The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	15822	62725	5279647	tail,terminase,holin,integrase	Klebsiella_phage(22.73%)	57	5914:5929	60031:60046
5914:5929	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_022631464.1|15822_18024_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	38.0	4.4e-99
WP_022631468.1|18099_21174_-	kinase	NA	A0A286S259	Klebsiella_phage	96.7	0.0e+00
WP_022631469.1|21170_21551_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	2.4e-69
WP_022631470.1|21560_22043_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.2	1.1e-82
WP_004190622.1|22223_22688_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
WP_022631471.1|22687_25588_-|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	5.2e-100
WP_086621259.1|25679_26153_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	57.4	4.6e-22
WP_022631473.1|26266_26464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190637.1|26601_27084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631474.1|27137_28310_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004190640.1|28333_28726_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_008807839.1|28722_29274_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	7.8e-29
WP_004217344.1|29275_29659_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004190646.1|29645_29879_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004190649.1|29888_30143_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_008807837.1|30144_30540_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_124724672.1|30580_30853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631475.1|30861_31815_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	2.5e-131
WP_016946679.1|31825_32611_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_022631476.1|32695_33808_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.2	4.8e-110
WP_022631477.1|33791_35192_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	9.2e-127
WP_022631478.1|35191_36499_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	5.2e-148
WP_004218556.1|36476_37481_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004218558.1|38343_38589_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004190672.1|39547_39823_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004190674.1|39819_40164_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004184488.1|40160_40700_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_031281240.1|40696_40996_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_064159469.1|41609_42056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031281242.1|41961_42219_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	98.8	2.8e-42
WP_022631482.1|42372_43155_-	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	2.9e-114
WP_004190680.1|43151_43520_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
WP_031281243.1|43516_43813_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	1.7e-35
WP_022631485.1|44021_44621_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.9	1.7e-90
WP_022631486.1|44678_44900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631487.1|44977_45211_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	67.5	7.0e-24
WP_022631188.1|45813_46656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086538002.1|46645_47689_-	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_022631185.1|48171_48375_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	92.5	3.7e-29
WP_022631184.1|48371_48740_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	44.3	6.4e-11
WP_022631183.1|48747_49497_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	80.3	3.0e-116
WP_032408811.1|49499_50339_-	hypothetical protein	NA	Q8HA96	Salmonella_phage	53.1	2.3e-24
WP_022631181.1|50404_51199_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.3	6.3e-64
WP_022631179.1|51327_51864_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	69.5	4.4e-61
WP_071784508.1|51866_52130_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071784507.1|52226_52583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631177.1|52809_53118_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_022631176.1|53209_53308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107240781.1|53414_53606_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_022631175.1|53614_53770_+	DNA breaking-rejoining protein	NA	K7PGY4	Enterobacteria_phage	71.2	1.5e-14
WP_094313837.1|53907_57045_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	56.7	2.7e-291
WP_022631173.1|57057_58167_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
WP_022631172.1|58207_58447_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_004892753.1|58667_59855_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
WP_004151901.1|60031_60922_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
60031:60046	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|60921_61914_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|61915_62725_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 2
NZ_CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	181114	226785	5279647	portal,integrase,capsid,tail,tRNA,plate,head,terminase	Enterobacteria_phage(54.29%)	55	186338:186359	223047:223068
WP_004179374.1|181114_181615_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|181731_182178_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|182161_182953_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|183054_184239_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004179371.1|184270_184963_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|185108_185618_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|185604_185961_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004179368.1|185950_186190_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
186338:186359	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|186454_186706_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_020324077.1|186749_187889_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_020324084.1|188043_189216_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_004216461.1|189215_189731_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|189776_190094_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|190093_190252_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_020324072.1|190238_193214_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
WP_032408799.1|193229_193721_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_020324073.1|193965_195324_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_020324070.1|195477_196575_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324108.1|196574_196787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806131.1|196783_199810_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324110.1|199799_200723_-|plate	baseplate J-like protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020324083.1|200724_201075_-	lysozyme	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_009486481.1|201071_201659_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324118.1|201655_202291_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_020324102.1|202287_202755_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_157833084.1|202755_203091_-	peptidase	NA	B6SD31	Bacteriophage	33.3	4.3e-06
WP_020324098.1|203277_203823_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_020324103.1|203819_204104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107240783.1|204094_204295_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324071.1|204294_204810_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_020324091.1|204914_205781_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324085.1|205830_206865_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324109.1|206875_207715_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324092.1|207871_209599_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_044816202.1|209592_210654_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020324107.1|211130_211883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324074.1|212804_213812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324106.1|213804_215751_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_020324090.1|216008_218156_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324116.1|218193_219129_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_032408797.1|219361_219928_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324115.1|219924_220149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|220226_220490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324119.1|220505_220883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|220898_221117_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|221137_221416_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|221536_221836_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004216842.1|221951_222935_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004176549.1|223199_224213_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
