The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	0	46299	4815114	portal,terminase,plate,lysis,capsid,head,tail	Salmonella_phage(79.55%)	59	NA	NA
WP_095186535.1|534_2304_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_042096903.1|2347_3286_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.2	1.8e-33
WP_000188448.1|3373_3595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|3627_4137_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956184.1|4144_4345_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
WP_000963473.1|4308_4650_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001703803.1|4717_4951_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000752619.1|4950_5178_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_053903769.1|5174_6032_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.9e-159
WP_053903771.1|6028_8443_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
WP_001154431.1|8595_8784_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|8794_9028_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_103743454.1|9220_9556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085437309.1|10066_10888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107147817.1|10889_11645_+	hypothetical protein	NA	S5W9H2	Leptospira_phage	38.0	3.7e-05
WP_085437313.1|11663_12695_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	1.7e-170
WP_001098422.1|12694_14461_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_107147818.1|14603_15437_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	2.4e-122
WP_024238783.1|15453_16512_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_107147819.1|16515_17166_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.3	9.6e-111
WP_107147820.1|17261_17726_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868192.1|17725_17929_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000171568.1|17932_18148_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_080182549.1|18167_18641_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	2.2e-80
WP_000727867.1|18642_19020_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	1.1e-15
WP_107147821.1|19016_19445_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	2.4e-46
WP_001039927.1|19540_19972_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.9e-71
WP_000819109.1|19964_20411_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.8	6.9e-60
WP_107147822.1|20388_21549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993763.1|21625_22204_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177580.1|22200_22560_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000268309.1|22546_23455_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_001086820.1|23447_24053_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_107147823.1|24049_25465_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	1.2e-153
WP_107147824.1|25473_25869_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	56.1	6.0e-15
WP_085437549.1|25840_26278_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.6	3.8e-47
WP_072057766.1|26279_26666_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000905023.1|26696_27263_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_107147825.1|27405_28578_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
WP_001207660.1|28587_29103_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|29157_29460_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|29474_29594_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_107147826.1|29586_32664_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	0.0e+00
WP_000980387.1|32660_33146_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_001011800.1|33142_34243_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	1.2e-177
WP_000972391.1|34333_34552_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|34787_36473_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_107147827.1|36742_37120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|37149_37407_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|37566_37854_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|37837_38560_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|38620_39523_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|39610_40087_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126073.1|40437_41550_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|41644_42778_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|42787_43741_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061665.1|43737_44583_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|44642_45131_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149756.1|45171_46299_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
>prophage 2
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	49659	52397	4815114		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|49659_50388_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|50605_51121_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|51246_51570_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|51566_52397_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 3
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	55984	57703	4815114		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_107147828.1|55984_57703_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.9	2.3e-31
>prophage 4
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	67000	90685	4815114	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188144.1|67000_68947_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|69019_69244_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_032187272.1|69566_69887_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.3	5.9e-13
WP_000934041.1|69917_72194_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|72878_73097_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|73381_74086_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|74127_75849_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043598.1|75849_77616_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|77738_78704_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|79248_79743_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_032187273.1|79877_83867_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|84025_84637_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|84647_85991_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|86081_87374_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|87612_90057_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|90067_90685_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 5
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	96993	100208	4815114		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|96993_97734_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|97925_100208_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 6
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	104306	105395	4815114		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|104306_105395_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 7
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	110481	115022	4815114		Bacillus_phage(100.0%)	2	NA	NA
WP_000167336.1|110481_110766_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000551270.1|113273_115022_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 8
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	129727	140697	4815114	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|129727_130276_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|130302_130950_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|131171_132362_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|132546_133635_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|134237_135638_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|135806_137009_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|137274_139887_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|139929_140697_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 9
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	156617	158525	4815114		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|156617_158525_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 10
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	171124	173179	4815114		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|171124_173179_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 11
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	177412	178072	4815114	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|177412_178072_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 12
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	197718	210033	4815114		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|197718_197931_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|197941_198130_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|198104_198335_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|198324_198498_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|198546_199620_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001300633.1|199691_202436_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264933.1|202518_203547_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|203519_204212_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_107147835.1|204341_205514_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_096260557.1|205513_208060_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	9.0e-72
