1947514_1948513_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_059340840.1|1948583_1950599_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.0e-150
>prophage 131
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1959895	1961104	5071057	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_107235743.1|1959895_1961104_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	7.0e-208
>prophage 132
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1967666	1969015	5071057	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_107235745.1|1967666_1969015_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.3	3.3e-73
>prophage 133
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1979318	1980053	5071057		Clostridioides_phage(100.0%)	1	NA	NA
WP_001298580.1|1979318_1980053_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	4.7e-13
>prophage 134
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1983871	1984792	5071057		Morganella_phage(100.0%)	1	NA	NA
WP_000484013.1|1983871_1984792_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 135
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	1988483	1996059	5071057		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_107235750.1|1988483_1990178_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
WP_000955028.1|1990246_1991191_+	transporter YfdV	NA	NA	NA	NA	NA
WP_107235751.1|1991264_1992410_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_107235752.1|1992465_1996059_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	29.3	1.0e-36
>prophage 136
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2002712	2004146	5071057		Bacillus_phage(100.0%)	1	NA	NA
WP_001544784.1|2002712_2004146_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	7.0e-29
>prophage 137
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2007185	2008118	5071057		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|2007185_2008118_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 138
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2024500	2032585	5071057	transposase	Bacillus_phage(66.67%)	9	NA	NA
WP_107235745.1|2024500_2025848_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.3	3.3e-73
WP_000730805.1|2025914_2026466_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001309606.1|2026631_2027564_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001297933.1|2027598_2028684_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_107235760.1|2028687_2029512_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|2029511_2030321_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089220.1|2030320_2030869_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|2030902_2031181_+	YfcL family protein	NA	NA	NA	NA	NA
WP_107235761.1|2031236_2032585_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.0e-74
>prophage 139
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2038601	2039738	5071057		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_107235763.1|2038601_2039738_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	2.2e-22
>prophage 140
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2046202	2047720	5071057		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|2046202_2047720_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 141
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2051931	2053780	5071057		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|2051931_2052705_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_001520932.1|2052877_2053780_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	2.4e-67
>prophage 142
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2064339	2067567	5071057		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203403.1|2064339_2064990_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
WP_107235766.1|2065076_2066909_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|2066967_2067567_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 143
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2102387	2107391	5071057		Tupanvirus(50.0%)	4	NA	NA
WP_063086669.1|2102387_2104370_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	3.1e-19
WP_000461637.1|2104369_2105338_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_063086667.1|2105341_2106481_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	30.1	9.4e-29
WP_001306469.1|2106788_2107391_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
>prophage 144
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2110994	2115552	5071057	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_063086748.1|2110994_2112200_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	9.3e-27
WP_107235768.1|2112256_2113546_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992992.1|2113562_2114366_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140566.1|2114592_2115552_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.1e-69
>prophage 145
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2121444	2122521	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001559485.1|2121444_2122521_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 146
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2125566	2138162	5071057		Pseudomonas_phage(40.0%)	6	NA	NA
WP_000135039.1|2125566_2125821_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	1.5e-24
WP_000332037.1|2125820_2126951_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_001075170.1|2127865_2130151_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_063086656.1|2130846_2134605_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.3	5.0e-18
WP_063086654.1|2134665_2135388_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_001281242.1|2135534_2138162_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 147
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2153084	2157927	5071057		Bacillus_phage(50.0%)	2	NA	NA
WP_000559127.1|2153084_2154911_-	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	4.4e-20
WP_000876029.1|2155077_2157927_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.5	8.4e-42
>prophage 148
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2162090	2167892	5071057		Enterobacteria_phage(25.0%)	5	NA	NA
WP_001590387.1|2162090_2163218_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	1.6e-116
WP_001590385.1|2163329_2164385_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_001590383.1|2164458_2165523_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	39.1	1.8e-18
WP_000884972.1|2165522_2166173_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_063086647.1|2166248_2167892_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	25.0	1.2e-13
>prophage 149
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2176628	2177246	5071057		Bacillus_virus(100.0%)	1	NA	NA
WP_159042848.1|2176628_2177246_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 150
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2188944	2196593	5071057		Vibrio_phage(50.0%)	7	NA	NA
WP_001544737.1|2188944_2189952_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	9.1e-84
WP_000494186.1|2190090_2190375_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578075.1|2190499_2192260_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	4.2e-100
WP_001234850.1|2192409_2193105_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213371.1|2193132_2194323_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	1.7e-20
WP_000202798.1|2194655_2195000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194914.1|2195003_2196593_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 151
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2202347	2206648	5071057		Clostridioides_phage(50.0%)	4	NA	NA
WP_107235777.1|2202347_2202914_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_107235778.1|2203325_2204039_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198810.1|2204077_2205064_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_107235779.1|2205181_2206648_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	8.7e-43
>prophage 152
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2221141	2221999	5071057		Hokovirus(100.0%)	1	NA	NA
WP_000873875.1|2221141_2221999_-	deoxyribonuclease IV	NA	A0A1V0SFR4	Hokovirus	34.3	1.4e-24
>prophage 153
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2226068	2229841	5071057		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489254.1|2226068_2228048_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
WP_063086627.1|2228078_2228915_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|2229172_2229841_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 154
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2233535	2235056	5071057		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|2233535_2235056_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 155
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2255182	2264625	5071057		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569373.1|2255182_2256109_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783137.1|2256113_2256845_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2256825_2256933_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|2256992_2257724_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001309587.1|2257945_2259631_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_000598641.1|2259627_2260347_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2260393_2260864_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|2260905_2261367_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_107235788.1|2261491_2263492_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_107235789.1|2263488_2264625_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 156
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2276481	2278515	5071057	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001600151.1|2276481_2278515_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 157
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2289168	2292725	5071057		Paenibacillus_phage(50.0%)	4	NA	NA
WP_063086595.1|2289168_2289987_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	39.4	2.9e-24
WP_000434038.1|2290038_2290785_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011941.1|2290758_2291724_-	sugar kinase	NA	NA	NA	NA	NA
WP_001578612.1|2291720_2292725_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	30.0	8.9e-15
>prophage 158
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2301865	2307970	5071057	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000807362.1|2301865_2302765_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001308758.1|2303179_2303497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476012.1|2303826_2305188_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
WP_000929408.1|2305335_2305668_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|2305847_2306570_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675148.1|2306566_2307970_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
>prophage 159
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2321411	2322764	5071057		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_107235797.1|2321411_2322764_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	6.0e-06
>prophage 160
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2327427	2337837	5071057		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|2327427_2328069_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|2328160_2328742_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001252331.1|2328763_2330617_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454701.1|2330909_2332493_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|2333151_2334291_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_107235798.1|2334296_2334740_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_107235799.1|2334742_2336905_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654494.1|2336997_2337837_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	7.5e-07
>prophage 161
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2342081	2348875	5071057		Synechococcus_phage(25.0%)	6	NA	NA
WP_107235800.1|2342081_2343203_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.2e-132
WP_000089918.1|2343205_2344171_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	4.9e-87
WP_107235801.1|2344173_2344653_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699734.1|2344649_2345873_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_107235802.1|2345875_2347312_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.4	8.8e-48
WP_097420791.1|2347504_2348875_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
>prophage 162
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2354383	2363094	5071057		Enterobacteria_phage(42.86%)	8	NA	NA
WP_063085474.1|2354383_2355778_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.4e-18
WP_000183053.1|2355952_2356846_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_063085473.1|2357216_2358302_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.9e-101
WP_063085472.1|2358301_2359201_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.7e-28
WP_000857539.1|2359258_2360137_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	8.7e-107
WP_032180859.1|2360141_2360675_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.3	1.5e-56
WP_159042825.1|2360701_2361949_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_032180858.1|2361960_2363094_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.7	3.4e-31
>prophage 163
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2366387	2427940	5071057	head,lysis,transposase,portal,coat,protease,terminase,integrase,holin	Enterobacteria_phage(47.54%)	82	2364123:2364138	2402151:2402166
2364123:2364138	attL	AAAAAGTTGAAAATAA	NA	NA	NA	NA
WP_032180853.1|2366387_2367533_+	glycosyltransferase family 4 protein	NA	A0A1V0SD18	Indivirus	28.8	1.9e-08
WP_032180852.1|2367767_2369174_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	2.3e-37
WP_000526135.1|2369370_2369829_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_024235091.1|2370131_2371298_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	1.7e-110
WP_107235805.1|2371443_2372421_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_023062941.1|2372517_2373129_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000880175.1|2373122_2373899_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_000586485.1|2373880_2374618_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_001103560.1|2374617_2375208_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_000080111.1|2375207_2376275_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_063085464.1|2376274_2377345_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_063085463.1|2377341_2378646_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_000131782.1|2378651_2379551_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
WP_001364200.1|2379696_2379747_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_001259255.1|2380029_2380281_+	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_000767829.1|2380277_2380532_+	type II toxin-antitoxin system mRNA interferase toxin YoeB	NA	NA	NA	NA	NA
WP_000754737.1|2380614_2381439_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000803351.1|2381484_2382414_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010723108.1|2382628_2382691_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000019197.1|2382680_2384039_+	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_000526135.1|2384252_2384711_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_107235806.1|2384823_2386248_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_107235807.1|2386429_2387608_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.2	2.0e-231
WP_057762969.1|2387588_2387780_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	98.4	2.9e-31