223047:223068	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|224270_224372_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|224371_224446_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|224563_224689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|224748_225012_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_020324076.1|225142_225781_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_008807690.1|225870_226785_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 3
NZ_CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	506784	516247	5279647	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_020323882.1|506784_508506_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
WP_002898014.1|508550_509252_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|509605_509824_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|509943_512223_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|512253_512571_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|512896_513118_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|513194_515135_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|515131_516247_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 4
NZ_CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	4994911	5005798	5279647		Escherichia_phage(87.5%)	9	NA	NA
WP_004179756.1|4994911_4998019_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|4998073_4999339_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|4999369_5000458_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|5000544_5000805_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|5001102_5001963_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|5001983_5002745_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|5003005_5003908_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|5003919_5005185_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|5005177_5005798_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP028176	Klebsiella pneumoniae strain CFSAN054111 chromosome, complete genome	5279647	5200210	5259985	5279647	transposase,plate	Leptospira_phage(14.29%)	45	NA	NA
WP_004176418.1|5200210_5201296_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_020324625.1|5201259_5203014_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022631448.1|5203090_5203561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107240829.1|5204644_5206243_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_077253207.1|5206239_5209698_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_020324630.1|5209694_5210903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071531917.1|5211649_5212144_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_088426872.1|5212349_5213448_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	9.7e-47
WP_071579625.1|5213640_5214162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958252.1|5214341_5215109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806164.1|5215095_5217114_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_004176137.1|5217302_5218334_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_107240830.1|5218349_5218667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323827.1|5219061_5219337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190533.1|5219470_5220682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022631455.1|5220674_5223194_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	2.3e-19
WP_020323826.1|5223186_5225841_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	5.9e-98
WP_002902160.1|5226105_5226597_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_020323828.1|5226601_5228308_-	OmpA family protein	NA	NA	NA	NA	NA
WP_020323825.1|5228304_5228994_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032408743.1|5228990_5230331_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004892641.1|5230343_5231888_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004176434.1|5231930_5232422_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190556.1|5233063_5233630_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004183778.1|5233828_5235361_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	8.8e-22
WP_019705447.1|5235577_5236339_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	4.1e-20
WP_004176438.1|5236447_5237362_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004183775.1|5237663_5237852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907732.1|5237923_5238367_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004183770.1|5238386_5238725_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_004183769.1|5238714_5239929_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_020324874.1|5239937_5240837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324891.1|5240847_5242065_-	succinyl transferase OpgC	NA	NA	NA	NA	NA
WP_019704221.1|5242341_5244159_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004183757.1|5244155_5245487_+	DUF3131 domain-containing protein	NA	NA	NA	NA	NA
WP_004183756.1|5245483_5247031_+	DUF3131 domain-containing protein	NA	NA	NA	NA	NA
WP_020324883.1|5247015_5248410_+	DUF3131 domain-containing protein	NA	NA	NA	NA	NA
WP_020324881.1|5248406_5248841_+	globin	NA	NA	NA	NA	NA
WP_020324872.1|5248843_5251537_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-60
WP_020324880.1|5251526_5253725_+	glycoside hydrolase family 2	NA	NA	NA	NA	NA
WP_004152141.1|5253749_5254619_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	5.7e-50
WP_004179500.1|5254697_5255900_-	MFS transporter	NA	NA	NA	NA	NA
WP_004888562.1|5255972_5257109_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004152138.1|5257281_5258166_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004176137.1|5258953_5259985_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP028177	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence	116768	11440	23532	116768		Escherichia_phage(25.0%)	12	NA	NA
WP_004152355.1|11440_12142_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_040245863.1|12578_12809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152354.1|12869_13541_-	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_032414078.1|13543_14515_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152352.1|14746_15178_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152351.1|15177_16449_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152350.1|16849_17746_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152349.1|18067_19273_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152348.1|19269_20244_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152347.1|20620_20953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004227314.1|21177_21393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152345.1|21504_23532_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
>prophage 2
NZ_CP028177	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence	116768	28107	59697	116768	protease,integrase,transposase	Enterobacteria_phage(44.44%)	31	21749:21764	40284:40299
21749:21764	attL	ACAACACCTCTGAATA	NA	NA	NA	NA
WP_004152342.1|28107_29376_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|29495_29969_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004152340.1|31182_31965_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|31964_32297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152338.1|32303_32660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|32727_33057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|33084_33393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|33438_33645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016338373.1|34297_34528_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_107240835.1|34524_34941_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016338369.1|36517_37795_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_016338368.1|37784_39893_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.3	2.4e-38
WP_016338367.1|39892_40528_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
40284:40299	attR	TATTCAGAGGTGTTGT	NA	NA	NA	NA
WP_058650054.1|40635_40980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009310051.1|41546_41810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|41874_42579_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000113282.1|42590_43247_-	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001039466.1|43342_44527_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_001550555.1|44621_44912_+	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	40.6	4.8e-06