WP_000209868.1|208056_208656_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|208807_209113_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|209112_210033_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 13
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	214338	216613	4815114		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|214338_214512_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001338446.1|214769_216098_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	3.7e-234
WP_001028083.1|216118_216613_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 14
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	231251	232316	4815114		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|231251_232316_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 15
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	239135	241697	4815114	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409873.1|239135_240494_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_085947771.1|240534_241697_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 16
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	246930	247764	4815114		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|246930_247764_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 17
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	251899	252433	4815114		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|251899_252433_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 18
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	261741	262662	4815114		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|261741_262662_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 19
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	267322	267568	4815114		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|267322_267568_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 20
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	283451	284393	4815114		Brevibacillus_phage(100.0%)	1	NA	NA
WP_107147846.1|283451_284393_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 21
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	296750	297932	4815114		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|296750_297485_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|297695_297932_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 22
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	301204	302847	4815114		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|301204_301846_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|301842_302847_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 23
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	315153	315411	4815114		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|315153_315411_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 24
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	322699	326440	4815114		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|322699_323401_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|323400_324645_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|324673_325585_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|325600_326440_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 25
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	329697	331675	4815114		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|329697_330555_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|330538_331675_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 26
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	336696	386580	4815114	tRNA,terminase,integrase,portal,plate,protease,capsid,head,holin,tail	Shigella_phage(51.92%)	63	328773:328788	371279:371294
328773:328788	attL	GAACTGTTCAAGCAGT	NA	NA	NA	NA
WP_000423742.1|336696_338067_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|338070_338712_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|338747_339854_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|339907_340369_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|340378_341032_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444485.1|341203_342454_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	1.1e-22
WP_080086261.1|342879_346521_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_080086259.1|346695_347823_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	61.3	1.7e-123
WP_071792162.1|347803_348049_-	excisionase	NA	NA	NA	NA	NA
WP_000016389.1|348542_348977_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549626.1|348948_349155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|349389_350064_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|350154_350355_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515830.1|350398_350950_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_071529388.1|351125_351305_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	3.0e-14
WP_107147850.1|351294_352236_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	98.7	1.6e-143
WP_072176118.1|352232_352727_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
WP_000210156.1|352726_353053_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_000767115.1|353049_353439_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_001061438.1|353458_354268_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_016230662.1|354275_355265_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.7	4.3e-195
WP_016159280.1|355282_355627_+	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	3.3e-54
WP_016159279.1|355619_356846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059274475.1|356842_357991_-	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	25.3	7.3e-13
WP_021537120.1|358253_358448_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	98.4	5.1e-28
WP_107147851.1|358597_359650_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	97.4	3.5e-203
WP_001120501.1|359727_360063_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_016159277.1|360066_360543_+	glycoside hydrolase family 104 protein	NA	U5P0A9	Shigella_phage	98.7	6.4e-88
WP_096145190.1|360526_360919_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	86.2	7.2e-53
WP_001379492.1|361381_361714_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_096145191.1|361764_362115_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.0	5.8e-62
WP_000929175.1|362240_362735_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_072011717.1|362968_364465_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000605606.1|364476_364659_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|364658_365900_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193633.1|365877_366528_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
WP_000257497.1|366542_367748_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.3	7.7e-223
WP_000601357.1|367797_367998_+	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	1.4e-25
WP_000927719.1|368000_368324_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_064674029.1|368320_368731_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	91.9	4.8e-68
WP_000224835.1|368705_369212_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_032223445.1|369208_369769_+	hypothetical protein	NA	S5FM61	Shigella_phage	98.4	1.2e-104
WP_000497751.1|369777_369948_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_089558416.1|369931_371428_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	4.5e-273
371279:371294	attR	GAACTGTTCAAGCAGT	NA	NA	NA	NA
WP_000090998.1|371427_371784_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661054.1|371783_372053_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_021519690.1|372194_374030_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	2.0e-307
WP_159038688.1|374090_375419_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	96.6	1.5e-240
WP_107147853.1|375415_376495_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.0e-206
WP_001259088.1|376494_377043_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000424732.1|377042_377468_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_107147854.1|377454_378513_+|plate	baseplate J/gp47 family protein	plate	S5FM68	Shigella_phage	98.6	2.8e-200
WP_000383567.1|378503_379088_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	2.7e-112
WP_107147855.1|379091_379748_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	67.4	8.8e-72
WP_107147856.1|379756_380152_+|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	45.7	3.5e-15
WP_107148151.1|380123_380561_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.6	1.1e-46
WP_032145339.1|380941_381169_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	81.2	1.9e-13
WP_001526918.1|381202_383092_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000943927.1|383934_384099_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|384201_384525_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|385060_385171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|385223_385628_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|385848_386580_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 27
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	394215	395304	4815114		Escherichia_phage(100.0%)	1	NA	NA
WP_071524883.1|394215_395304_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
>prophage 28
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	403837	405525	4815114		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|403837_404257_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|404256_405525_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 29