WP_001281200.1|2387861_2388206_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_001277763.1|2388306_2388486_-	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	98.3	5.6e-29
WP_107235808.1|2388998_2389367_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	97.5	6.1e-62
WP_016063110.1|2389363_2389531_-	DUF2737 family protein	NA	K7PJV9	Enterobacteria_phage	100.0	1.0e-24
WP_001111298.1|2389541_2389835_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.9e-50
WP_001535902.1|2389858_2390446_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	8.4e-106
WP_000536247.1|2390442_2391123_-	AAA family ATPase	NA	A0A2D1GLT5	Escherichia_phage	100.0	4.5e-127
WP_000613346.1|2391131_2391320_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000372936.1|2391316_2391430_-	host cell division inhibitory peptide Kil	NA	K7PL44	Enterobacteria_phage	97.3	7.8e-13
WP_001198861.1|2391398_2391563_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_025766313.1|2391635_2392004_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167585.1|2392154_2392625_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000382838.1|2392825_2393320_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_001430488.1|2393350_2393713_-	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
WP_107235810.1|2393757_2393988_-	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	97.4	2.0e-31
WP_053294712.1|2394432_2395185_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|2395181_2395739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428098.1|2395829_2396534_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064149.1|2396647_2396881_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	98.7	2.3e-35
WP_107235811.1|2397019_2397319_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	94.9	4.5e-47
WP_107235812.1|2397351_2398251_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	1.9e-173
WP_000788877.1|2398247_2398949_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145926.1|2398945_2399236_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_107235453.1|2399308_2399515_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	1.2e-30
WP_000796282.1|2399527_2399854_+	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
WP_107235452.1|2399850_2400051_+	hypothetical protein	NA	Q716C9	Shigella_phage	98.5	3.9e-31
WP_001555367.1|2400062_2400419_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	96.5	7.9e-59
WP_061157944.1|2400390_2400801_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	9.4e-72
WP_107235451.1|2400797_2400974_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	7.9e-28
WP_107235450.1|2401253_2401937_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	84.6	2.6e-111
WP_001003999.1|2402011_2402734_+	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	98.3	3.3e-128
2402151:2402166	attR	AAAAAGTTGAAAATAA	NA	NA	NA	NA
WP_016244745.1|2402733_2403339_+	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	98.5	3.3e-97
WP_000144614.1|2403335_2403542_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_107235813.1|2403519_2404185_+	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	98.6	6.5e-131
WP_065225559.1|2404181_2404805_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	1.2e-113
WP_000783734.1|2405473_2405797_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229397.1|2405780_2406257_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	3.7e-88
WP_107235448.1|2406253_2406691_+|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	97.9	6.5e-71
WP_107235814.1|2406840_2407323_+	Rha family transcriptional regulator	NA	A0A0N7CEE8	Salmonella_phage	94.7	1.8e-77
WP_107235815.1|2407225_2407453_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.6e-25
WP_107235816.1|2407455_2407896_+|terminase	terminase	terminase	C7U0V7	Enterobacteria_phage	99.3	7.7e-80
WP_107235817.1|2407892_2409308_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.2	2.2e-277
WP_097311862.1|2409309_2411508_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.5	0.0e+00
WP_062886872.1|2411598_2412492_+	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	87.2	5.3e-120
WP_000013272.1|2412510_2413764_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	100.0	2.6e-237
WP_069905690.1|2413805_2413994_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	96.8	9.4e-27
WP_001140510.1|2413974_2414436_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_107235818.1|2414445_2415864_+	hypothetical protein	NA	A5VW69	Enterobacteria_phage	99.6	1.6e-275
WP_107235819.1|2415863_2416817_+	hypothetical protein	NA	Q716G6	Shigella_phage	84.2	7.7e-93
WP_107235820.1|2416816_2417272_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	4.4e-86
WP_096218894.1|2417274_2417967_+	DNA transfer protein	NA	A0A2H4FUQ9	Salmonella_phage	99.1	9.5e-117
WP_107235821.1|2417977_2419390_+	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	69.6	1.7e-165
WP_107235822.1|2419386_2421219_+	DNA transfer protein	NA	A0A2H4FNB8	Salmonella_phage	98.0	1.3e-290
WP_000136767.1|2421581_2422550_+	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
WP_072664579.1|2422565_2422805_-	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	59.7	8.6e-17
WP_001549438.1|2422893_2423067_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_107235823.1|2423129_2424008_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	3.2e-93
WP_063085169.1|2426773_2427940_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	2.5e-226
>prophage 164
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2445429	2446239	5071057		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_063085160.1|2445429_2446239_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.7	4.1e-10
>prophage 165
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2460438	2465671	5071057		Vibrio_phage(50.0%)	3	NA	NA
WP_001578542.1|2460438_2460627_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.1	2.1e-10
WP_001578541.1|2460623_2461085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107235834.1|2461606_2465671_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.1	1.8e-21
>prophage 166
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2482212	2553900	5071057	head,transposase,capsid,terminase,tail,integrase,holin	Enterobacteria_phage(39.62%)	78	2478810:2478825	2495038:2495053
2478810:2478825	attL	TGATATTCACCACGGC	NA	NA	NA	NA
WP_024226620.1|2482212_2483238_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	1.2e-102
WP_000096344.1|2483237_2483441_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_107235836.1|2483499_2485977_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|2486069_2486261_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_107235837.1|2486263_2486446_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001438288.1|2486845_2487283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394533.1|2487251_2487581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053289474.1|2487603_2487822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315544.1|2487981_2488137_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_000787424.1|2488339_2488747_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_000912290.1|2488823_2489051_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_107235838.1|2489034_2489586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122997305.1|2489557_2490598_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	84.6	5.3e-87
WP_157902667.1|2490509_2491052_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_063102599.1|2491084_2491846_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.9	1.8e-116
WP_159042827.1|2493456_2493615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107235839.1|2493979_2494753_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_122997306.1|2495235_2495355_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.1e-08
2495038:2495053	attR	TGATATTCACCACGGC	NA	NA	NA	NA
WP_063102597.1|2495399_2495612_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	8.6e-29
WP_000980984.1|2495828_2496080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140024.1|2497488_2497854_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_107235841.1|2497862_2498405_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	1.6e-71
WP_000917767.1|2498636_2498834_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_107235842.1|2498984_2500034_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	92.2	4.7e-192
WP_032239021.1|2500507_2500933_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	86.5	3.8e-60
WP_000833653.1|2500929_2501082_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001297664.1|2501170_2501563_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	78.5	3.4e-47
WP_000950576.1|2501552_2501828_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	1.9e-44
WP_096930193.1|2501830_2502208_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	1.5e-63
WP_001297666.1|2502340_2502454_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	86.5	5.6e-11
WP_000415817.1|2502812_2503205_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.9	3.7e-49
WP_107235843.1|2503789_2504335_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	2.1e-79
WP_107235446.1|2504309_2506235_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.4	0.0e+00
WP_000198149.1|2506231_2506438_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_000381359.1|2508117_2509689_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2509708_2510056_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|2510055_2510733_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_096101123.1|2511413_2512091_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_000624622.1|2512090_2512438_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381359.1|2512457_2514029_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000201478.1|2514771_2515104_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_107235844.1|2515159_2516185_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.3	1.7e-183
WP_107235845.1|2516226_2516622_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	92.4	4.8e-57
WP_000753006.1|2516633_2516987_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_107235846.1|2516998_2517577_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	8.6e-79
WP_107235847.1|2517573_2517969_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	3.2e-69
WP_107236326.1|2517976_2518717_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.4	6.1e-130
WP_000479153.1|2518732_2519155_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_107235848.1|2519136_2519571_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	2.2e-63
WP_042004418.1|2521974_2522118_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	80.9	5.3e-14
WP_042634545.1|2523833_2524436_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	1.2e-88
WP_107235849.1|2528044_2528644_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	5.7e-102
WP_000526135.1|2528840_2529299_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_107235850.1|2529419_2531795_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	2.0e-169
WP_063103460.1|2531794_2532076_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	52.2	3.7e-19
WP_107235851.1|2532085_2532787_+	chaperone of endosialidase	NA	A0A1X7QGH6	Escherichia_phage	62.3	4.1e-59
WP_063103462.1|2532800_2533091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000358619.1|2533590_2534304_+	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_000734593.1|2534300_2535122_+	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000859544.1|2535118_2535691_+	cytolethal distending toxin type I subunit CdtC	NA	A5LH54	Enterobacteria_phage	98.9	5.3e-105
WP_001007759.1|2536761_2537412_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_107235852.1|2537672_2539020_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	1.5e-73
WP_063086292.1|2539104_2539740_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_021564447.1|2539740_2540745_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2540853_2541267_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2541399_2542071_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826807.1|2542070_2543429_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001544645.1|2543535_2544387_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_107235853.1|2544547_2544898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824405.1|2544978_2546172_-	porin	NA	Q1MVN1	Enterobacteria_phage	55.0	6.5e-105
WP_001313057.1|2546737_2547103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365574.1|2547142_2547838_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_063086296.1|2547904_2549323_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000785989.1|2549303_2549774_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	3.1e-34
WP_001212226.1|2549762_2550683_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|2550855_2551773_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2551851_2552034_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_107235854.1|2552262_2553900_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 167
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2569714	2570383	5071057		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_063086311.1|2569714_2570383_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
>prophage 168
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2583389	2584142	5071057		Bacillus_virus(100.0%)	1	NA	NA
WP_001272991.1|2583389_2584142_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 169
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2596123	2597638	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_107235864.1|2596123_2597638_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	1.6e-12
>prophage 170
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2607726	2613370	5071057		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_107235867.1|2607726_2609388_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_033867069.1|2609433_2611035_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	1.6e-13
WP_107235868.1|2611053_2611914_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|2611916_2612966_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2612980_2613370_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 171
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2617890	2619624	5071057	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025308.1|2617890_2619624_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
>prophage 172
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2626108	2628159	5071057		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019591.1|2626108_2626852_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2626892_2627288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107235873.1|2627340_2628159_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.1	1.8e-69
>prophage 173
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2632177	2639242	5071057		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|2632177_2632699_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024929.1|2632700_2633303_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|2633373_2633439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|2633577_2634189_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568522.1|2634197_2635208_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571471.1|2635355_2636141_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|2636137_2636893_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001376899.1|2636971_2637904_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|2637919_2639242_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 174
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2643241	2644717	5071057		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2643241_2644717_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 175
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2650670	2659715	5071057	transposase	Escherichia_phage(40.0%)	11	NA	NA