WP_000027057.1|45006_45867_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000971921.1|46687_48058_-|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000080861.1|48172_49309_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|49359_49605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|49610_49802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|50283_50826_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|50838_51699_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000027057.1|51880_52741_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001206315.1|54324_55113_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_063840280.1|55182_55737_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|55970_56528_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_011977771.1|56691_59697_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.5	0.0e+00
>prophage 1
NZ_CP028178	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_2, complete sequence	100222	5679	73583	100222	transposase	Salmonella_phage(21.43%)	60	NA	NA
WP_032413488.1|5679_8652_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001247892.1|8726_9017_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|9013_9415_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|9404_9761_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|10015_10330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194048.1|10756_11938_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000509966.1|12597_13203_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_000027057.1|13426_14287_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|14986_15811_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001206315.1|15870_16659_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_063840280.1|16728_17283_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|17516_18074_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000608644.1|18637_19900_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|20155_21031_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|21077_21410_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001516695.1|25671_26328_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|27107_28499_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|28535_29108_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|29244_29835_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014386410.1|30205_30985_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
WP_071905678.1|32171_33203_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004201164.1|33417_34230_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|34233_34599_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|34603_35242_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|35252_36284_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|36288_36618_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_020324562.1|36681_37386_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_153933072.1|37391_37538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016338366.1|37534_38146_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|38199_38481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|38653_38989_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_159041655.1|39935_40433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064357964.1|41141_41393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096807525.1|41404_41938_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.6	1.9e-19
WP_064357960.1|41983_44176_-	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_081042500.1|44177_45332_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_064357957.1|46799_47423_-	plasmid IncI1-type surface exclusion protein ExcA	NA	NA	NA	NA	NA
WP_064357955.1|47488_49633_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_064357954.1|49674_50256_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_099119324.1|50252_51449_-	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_064357949.1|54514_55078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440588.1|55121_55523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064357947.1|55578_56112_-	conjugal transfer protein TraQ	NA	NA	NA	NA	NA
WP_099119323.1|56121_56841_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_064357943.1|56847_58176_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_081042499.1|58179_59283_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_069217503.1|59293_59998_-	conjugal transfer protein TraM	NA	NA	NA	NA	NA
WP_064357942.1|60035_60389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064357941.1|60422_63638_-	hypothetical protein	NA	A0A088F8A2	Idiomarinaceae_phage	31.8	8.0e-17
WP_032440577.1|63655_63922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081042498.1|63918_65106_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
WP_064357938.1|65083_65902_-	type IV secretion system DotC family protein	NA	NA	NA	NA	NA
WP_099119326.1|65898_66327_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_064357937.1|66388_66868_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_032440573.1|67599_67827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032440572.1|68436_69279_+	response regulator	NA	NA	NA	NA	NA
WP_064357981.1|69338_70268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064357935.1|70260_70755_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064357933.1|70751_72446_+	response regulator	NA	A0A1V0SGX0	Hokovirus	26.4	2.1e-24
WP_064357932.1|72629_73583_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.5	2.5e-75
>prophage 2
NZ_CP028178	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_2, complete sequence	100222	86432	97668	100222	transposase,integrase	Stx2-converting_phage(30.0%)	11	86883:86895	98404:98416
WP_096807527.1|86432_87110_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	50.5	1.1e-21
86883:86895	attL	CGGCCGGGAACCG	NA	NA	NA	NA
WP_064357924.1|87795_88044_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	50.7	2.1e-10
WP_006796638.1|89487_89919_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_064357922.1|89918_91190_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	2.9e-151
WP_004098982.1|91601_92477_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_023280007.1|92769_93147_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	7.9e-57
WP_004114612.1|93143_93491_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_004181747.1|93540_95079_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.8	6.1e-273
WP_016946792.1|95508_96135_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.2e-40
WP_006788217.1|96254_96434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240356.1|96873_97668_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
98404:98416	attR	CGGCCGGGAACCG	NA	NA	NA	NA
>prophage 1
NZ_CP028179	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_3, complete sequence	38695	5604	15453	38695	transposase	Salmonella_phage(50.0%)	7	NA	NA
WP_004201235.1|5604_7074_-	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
WP_001749988.1|7830_8400_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_001067855.1|8856_9561_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001138070.1|9900_12867_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|12945_13950_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|14131_14308_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|14637_15453_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
>prophage 2
NZ_CP028179	Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_3, complete sequence	38695	19464	34858	38695	transposase,integrase	Escherichia_phage(50.0%)	17	23573:23586	35975:35988
WP_001067855.1|19464_20169_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071549088.1|20193_20706_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|20710_20917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|21298_22732_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|22765_23980_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
23573:23586	attL	AATATTTACTTCCT	NA	NA	NA	NA
WP_001389365.1|24240_25005_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|25147_25414_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|25634_26108_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|26263_27277_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|27336_28041_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_107240842.1|28147_28831_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.7	3.5e-79
WP_012600007.1|28912_29890_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|29886_31092_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|31506_31776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|32132_32999_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|33766_34024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|34081_34858_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
35975:35988	attR	AATATTTACTTCCT	NA	NA	NA	NA