WP_000942662.1|2650670_2651840_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.7	1.9e-205
WP_000064873.1|2651896_2652322_+|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
WP_107235877.1|2652478_2654539_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944256.1|2654535_2655198_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011651.1|2655221_2655878_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_107235878.1|2655978_2656209_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	63.2	3.5e-15
WP_001578488.1|2656347_2656722_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_107235879.1|2656725_2657598_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976481.1|2657610_2657952_+	YebY family protein	NA	NA	NA	NA	NA
WP_159042828.1|2658087_2658546_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000812713.1|2659058_2659715_+	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	1.4e-56
>prophage 176
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2667211	2669260	5071057		Moraxella_phage(100.0%)	1	NA	NA
WP_107235882.1|2667211_2669260_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.0e-85
>prophage 177
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2675303	2675513	5071057		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2675303_2675513_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 178
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2681153	2682710	5071057		Moraxella_phage(100.0%)	1	NA	NA
WP_000394985.1|2681153_2682710_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 179
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2686572	2694677	5071057	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_106905103.1|2686572_2687934_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	2.0e-41
WP_000457334.1|2688007_2688187_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001322969.1|2688306_2688666_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2689027_2689372_-	RidA family protein	NA	NA	NA	NA	NA
WP_097752659.1|2689503_2691414_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.0	1.2e-92
WP_107235888.1|2691471_2692167_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|2692205_2692787_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|2692991_2694677_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 180
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2709431	2714008	5071057		Bacillus_phage(100.0%)	3	NA	NA
WP_000766137.1|2709431_2710922_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_107235890.1|2711102_2712578_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|2712724_2714008_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 181
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2717326	2718181	5071057		Indivirus(100.0%)	1	NA	NA
WP_063118653.1|2717326_2718181_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	25.0	3.9e-11
>prophage 182
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2726995	2731080	5071057		Staphylococcus_phage(50.0%)	4	NA	NA
WP_107235895.1|2726995_2727976_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.6	3.0e-07
WP_000719088.1|2728112_2728871_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000438820.1|2728987_2730346_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135079.1|2730438_2731080_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
>prophage 183
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2736005	2739415	5071057	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_063086380.1|2736005_2737961_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
WP_107235896.1|2738067_2739415_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 184
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2743787	2744441	5071057		Planktothrix_phage(100.0%)	1	NA	NA
WP_001339695.1|2743787_2744441_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.7	3.4e-15
>prophage 185
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2751205	2752426	5071057		Klosneuvirus(100.0%)	1	NA	NA
WP_107235899.1|2751205_2752426_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	3.2e-27
>prophage 186
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2759902	2760730	5071057		Bacillus_virus(100.0%)	1	NA	NA
WP_000175035.1|2759902_2760730_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 187
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2766848	2769110	5071057		Tupanvirus(100.0%)	1	NA	NA
WP_107235905.1|2766848_2769110_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	3.0e-143
>prophage 188
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2780399	2799848	5071057	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144202.1|2780399_2782328_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|2782331_2782874_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2782970_2783168_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2783221_2783578_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2783700_2783745_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_107235907.1|2783883_2784867_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	8.4e-34
WP_000672359.1|2784881_2787269_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2787273_2787573_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_107235908.1|2787673_2788654_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|2788716_2789268_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|2789267_2790017_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|2790094_2790559_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001544590.1|2790805_2791519_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_096987340.1|2791581_2793018_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270810.1|2793021_2793213_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001520625.1|2793344_2794391_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	1.2e-83
WP_000368046.1|2794547_2795381_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069370.1|2795712_2798091_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	1.6e-171
WP_159042829.1|2798147_2799848_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
>prophage 189
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2818264	2823348	5071057		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367171.1|2818264_2818633_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
WP_107235915.1|2818641_2820129_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|2820138_2820885_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_044804518.1|2820859_2822131_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_107235916.1|2822127_2823348_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	2.2e-92
>prophage 190
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2831638	2833905	5071057		Escherichia_phage(50.0%)	3	NA	NA
WP_001309532.1|2831638_2832307_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
WP_001070006.1|2832303_2833089_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_107235918.1|2833092_2833905_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
>prophage 191
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2839410	2848214	5071057		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|2839410_2840052_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098886.1|2840091_2841240_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_107235920.1|2841530_2842742_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269493.1|2842854_2843787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|2843783_2844809_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|2845107_2845197_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_063086032.1|2845362_2846532_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|2846677_2847259_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101187.1|2847386_2848214_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 192
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2857015	2858514	5071057		Indivirus(50.0%)	2	NA	NA
WP_000250656.1|2857015_2857912_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
WP_001298528.1|2857992_2858514_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
>prophage 193
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2865425	2866700	5071057	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2865425_2866700_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 194
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2886482	2888294	5071057		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945938.1|2886482_2888294_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 195
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2898189	2899491	5071057		Bacillus_phage(100.0%)	1	NA	NA
WP_097309747.1|2898189_2899491_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	1.1e-17
>prophage 196
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2909591	2967118	5071057	transposase,lysis,portal,protease,terminase,tail,integrase,holin	Enterobacteria_phage(30.56%)	67	2916468:2916482	2935308:2935322
WP_001260850.1|2909591_2910413_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2910512_2910596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|2910688_2911024_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2911420_2912674_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019558.1|2912780_2913674_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225257.1|2913808_2915029_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2915153_2915849_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071591524.1|2915801_2917094_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2916468:2916482	attL	GCTAACCAGCAACGC	NA	NA	NA	NA
WP_063085996.1|2917251_2917866_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	7.3e-28
WP_063085994.1|2917908_2918763_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2918764_2919382_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_074150141.1|2919392_2921816_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_001295396.1|2924501_2924807_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001445899.1|2924914_2925625_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2925627_2926188_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705205.1|2926222_2926564_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001314753.1|2926698_2927025_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_107235931.1|2927229_2928444_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836035.1|2928455_2929475_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001360138.1|2929532_2929643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032171312.1|2929662_2930943_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2930977_2931214_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_107235932.1|2931301_2933773_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083273.1|2933866_2934058_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2934054_2934243_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000159335.1|2934745_2934946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281935.1|2934914_2935280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2935291_2935444_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
2935308:2935322	attR	GCTAACCAGCAACGC	NA	NA	NA	NA
WP_001003381.1|2935636_2936044_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2936121_2936349_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2936332_2936854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023909767.1|2936834_2937800_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	61.8	5.9e-56
WP_107235933.1|2937802_2938015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107235934.1|2938264_2939821_+	DNA repair protein	NA	NA	NA	NA	NA
WP_000887491.1|2939994_2940207_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000981003.1|2940435_2940687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2940753_2941032_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_107235935.1|2941033_2942083_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	5.7e-113
WP_001204787.1|2942100_2942478_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|2942633_2943158_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000592549.1|2943350_2944310_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_089638411.1|2944402_2945676_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.0e-176
WP_123009495.1|2946052_2946766_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107235936.1|2946956_2947172_+|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	6.1e-30
WP_000189900.1|2947176_2947728_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_001557934.1|2947675_2947936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107235937.1|2948048_2948582_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	7.1e-96
WP_001071778.1|2948578_2949076_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|2949439_2949652_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|2949662_2949851_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2949998_2950154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2950326_2950500_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2950793_2951000_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000373425.1|2951552_2952047_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_107235938.1|2952046_2954149_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.4	0.0e+00
WP_107235939.1|2954145_2954358_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	98.6	3.2e-31
WP_023908451.1|2954285_2955866_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	3.1e-288
WP_085949589.1|2955982_2957196_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_107235940.1|2957754_2958354_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.0	4.1e-108
WP_107236330.1|2958418_2961445_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	4.2e-68
WP_097334569.1|2961444_2962020_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	3.2e-102
WP_000087133.1|2962117_2962708_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000836765.1|2963026_2963260_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|2963328_2963442_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347485.1|2964045_2965329_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527819.1|2965418_2966879_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	5.1e-43
WP_063085277.1|2966914_2967118_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.7e-11
>prophage 197
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2972017	2972908	5071057		Bacillus_phage(100.0%)	1	NA	NA
WP_064226038.1|2972017_2972908_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.1e-19
>prophage 198
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2982157	2982541	5071057		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|2982157_2982541_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 199
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2990288	2991707	5071057		Bacillus_phage(100.0%)	1	NA	NA
WP_159042830.1|2990288_2991707_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.7	2.9e-19
>prophage 200
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	2999578	2999842	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_024194905.1|2999578_2999842_-	hypothetical protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	5.7e-06
>prophage 201
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3030063	3036999	5071057		Bacillus_phage(50.0%)	3	NA	NA
WP_107235955.1|3030063_3031749_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	2.9e-10
WP_089559391.1|3031786_3034159_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_107235956.1|3034203_3036999_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	6.8e-20
>prophage 202
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3042279	3046086	5071057		Bacillus_virus(50.0%)	2	NA	NA
WP_107235957.1|3042279_3043662_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	1.2e-17
WP_159042831.1|3043686_3046086_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 203
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3050402	3052308	5071057		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193510.1|3050402_3051389_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	8.5e-18
WP_001595747.1|3051381_3052308_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	5.9e-13
>prophage 204
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3055581	3056993	5071057		Tupanvirus(50.0%)	2	NA	NA
WP_063085560.1|3055581_3056592_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	7.3e-25
WP_000781370.1|3056708_3056993_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 205
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3063005	3064106	5071057		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768393.1|3063005_3064106_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 206
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3072390	3073935	5071057		Escherichia_phage(100.0%)	1	NA	NA
WP_001578328.1|3072390_3073935_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 207
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3077474	3091290	5071057	transposase	Escherichia_phage(33.33%)	9	NA	NA
WP_107235963.1|3077474_3078497_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_001317493.1|3078493_3079276_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000085928.1|3079353_3079923_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_001120147.1|3079926_3080154_-	tautomerase PptA	NA	NA	NA	NA	NA
WP_107235964.1|3080459_3082436_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.6	2.7e-156
WP_107235965.1|3082530_3083580_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	2.4e-18
WP_063085549.1|3084510_3084909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107235966.1|3084909_3089115_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.9	6.4e-22
WP_107235967.1|3089181_3091290_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
>prophage 208
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3096195	3098298	5071057		Salmonella_phage(100.0%)	1	NA	NA
WP_063085542.1|3096195_3098298_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	9.6e-136
>prophage 209
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3105430	3112480	5071057		Mycoplasma_phage(25.0%)	7	NA	NA
WP_000220413.1|3105430_3106444_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_107235970.1|3106461_3107607_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_059341544.1|3107851_3109258_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|3109336_3109753_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813797.1|3109798_3109975_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	59.6	1.2e-12
WP_000494244.1|3110196_3110427_+	YncJ family protein	NA	NA	NA	NA	NA
WP_063085534.1|3110518_3112480_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.8	2.4e-24
>prophage 210
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3126374	3127323	5071057		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|3126374_3126548_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001571380.1|3126792_3127323_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	4.1e-19
>prophage 211
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3131262	3135165	5071057		Klosneuvirus(100.0%)	1	NA	NA
WP_063085528.1|3131262_3135165_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 212
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3166442	3167432	5071057		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3166442_3167432_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 213
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3172392	3179662	5071057	tRNA	Enterobacteria_phage(20.0%)	6	NA	NA
WP_021564352.1|3172392_3173526_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.2e-103
WP_001295593.1|3173666_3174101_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000081418.1|3174276_3175212_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_063085924.1|3175340_3176714_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|3177191_3178175_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|3178429_3179662_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 214
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3189477	3189993	5071057		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945045.1|3189477_3189993_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 215
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3207916	3208999	5071057		Planktothrix_phage(100.0%)	1	NA	NA
WP_063085945.1|3207916_3208999_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 216
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3222702	3223968	5071057		Klosneuvirus(100.0%)	1	NA	NA
WP_000069237.1|3222702_3223968_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	2.7e-24
>prophage 217
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3236758	3238777	5071057		Bacillus_virus(50.0%)	2	NA	NA
WP_107235994.1|3236758_3237565_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_107235995.1|3237613_3238777_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.4	3.3e-29
>prophage 218
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3247710	3249645	5071057		Lactococcus_phage(100.0%)	1	NA	NA
WP_107235998.1|3247710_3249645_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.8	3.4e-31
>prophage 219
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3257457	3258048	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3257457_3258048_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 220
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3262972	3268264	5071057	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001295576.1|3262972_3265570_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_063085969.1|3265949_3266201_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|3266236_3267286_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_107236000.1|3267505_3268264_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
>prophage 221
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3276768	3279726	5071057		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763524.1|3276768_3278364_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_107236335.1|3278367_3279726_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	6.6e-37
>prophage 222
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3291390	3293405	5071057		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|3291390_3292395_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110954.1|3292391_3293405_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 223
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3301816	3312183	5071057		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068076.1|3301816_3302434_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_001287378.1|3303037_3303451_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|3303595_3304504_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|3304705_3305719_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|3305810_3306716_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001314642.1|3306828_3307287_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|3307336_3308179_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|3309260_3309938_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571694.1|3309937_3310648_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|3310644_3312183_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 224
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3323316	3330120	5071057		Spodoptera_litura_granulovirus(33.33%)	9	NA	NA
WP_001146444.1|3323316_3323547_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
WP_001309461.1|3323816_3324917_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_021564294.1|3325321_3325429_+	small toxic polypeptide ldrA/ldrC	NA	NA	NA	NA	NA
WP_064528730.1|3325856_3325964_+	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
WP_000811065.1|3326112_3326967_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|3327002_3327812_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|3327815_3328208_-	SirB family protein	NA	NA	NA	NA	NA
WP_107236006.1|3328204_3329038_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|3329037_3330120_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 225
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3333256	3336008	5071057		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|3333256_3334204_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_107236007.1|3334328_3336008_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.1e-22
>prophage 226
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3351863	3352622	5071057		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000173311.1|3351863_3352622_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 227
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3371287	3372975	5071057		Salmonella_phage(50.0%)	2	NA	NA
WP_107236014.1|3371287_3372556_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	7.4e-208
WP_000897378.1|3372555_3372975_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 228
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3380610	3382412	5071057	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001317493.1|3380610_3381393_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_107235963.1|3381389_3382412_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
>prophage 229
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3386502	3389166	5071057		Escherichia_phage(100.0%)	1	NA	NA
WP_159042832.1|3386502_3389166_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	2.2e-84
>prophage 230
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3394710	3399149	5071057	transposase	Enterobacteria_phage(50.0%)	5	NA	NA
WP_063085009.1|3394710_3395442_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	6.0e-53
WP_063085010.1|3395662_3396067_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_019842521.1|3396119_3396230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210499.1|3396386_3396845_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000444487.1|3397898_3399149_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 231
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3402285	3403656	5071057		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|3402285_3403656_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 232
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3408678	3410656	5071057		Mycoplasma_phage(100.0%)	2	NA	NA
WP_063085459.1|3408678_3409815_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	7.2e-29
WP_044863733.1|3409798_3410656_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 233
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3413908	3417631	5071057		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|3413908_3414730_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_059341441.1|3414745_3415657_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251352.1|3415685_3416930_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|3416929_3417631_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 234
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3425617	3425875	5071057		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|3425617_3425875_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 235
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3438198	3439841	5071057		Streptococcus_virus(50.0%)	2	NA	NA
WP_107236026.1|3438198_3439203_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257002.1|3439199_3439841_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 236
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3443113	3444295	5071057		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|3443113_3443350_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_000007233.1|3443560_3444295_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
>prophage 237
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3456651	3457593	5071057		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001544506.1|3456651_3457593_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 238
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3473438	3473684	5071057		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|3473438_3473684_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 239
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3478346	3479267	5071057		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|3478346_3479267_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 240
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3488575	3489109	5071057		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857406.1|3488575_3489109_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 241
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3493243	3494077	5071057		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|3493243_3494077_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 242
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3497468	3498836	5071057		Bacillus_phage(100.0%)	1	NA	NA
WP_001522838.1|3497468_3498836_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.9e-20
>prophage 243
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3505660	3506725	5071057		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258758.1|3505660_3506725_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 244
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3521451	3523551	5071057		Enterobacteria_phage(100.0%)	3	NA	NA
WP_063085229.1|3521451_3521946_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_107236040.1|3521966_3523295_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.2e-234
WP_001273658.1|3523377_3523551_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 245
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3527859	3540114	5071057		Klosneuvirus(20.0%)	13	NA	NA
WP_063085233.1|3527859_3528780_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
WP_000024560.1|3528779_3529085_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_063085234.1|3529177_3529777_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_059340963.1|3529773_3532320_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	1.2e-71
WP_107236041.1|3532319_3533492_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3533621_3534314_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_063085235.1|3534286_3535315_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_107236042.1|3535397_3538130_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	9.2e-38
WP_063118611.1|3538212_3539286_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3539334_3539508_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_107236043.1|3539497_3539728_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528143.1|3539702_3539891_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3539901_3540114_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 246
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3551108	3551768	5071057	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|3551108_3551768_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 247
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3556001	3558056	5071057		Bacillus_phage(100.0%)	1	NA	NA
WP_063085342.1|3556001_3558056_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.7e-20
>prophage 248
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3570667	3572575	5071057		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|3570667_3572575_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 249
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3581475	3592274	5071057	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_032283123.1|3581475_3582243_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_107236046.1|3582285_3584898_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_063085348.1|3585163_3586366_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3586534_3587935_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977917.1|3588537_3589626_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3589810_3591001_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_063085349.1|3591051_3591699_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3591725_3592274_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 250
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3606979	3611520	5071057		Bacillus_phage(100.0%)	3	NA	NA
WP_107236049.1|3606979_3608728_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_063085354.1|3608764_3611029_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3611235_3611520_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 251
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3617318	3618407	5071057		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057148.1|3617318_3618407_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
>prophage 252
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3622505	3625720	5071057		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292809.1|3622505_3624788_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000111043.1|3624979_3625720_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 253
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3630559	3654679	5071057	tRNA,protease	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|3630559_3631177_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_063085059.1|3631187_3633632_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	1.1e-220
WP_000886683.1|3633870_3635163_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3635253_3636597_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001522754.1|3636607_3637219_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_107236052.1|3637377_3641445_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3641579_3642074_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3642617_3643583_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043583.1|3643705_3645472_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_063085570.1|3645472_3647194_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	1.7e-21
WP_107236053.1|3647235_3647940_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3648224_3648443_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3649485_3651762_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3651792_3652113_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3652435_3652660_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_042003386.1|3652732_3654679_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 254
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3663965	3665684	5071057		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815339.1|3663965_3665684_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	3.1e-31
>prophage 255
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3669271	3670102	5071057		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255171.1|3669271_3670102_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
>prophage 256
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3673782	3674511	5071057		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027205.1|3673782_3674511_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 257
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3677636	3686786	5071057		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149712.1|3677636_3678764_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	7.9e-28
WP_000389258.1|3678804_3679293_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|3679352_3680198_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105436.1|3680194_3681148_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_107236058.1|3681157_3682291_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.1e-29
WP_107236059.1|3682385_3683498_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_107236060.1|3683848_3684325_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_024243474.1|3684412_3685315_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.0e-37
WP_000189140.1|3685375_3686098_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_107236061.1|3686081_3686369_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|3686528_3686786_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
>prophage 258
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3695351	3696554	5071057		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3695351_3696554_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 259
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3701652	3702693	5071057	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_107236064.1|3701652_3702693_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	87.3	2.8e-181
>prophage 260
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3710051	3711923	5071057		Planktothrix_phage(100.0%)	1	NA	NA
WP_107236067.1|3710051_3711923_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	30.1	5.2e-16
>prophage 261
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3715138	3723473	5071057		Synechococcus_phage(33.33%)	6	NA	NA
WP_063085624.1|3715138_3715801_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	2.8e-25
WP_063085626.1|3715931_3716831_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209369.1|3716836_3719269_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114247.1|3719414_3720230_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_107236070.1|3720381_3721641_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|3721880_3723473_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 262
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3729180	3734405	5071057		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|3729180_3729696_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3729748_3729814_-	protein YliM	NA	NA	NA	NA	NA
WP_001295297.1|3730048_3730936_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3731234_3731738_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3732141_3732888_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3733026_3733686_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3733682_3734405_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 263
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3737945	3746843	5071057		Erwinia_phage(25.0%)	8	NA	NA
WP_000710619.1|3737945_3738206_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_107236073.1|3738470_3740753_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990148.1|3740794_3741472_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.5e-18
WP_000146357.1|3741545_3741812_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|3742076_3742337_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_063085649.1|3742476_3743562_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_107236074.1|3743702_3744665_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001522662.1|3744692_3746843_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.7	1.4e-41
>prophage 264
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3751233	3756222	5071057		Catovirus(50.0%)	4	NA	NA
WP_000007116.1|3751233_3752595_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|3752823_3753495_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|3753497_3754493_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_063085273.1|3754485_3756222_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 265
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3767206	3768115	5071057		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308507.1|3767206_3768115_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 266
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3774551	3775841	5071057		Klosneuvirus(100.0%)	1	NA	NA
WP_107236079.1|3774551_3775841_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
>prophage 267
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3786743	3793318	5071057		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|3786743_3787802_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_000604037.1|3787804_3788494_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101994.1|3788493_3789267_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|3789432_3789582_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|3789710_3790499_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_063085395.1|3790566_3792039_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001265443.1|3792301_3793318_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 268
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3797680	3801200	5071057		Klebsiella_phage(33.33%)	4	NA	NA
WP_063085393.1|3797680_3798733_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	5.7e-81
WP_000784339.1|3799048_3799429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951276.1|3799542_3800484_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_107236082.1|3800480_3801200_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	1.6e-21
>prophage 269
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3845115	3845907	5071057		Kaumoebavirus(100.0%)	1	NA	NA
WP_062876414.1|3845115_3845907_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.0	1.7e-08
>prophage 270
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3849285	3858726	5071057		Acinetobacter_phage(33.33%)	4	NA	NA
WP_001032697.1|3849285_3850767_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_063085385.1|3850809_3852228_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	5.2e-61
WP_063085384.1|3852224_3852734_-	YbgA family protein	NA	NA	NA	NA	NA
WP_107236088.1|3854475_3858726_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.5	6.9e-24
>prophage 271
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3861985	3871290	5071057		Paramecium_bursaria_Chlorella_virus(25.0%)	7	NA	NA
WP_000088011.1|3861985_3864034_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.7	9.3e-27
WP_063085054.1|3864042_3864615_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_107236090.1|3864607_3867292_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186084.1|3867288_3867966_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	5.2e-27
WP_107236091.1|3868129_3869770_-	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_000848387.1|3869795_3870341_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_000773283.1|3870525_3871290_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 272
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3876154	3879968	5071057	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|3876154_3877819_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023116.1|3878021_3879968_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	9.2e-08
>prophage 273
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3884594	3886259	5071057		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_063085204.1|3884594_3886259_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 274
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3890355	3891435	5071057		Pseudomonas_phage(100.0%)	1	NA	NA
WP_074150205.1|3890355_3891435_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 275
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3897318	3902442	5071057	tRNA	Planktothrix_phage(50.0%)	4	NA	NA
WP_000631384.1|3897318_3898044_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207527.1|3898161_3899097_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_001044880.1|3899141_3899624_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_107236337.1|3899859_3902442_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.5e-183
>prophage 276
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3909452	3911892	5071057		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|3909452_3910541_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_107236092.1|3910680_3911892_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.4	6.8e-102
>prophage 277
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3916708	3917355	5071057		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939743.1|3916708_3917092_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.6	2.3e-24
WP_000034825.1|3917145_3917355_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 278
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	3931445	4058297	5071057	head,transposase,lysis,portal,capsid,protease,tail,terminase,integrase,holin	Enterobacteria_phage(46.48%)	131	3996672:3996718	4058311:4058357
WP_000278505.1|3931445_3931874_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000526135.1|3932044_3932503_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000887629.1|3932706_3934272_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000052796.1|3934442_3935006_-	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_001469131.1|3935377_3936124_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_021564067.1|3936331_3937234_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077779129.1|3938572_3939202_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
WP_025210291.1|3939202_3940363_-	methionine-oxo-acid transaminase	NA	NA	NA	NA	NA
WP_072648602.1|3940470_3941559_+	hydroxycarboxylate dehydrogenase HcxA	NA	NA	NA	NA	NA
WP_000460431.1|3941568_3941766_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001043157.1|3941908_3944014_-	carbon starvation protein CstA	NA	NA	NA	NA	NA
WP_063086136.1|3944194_3944608_-	proofreading thioesterase EntH	NA	NA	NA	NA	NA
WP_000347633.1|3944610_3945357_-	2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase	NA	NA	NA	NA	NA
WP_107236095.1|3945356_3946214_-	enterobactin biosynthesis bifunctional isochorismatase/aryl carrier protein EntB	NA	NA	NA	NA	NA
WP_000026840.1|3946227_3947838_-	(2,3-dihydroxybenzoyl)adenylate synthase	NA	NA	NA	NA	NA
WP_107236096.1|3947847_3949023_-	isochorismate synthase EntC	NA	NA	NA	NA	NA
WP_001558787.1|3949211_3950168_+	Fe2+-enterobactin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001041789.1|3950171_3951422_-	enterobactin transporter EntS	NA	NA	NA	NA	NA
WP_063086133.1|3951532_3952537_+	Fe(3+)-siderophore ABC transporter permease	NA	NA	NA	NA	NA
WP_063086131.1|3952533_3953526_+	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_063086130.1|3953522_3954338_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	1.5e-07
WP_063086128.1|3954334_3955468_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_107236097.1|3955682_3959564_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	6.4e-61
WP_000885788.1|3959560_3959779_-	MbtH family protein	NA	NA	NA	NA	NA
WP_063086124.1|3959781_3960984_-	enterochelin esterase	NA	NA	NA	NA	NA
WP_107236098.1|3961226_3963467_+	siderophore enterobactin receptor FepA	NA	NA	NA	NA	NA
WP_077881291.1|3963641_3964262_+	enterobactin synthase subunit EntD	NA	NA	NA	NA	NA
WP_000956465.1|3964383_3964536_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_074151665.1|3964886_3965183_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001130640.1|3965479_3966598_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000682518.1|3966663_3966912_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_000360954.1|3966976_3967345_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_107236099.1|3967438_3968092_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_107236100.1|3968199_3969447_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_107236101.1|3969514_3970891_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_000573940.1|3970992_3974136_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
WP_107236102.1|3974147_3975371_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000709869.1|3975386_3975719_-	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000074187.1|3975742_3977125_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000770953.1|3977281_3977965_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253856.1|3977954_3979403_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.5	1.7e-11
WP_000103213.1|3980139_3982041_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	7.1e-29
WP_001160804.1|3982068_3982530_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_107236103.1|3982549_3987412_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.5	4.5e-19
WP_001299578.1|3987450_3987660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159042835.1|3987774_3988086_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_001550768.1|3988189_3989326_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_063086119.1|3989596_3991834_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_107236105.1|3991820_3994793_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224574.1|3994793_3995684_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|3995866_3996628_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3996672:3996718	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|3997140_3998094_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_107236107.1|3998280_3999765_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_107236108.1|3999948_4000254_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|4000310_4000979_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_107236109.1|4001420_4003304_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095522819.1|4003779_4004073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551067.1|4004115_4005156_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_107236110.1|4005165_4005447_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	7.0e-18
WP_107236111.1|4005446_4007819_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_001230336.1|4007883_4008483_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_107236112.1|4008549_4011948_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.2	0.0e+00
WP_000090891.1|4012008_4012641_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_107236113.1|4012577_4013321_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152612.1|4013326_4014025_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847332.1|4014024_4014354_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_107236114.1|4014350_4016900_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.6	0.0e+00
WP_107235848.1|4016892_4017327_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	2.2e-63
WP_000479153.1|4017308_4017731_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_103743600.1|4017746_4018487_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.6e-130
WP_107235847.1|4018494_4018890_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	3.2e-69
WP_107236115.1|4018886_4019465_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.0e-79
WP_107236116.1|4019476_4019812_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	97.3	4.8e-58
WP_000381359.1|4019857_4021429_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4021448_4021796_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|4021795_4022473_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_107236117.1|4022548_4022944_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	91.7	1.8e-56
WP_033549155.1|4022985_4024011_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	3.6e-189
WP_001563774.1|4024066_4024399_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	99.1	2.5e-54
WP_107236118.1|4024408_4025728_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_107236119.1|4027297_4027579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835282.1|4027590_4028133_-|terminase	terminase	terminase	O64316	Escherichia_phage	48.8	3.4e-37
WP_001178671.1|4028334_4028718_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000190773.1|4028729_4029071_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000228106.1|4029080_4030121_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.2	3.0e-66
WP_000126640.1|4030338_4030761_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000161636.1|4030757_4031009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107236121.1|4031357_4033112_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.1	7.8e-91
WP_000425299.1|4033108_4033408_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001091146.1|4033425_4033647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|4033647_4033839_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_000920679.1|4033838_4034024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390072.1|4034016_4034214_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000179580.1|4034404_4034710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038675.1|4035043_4035622_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.0	9.2e-57
WP_001029461.1|4035678_4035936_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_107236122.1|4035937_4037179_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	42.6	4.5e-93
WP_107236123.1|4037327_4038209_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.6	3.6e-161
WP_000198149.1|4038205_4038412_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_107236124.1|4038408_4040334_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453576.1|4040308_4040854_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_089601969.1|4041478_4041853_-	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	83.1	1.1e-50
WP_097439781.1|4041891_4042335_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	95.2	3.5e-72
WP_107236125.1|4042331_4042808_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	5.8e-81
WP_000544528.1|4042794_4043100_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_064226622.1|4043329_4044133_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	48.2	1.1e-68
WP_107236126.1|4044354_4045044_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	49.4	7.6e-58
WP_032238472.1|4045040_4045181_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	1.9e-08
WP_001099519.1|4045177_4045540_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	3.3e-60
WP_000774477.1|4045536_4045827_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224907.1|4045819_4045990_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_107236127.1|4045989_4046445_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_001303586.1|4046441_4046543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107236128.1|4046632_4047943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089619356.1|4048332_4048665_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|4048732_4049035_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_107236129.1|4049031_4049733_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.9e-128
WP_001551200.1|4049729_4050659_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_001182903.1|4050745_4051285_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|4051354_4051585_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|4051689_4052379_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|4052974_4053181_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|4053256_4053553_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|4053558_4054344_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186878.1|4054340_4055021_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_000149533.1|4055017_4055176_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_000084449.1|4055172_4056237_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
WP_000763385.1|4056390_4056609_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|4056656_4056935_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_096843913.1|4056906_4057278_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|4057133_4058297_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
4058311:4058357	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 279
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4065375	4068506	5071057	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729155.1|4065375_4066242_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190286.1|4066243_4066456_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001522081.1|4066563_4067085_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912350.1|4067120_4068506_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 280
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4079917	4081063	5071057		Streptococcus_phage(100.0%)	1	NA	NA
WP_107236134.1|4079917_4081063_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 281
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4087255	4089037	5071057		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001305518.1|4087255_4089037_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 282
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4094295	4102025	5071057		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_107236138.1|4094295_4098498_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.5	1.2e-23
WP_107236139.1|4098927_4101342_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110571.1|4101338_4102025_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	3.8e-33
>prophage 283
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4105161	4105839	5071057		Bacillus_virus(100.0%)	1	NA	NA
WP_001157551.1|4105161_4105839_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 284
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4111542	4113705	5071057		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_107236140.1|4111542_4113705_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	4.1e-17
>prophage 285
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4138786	4141291	5071057		uncultured_virus(100.0%)	1	NA	NA
WP_063086081.1|4138786_4141291_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.6	2.6e-116
>prophage 286
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4149823	4158281	5071057		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000764314.1|4149823_4150783_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.7	7.2e-14
WP_001250111.1|4150779_4151742_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|4151873_4152518_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678197.1|4152698_4154573_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	8.9e-117
WP_001195025.1|4154682_4155288_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|4155287_4155617_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_107236142.1|4155669_4157601_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|4157729_4158281_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 287
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4165119	4168269	5071057		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|4165119_4168269_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 288
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4177093	4180640	5071057		Bacillus_phage(100.0%)	2	NA	NA
WP_063085324.1|4177093_4178875_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.0e-42
WP_001235645.1|4178867_4180640_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 289
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4183963	4184659	5071057		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|4183963_4184659_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 290
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4187787	4192834	5071057	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|4187787_4188060_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|4188268_4190623_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|4190810_4192085_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|4192210_4192834_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 291
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4216393	4225234	5071057	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|4216393_4216864_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_107236148.1|4216952_4218056_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	8.2e-54
WP_000543535.1|4218059_4218509_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_063085317.1|4218659_4219199_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_107236149.1|4219496_4220381_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|4220418_4220766_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|4220894_4221866_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|4221876_4223724_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|4223751_4224084_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|4224106_4225234_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 292
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4234762	4244734	5071057		Bacillus_phage(60.0%)	7	NA	NA
WP_000893603.1|4234762_4236058_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|4236115_4236805_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|4236994_4238197_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_107236151.1|4238193_4241337_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	4.5e-12
WP_024190038.1|4241462_4242647_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_107236152.1|4242789_4243698_-	fructokinase	NA	NA	NA	NA	NA
WP_001366457.1|4243822_4244734_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 293
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4249020	4250136	5071057		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4249020_4250136_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 294
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4265755	4266523	5071057		Planktothrix_phage(100.0%)	1	NA	NA
WP_107236157.1|4265755_4266523_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.2	4.7e-24
>prophage 295
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4271813	4272923	5071057		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4271813_4272923_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 296
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4276001	4277962	5071057		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_001013499.1|4276001_4277015_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_107236159.1|4277011_4277962_-	acetaldehyde dehydrogenase	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.3	1.1e-35
>prophage 297
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4283372	4287652	5071057		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805887.1|4283372_4284455_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.9	4.1e-191
WP_107236162.1|4284577_4287652_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.2	0.0e+00
>prophage 298
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4292178	4299215	5071057	transposase	Lactobacillus_phage(33.33%)	5	NA	NA
WP_025210232.1|4292178_4293078_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	7.2e-16
WP_063085411.1|4293117_4294401_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|4294390_4295650_-	cytosine permease	NA	NA	NA	NA	NA
WP_107236165.1|4295863_4297212_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.3	2.5e-73
WP_000010270.1|4297328_4299215_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 299
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4307596	4312134	5071057		Tupanvirus(50.0%)	4	NA	NA
WP_063085413.1|4307596_4308646_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	6.3e-72
WP_000750345.1|4308732_4309689_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818902.1|4309685_4310657_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447328.1|4310649_4312134_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 300
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4324792	4330712	5071057	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_063085419.1|4324792_4326826_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001305448.1|4326954_4327542_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_063085420.1|4327555_4329028_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_063085421.1|4329041_4330712_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	3.1e-60
>prophage 301
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4336287	4339592	5071057		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_107236171.1|4336287_4337613_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	7.2e-113
WP_000474001.1|4337721_4337958_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_107236172.1|4337969_4338563_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_159042837.1|4338722_4339592_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	3.5e-52
>prophage 302
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4364716	4366915	5071057		Acinetobacter_phage(100.0%)	1	NA	NA
WP_107236179.1|4364716_4366915_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	5.6e-38
>prophage 303
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4374035	4374314	5071057		Vibrio_phage(100.0%)	1	NA	NA
WP_001577780.1|4374035_4374314_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	1.6e-14
>prophage 304
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4379715	4380246	5071057		Sodalis_phage(100.0%)	1	NA	NA
WP_105288864.1|4379715_4380246_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	34.0	3.6e-07
>prophage 305
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4385481	4429058	5071057	integrase,plate,transposase	Stx2-converting_phage(36.36%)	39	4384615:4384629	4433099:4433113
4384615:4384629	attL	TTACCGTCAGCCATG	NA	NA	NA	NA
WP_000671665.1|4385481_4386330_-	hypothetical protein	NA	A0A0P0ZAZ7	Stx2-converting_phage	33.0	2.3e-19
WP_000072422.1|4386407_4386605_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000565284.1|4386832_4387630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772650.1|4387758_4388973_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	8.8e-134
WP_097420880.1|4389329_4390583_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	3.2e-94
WP_001285288.1|4390594_4391698_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4391985_4393041_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174684.1|4393079_4393481_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_107236189.1|4393538_4394783_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4394874_4395333_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4395593_4397051_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_107236190.1|4397407_4397662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107236191.1|4397906_4398359_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107236192.1|4398368_4398767_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_107236193.1|4398769_4399063_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|4399114_4400170_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_107236342.1|4400240_4401011_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_107236194.1|4400970_4402710_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000598760.1|4402814_4403093_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001030484.1|4403085_4403442_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001550651.1|4403498_4404257_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001225679.1|4404548_4405289_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4405259_4406027_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4406131_4406710_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_107236195.1|4406949_4409394_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|4409436_4409910_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_063085372.1|4410063_4410834_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001077735.1|4412231_4412609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107236196.1|4412608_4417105_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	4.7e-23
WP_000381359.1|4418833_4420405_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4420424_4420772_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_096101123.1|4420771_4421449_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	47.2	7.3e-21
WP_107236197.1|4421448_4422027_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_063085374.1|4423451_4423952_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4423986_4424211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236198.1|4424295_4425738_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_063085376.1|4425744_4426158_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_107236199.1|4426161_4428012_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_107236200.1|4427975_4429058_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
4433099:4433113	attR	TTACCGTCAGCCATG	NA	NA	NA	NA
>prophage 306
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4446309	4454161	5071057		Bradyrhizobium_phage(25.0%)	10	NA	NA
WP_001308374.1|4446309_4447041_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|4447105_4447573_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_107236205.1|4447569_4448292_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_107236206.1|4448325_4449081_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4449152_4450511_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_107236207.1|4450557_4451178_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_159042839.1|4451199_4451328_-	ubiquinone biosynthesis methyltransferase UbiE	NA	NA	NA	NA	NA
WP_001230983.1|4451405_4452206_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648583.1|4452446_4453361_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997053.1|4453357_4454161_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
>prophage 307
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4461392	4462424	5071057		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4461392_4462424_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 308
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4475255	4479371	5071057		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294788.1|4475255_4478738_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	2.8e-209
WP_000569423.1|4478774_4479371_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
>prophage 309
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4488199	4488958	5071057		Flavobacterium_phage(100.0%)	1	NA	NA
WP_107236215.1|4488199_4488958_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 310
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4500806	4502231	5071057	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|4500806_4502231_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 311
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4506160	4506505	5071057		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4506160_4506505_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 312
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4512416	4513214	5071057		Planktothrix_phage(100.0%)	1	NA	NA
WP_089638922.1|4512416_4513214_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.7e-13
>prophage 313
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4518355	4525161	5071057	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001520511.1|4518355_4520785_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	6.0e-41
WP_001294687.1|4520858_4521389_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396050.1|4521403_4522108_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|4522285_4522741_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937404.1|4522777_4523704_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071593646.1|4523742_4525161_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 314
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4534653	4535526	5071057	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_063086562.1|4534653_4535526_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.4	1.3e-59
>prophage 315
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4538788	4545250	5071057		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|4538788_4539715_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|4539823_4540486_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_107236222.1|4540526_4541063_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	8.7e-17
WP_021516789.1|4541268_4543653_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001550615.1|4543699_4545250_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	4.6e-18
>prophage 316
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4552995	4554420	5071057		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_038339909.1|4552995_4554420_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	2.4e-42
>prophage 317
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4563047	4563599	5071057		Sphingobium_phage(100.0%)	1	NA	NA
WP_063086558.1|4563047_4563599_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.1	2.3e-12
>prophage 318
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4567844	4568888	5071057		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|4567844_4568888_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 319
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4594971	4596696	5071057		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425633.1|4594971_4596696_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	3.2e-36
>prophage 320
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4609186	4609885	5071057		Planktothrix_phage(100.0%)	1	NA	NA
WP_032352598.1|4609186_4609885_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 321
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4616185	4621607	5071057		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_001586654.1|4616185_4618537_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	3.9e-37
WP_001117011.1|4618700_4621607_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 322
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4630668	4632616	5071057		Microcystis_phage(50.0%)	3	NA	NA
WP_000257195.1|4630668_4631517_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000125566.1|4631817_4632051_-	antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|4632136_4632616_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 323
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4640510	4646160	5071057		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|4640510_4642025_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|4642055_4643198_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_063086537.1|4643315_4644533_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_063086535.1|4644606_4646160_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.9	6.0e-34
>prophage 324
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4651660	4652809	5071057		Halovirus(100.0%)	1	NA	NA
WP_001589662.1|4651660_4652809_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 325
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4657215	4660032	5071057	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_063086530.1|4657215_4660032_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	3.5e-77
>prophage 326
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4669518	4678586	5071057		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681352.1|4669518_4670685_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	1.7e-89
WP_001181672.1|4671213_4671423_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001118464.1|4671526_4672657_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|4672745_4674662_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843579.1|4675037_4675442_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102367.1|4675467_4676181_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528541.1|4676329_4676896_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_063086525.1|4676930_4677518_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130187.1|4677632_4678586_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 327
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4690240	4692354	5071057		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_024230208.1|4690240_4691665_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.1	3.2e-10
WP_107236234.1|4691664_4692354_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
>prophage 328
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4695540	4699356	5071057		Bacillus_phage(50.0%)	2	NA	NA
WP_000409419.1|4695540_4697478_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046743.1|4697688_4699356_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
>prophage 329
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4703638	4704871	5071057		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|4703638_4704871_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 330
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4711588	4712911	5071057		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|4711588_4712911_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 331
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4718415	4721291	5071057		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|4718415_4718577_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_107236239.1|4718703_4719309_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175940.1|4719701_4721291_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 332
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4729118	4730398	5071057		Salmonella_phage(50.0%)	2	NA	NA
WP_107236241.1|4729118_4729658_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	6.4e-28
WP_000799911.1|4729660_4730398_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 333
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4733624	4738989	5071057		Tupanvirus(50.0%)	4	NA	NA
WP_000106044.1|4733624_4734647_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	25.9	6.1e-11
WP_000091572.1|4734785_4735700_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107236242.1|4735914_4737276_+	MFS transporter	NA	NA	NA	NA	NA
WP_033870791.1|4737324_4738989_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 334
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4755980	4759949	5071057		Synechococcus_phage(50.0%)	2	NA	NA
WP_107236248.1|4755980_4758413_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_001387312.1|4758479_4759949_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
>prophage 335
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4766495	4767440	5071057	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_107236251.1|4766495_4767440_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.8	3.3e-59
>prophage 336
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4783154	4783739	5071057		Clostridioides_phage(100.0%)	1	NA	NA
WP_107236255.1|4783154_4783739_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	1.1e-36
>prophage 337
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4791127	4792588	5071057		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|4791127_4792588_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 338
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4802785	4804462	5071057		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|4802785_4803382_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|4803859_4804462_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 339
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4807822	4815322	5071057	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_107236266.1|4807822_4808803_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	55.4	2.3e-100
WP_097310144.1|4809148_4809757_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_033870972.1|4810051_4810303_+	Zn-finger protein	NA	NA	NA	NA	NA
WP_085949589.1|4810457_4811671_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_097336610.1|4812342_4812462_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107236267.1|4812784_4815322_+	N-6 DNA methylase	NA	C7BGE8	Burkholderia_phage	29.3	4.1e-08
>prophage 340
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4818820	4830714	5071057	integrase,tRNA	Stenotrophomonas_phage(25.0%)	7	4809944:4809957	4837912:4837925
4809944:4809957	attL	AATCAATATTCATG	NA	NA	NA	NA
WP_107236269.1|4818820_4820074_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.4	5.2e-81
WP_096932507.1|4821700_4823203_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	2.0e-82
WP_001295681.1|4823321_4824404_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4824403_4825504_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|4825770_4827282_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_001188293.1|4827376_4827859_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_107236270.1|4827858_4830714_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
4837912:4837925	attR	AATCAATATTCATG	NA	NA	NA	NA
>prophage 341
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4839259	4846634	5071057	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_000013046.1|4839259_4840195_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4840207_4840669_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4840741_4841128_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_063086231.1|4841405_4842386_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_107236272.1|4842611_4845308_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.2	1.0e-44
WP_001387276.1|4845448_4845502_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_107236273.1|4845686_4846634_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	1.3e-12
>prophage 342
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4850272	4853583	5071057		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_107236275.1|4850272_4852411_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001009182.1|4852595_4853060_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_001105433.1|4853060_4853351_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_000212715.1|4853340_4853583_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
>prophage 343
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4857844	4864405	5071057		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|4857844_4858843_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595993.1|4858875_4859871_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001298067.1|4859857_4860880_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_107236277.1|4860893_4862396_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	5.2e-11
WP_000265933.1|4862608_4863565_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4863874_4864405_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 344
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4899306	4900470	5071057		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943963.1|4899306_4900470_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	8.3e-81
>prophage 345
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4904314	4917345	5071057	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_057695421.1|4904314_4906756_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	1.1e-66
WP_001177639.1|4906794_4907220_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_107236283.1|4907424_4908723_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	8.4e-66
WP_001089295.1|4908826_4909024_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4909105_4910110_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4910112_4911372_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_087905040.1|4911456_4912737_-	GTPase HflX	NA	NA	NA	NA	NA
WP_062876271.1|4912813_4913122_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|4913207_4914158_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122469.1|4914150_4915998_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_063086407.1|4916007_4917345_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 346
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4921376	4921922	5071057		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001376672.1|4921376_4921922_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	3.8e-28
>prophage 347
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4929350	4930328	5071057		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4929350_4930328_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 348
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4935248	4935782	5071057		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|4935248_4935782_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 349
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4939985	4941969	5071057		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|4939985_4941632_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4941675_4941969_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 350
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4956245	4959457	5071057	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_107236286.1|4956245_4957703_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	4.4e-47
WP_001295074.1|4957939_4959457_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 351
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4979020	4980523	5071057		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|4979020_4980523_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 352
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4985360	4986149	5071057		Pithovirus(100.0%)	1	NA	NA
WP_107236288.1|4985360_4986149_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	27.9	4.2e-12
>prophage 353
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4991708	4993390	5071057		Bacillus_virus(50.0%)	2	NA	NA
WP_001075536.1|4991708_4992467_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
WP_107236293.1|4992709_4993390_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 354
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	4999506	5005875	5071057		Staphylococcus_phage(50.0%)	5	NA	NA
WP_107236295.1|4999506_5001039_+	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.8e-20
WP_076795573.1|5001017_5001998_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001389715.1|5002008_5002704_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_107236296.1|5002687_5003617_+	allose kinase	NA	NA	NA	NA	NA
WP_076795575.1|5003889_5005875_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	4.2e-149
>prophage 355
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5011120	5013268	5071057		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|5011120_5013268_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 356
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5022552	5024511	5071057		Staphylococcus_phage(100.0%)	1	NA	NA
WP_107236302.1|5022552_5024511_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.7	8.7e-91
>prophage 357
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5030135	5031485	5071057		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|5030135_5031485_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 358
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5035301	5038915	5071057		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|5035301_5035838_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|5036092_5038915_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 359
NZ_CP028192	Escherichia coli strain CFSAN018748 chromosome, complete genome	5071057	5043122	5069783	5071057	integrase,tRNA,tail	Escherichia_phage(54.55%)	27	5038355:5038369	5060826:5060840
5038355:5038369	attL	TTCCTGCCGGATATC	NA	NA	NA	NA
WP_001147321.1|5043122_5044202_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|5044254_5045670_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001589538.1|5045752_5046736_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5046901_5047144_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543828.1|5047277_5048315_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332271.1|5048403_5049501_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_001217539.1|5049562_5049811_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_097310239.1|5049928_5050216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107236305.1|5050226_5050931_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.0e-57
WP_032239069.1|5050940_5051222_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
WP_107236306.1|5051221_5053594_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.7	2.5e-169
WP_107236307.1|5053652_5057051_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.7	0.0e+00
WP_159042842.1|5057111_5057744_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.1	1.2e-94
WP_107236309.1|5057680_5058418_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	3.7e-143
WP_053891241.1|5058472_5059393_-	antirepressor	NA	A5VW58	Enterobacteria_phage	90.8	2.6e-162
WP_001579610.1|5059465_5059633_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	79.2	1.6e-17
WP_032258060.1|5059756_5060131_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152612.1|5060147_5060846_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
5060826:5060840	attR	TTCCTGCCGGATATC	NA	NA	NA	NA
WP_000847332.1|5060845_5061175_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	5.6e-59
WP_107236114.1|5061171_5063721_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.6	0.0e+00
WP_107235848.1|5063713_5064148_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	2.2e-63
WP_000479153.1|5064129_5064552_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001405605.1|5064567_5065308_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	1.5e-131
WP_107235847.1|5065315_5065711_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	3.2e-69
WP_107236115.1|5065707_5066286_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.0e-79
WP_000753006.1|5066297_5066651_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_107236310.1|5068523_5069783_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	6.8e-222
>prophage 1
NZ_CP028194	Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence	48684	0	47172	48684	plate,terminase,tail,protease,portal,capsid,holin	Vibrio_phage(32.43%)	68	NA	NA
WP_000944895.1|1635_2637_+	hypothetical protein	NA	A0A067ZG47	Vibrio_phage	42.8	1.6e-69
WP_000998643.1|2639_3260_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	51.6	1.8e-29
WP_107236351.1|3256_3724_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016265986.1|3720_4041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174657.1|4037_5162_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	44.4	3.7e-86
WP_000763348.1|5154_5736_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	40.0	2.7e-16
WP_107236352.1|5766_7656_+|tail	phage tail protein	tail	O22004	Shigella_phage	82.9	3.2e-58
WP_107236353.1|7612_8080_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	98.1	3.9e-82
WP_107236354.1|8051_8654_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	3.3e-97
WP_107236355.1|8653_9082_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	74.1	2.3e-57
WP_107236356.1|9109_9640_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.5	1.5e-45
WP_107236357.1|9656_10217_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.4	4.1e-86
WP_107236358.1|10614_11451_+	RepA	NA	NA	NA	NA	NA
WP_000356589.1|12094_12382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424604.1|12405_12669_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	46.2	9.8e-14
WP_000269912.1|12913_13261_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001673379.1|13260_13560_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_021542820.1|13593_13878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000061763.1|14145_14526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148348.1|14589_14862_+	helix-turn-helix domain-containing protein	NA	A0A248SLB9	Klebsiella_phage	54.9	7.5e-09
WP_027662196.1|15497_16133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236360.1|16167_17310_-	hypothetical protein	NA	B0FED5	Escherichia_phage	89.2	1.0e-51
WP_000183351.1|17306_17498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157836022.1|17608_17803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000730008.1|18607_18856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000156167.1|18899_19553_-	ParA family protein	NA	A0A219YB79	Aeromonas_phage	32.5	9.2e-21
WP_000418975.1|19702_20077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839974.1|20169_20832_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000143878.1|21004_21499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080855625.1|21495_22011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000017467.1|22007_22241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089586989.1|22240_22645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001270825.1|22641_22974_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	39.8	2.9e-15
WP_001250512.1|22977_23355_+	hypothetical protein	NA	A0A2I7R3L8	Vibrio_phage	35.1	6.3e-06
WP_001041905.1|23525_24593_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000823235.1|24670_24952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004105278.1|24948_25314_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	55.9	3.1e-10
WP_001706266.1|25343_25502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236361.1|25498_26182_+	hypothetical protein	NA	Q71T76	Escherichia_phage	67.2	6.1e-84
WP_042094916.1|26184_26526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236366.1|26527_27211_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	87.4	6.1e-108
WP_001271967.1|27916_28312_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	82.3	6.1e-52
WP_000254764.1|28298_28595_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	63.7	2.3e-27
WP_024180651.1|28578_29124_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	84.0	3.0e-89
WP_000147213.1|29120_29399_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	53.9	4.0e-18
WP_000387271.1|30076_30664_+	hypothetical protein	NA	G9L699	Escherichia_phage	77.6	3.2e-81
WP_000867916.1|30775_31045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001222808.1|31044_31242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044326186.1|31316_31616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025667980.1|32041_32449_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_000160645.1|32740_33364_+	ParB N-terminal domain-containing protein	NA	A0A0E3JS81	Verrucomicrobia_phage	43.2	4.1e-34
WP_107236362.1|33363_34737_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001705017.1|34777_35473_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	33.8	1.3e-28
WP_001185429.1|36030_36621_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	58.5	1.6e-40
WP_001019009.1|36620_37172_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	29.4	1.7e-07
WP_042095056.1|37177_39034_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	62.7	8.5e-237
WP_001058287.1|39045_39285_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	52.0	6.8e-14
WP_001022885.1|39281_40856_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	65.7	1.2e-191
WP_107236363.1|40845_41913_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	46.2	7.4e-76
WP_001209256.1|41922_42306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001132883.1|42326_43370_+|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	47.9	8.8e-74
WP_032145258.1|43445_43763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083981.1|43762_44107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042095054.1|44103_44589_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	37.4	1.7e-16
WP_107236364.1|44589_44880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107236365.1|44879_46343_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	53.4	1.7e-144
WP_000070729.1|46359_46881_+|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	57.8	1.5e-50
WP_000450805.1|46890_47172_+	hypothetical protein	NA	A0A0C5AEP1	Bacteriophage	37.4	1.0e-05