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	432194	434946	4815114		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|432194_433874_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|433998_434946_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 30
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	438082	442090	4815114		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|438082_439165_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|439164_439998_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|439994_440387_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|440390_441200_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|441235_442090_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 31
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	457450	467991	4815114		Escherichia_phage(25.0%)	10	NA	NA
WP_107147864.1|457450_458989_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|458985_459696_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|459695_460373_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555857.1|461628_462471_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|462520_462979_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|463091_463997_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|464088_465102_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|465303_466212_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|466355_466769_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|467373_467991_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 32
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	477401	479416	4815114		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|477401_478415_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|478411_479416_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 33
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	491074	494032	4815114		Acinetobacter_phage(100.0%)	2	NA	NA
WP_021570766.1|491074_492433_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|492436_494032_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 34
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	501001	506293	4815114	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559286.1|501001_501760_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|501979_503029_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|503064_503316_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|503695_506293_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 35
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	511217	511808	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|511217_511808_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 36
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	519624	525281	4815114		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|519624_521559_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_107147866.1|521626_522754_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|522897_523686_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|524053_524407_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|524474_525281_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 37
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	538196	539462	4815114		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|538196_539462_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 38
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	553466	554549	4815114		Planktothrix_phage(100.0%)	1	NA	NA
WP_032187354.1|553466_554549_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 39
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	571168	571684	4815114		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|571168_571684_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 40
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	578010	604924	4815114	transposase,tRNA,integrase,tail	Escherichia_phage(55.17%)	33	578836:578850	607199:607213
WP_000628058.1|578010_579243_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
578836:578850	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000387388.1|579497_580481_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|580958_582332_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|582460_583396_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|583447_584683_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|584684_584900_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_032234345.1|584978_585188_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	3.0e-26
WP_001317028.1|585180_585375_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|585431_586241_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105124.1|586233_588834_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000632297.1|588935_589211_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|589285_589456_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|589455_589677_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001324055.1|590118_590607_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|590603_590759_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|590769_590949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|591191_591611_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|591690_591945_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|591941_592364_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|592441_593230_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788969.1|593236_593983_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	4.9e-111
WP_024250660.1|594005_594767_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.9	9.1e-121
WP_085947598.1|595124_596287_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001097895.1|596420_597878_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_107147870.1|598828_599074_+|tail	phage tail protein	tail	A0A222YXY8	Escherichia_phage	97.3	2.5e-32
WP_032234139.1|599102_599630_-|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	97.1	4.7e-92
WP_001171282.1|599633_600596_-	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001378636.1|600700_600895_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.3	2.3e-28
WP_000086518.1|601115_601706_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	2.8e-24
WP_000836772.1|602022_602256_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	4.1e-32
WP_120795384.1|602324_602438_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|603215_603650_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|603790_604924_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
607199:607213	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 41
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	609884	610874	4815114		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|609884_610874_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 42
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	641394	645297	4815114		Klosneuvirus(100.0%)	1	NA	NA
WP_107147875.1|641394_645297_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 43
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	649235	650184	4815114		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|649235_649766_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|650010_650184_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 44
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	661990	672164	4815114	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_000826416.1|661990_663199_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001326689.1|663238_664453_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|664505_665042_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303492.1|665114_667076_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|667167_667398_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|667619_667796_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|667841_668258_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760626.1|668336_669743_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|669987_671133_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|671150_672164_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 45
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	679296	681399	4815114		Salmonella_phage(100.0%)	1	NA	NA
WP_000689363.1|679296_681399_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 46
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	686305	688414	4815114		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103220.1|686305_688414_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
>prophage 47
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	700074	701619	4815114		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|700074_701619_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 48
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	708503	708794	4815114		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|708503_708794_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 49
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	714985	715270	4815114		Escherichia_phage(100.0%)	1	NA	NA
WP_000781370.1|714985_715270_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 50
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	719698	721604	4815114		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|719698_720625_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193547.1|720617_721604_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 51
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	728345	729728	4815114		Bacillus_virus(100.0%)	1	NA	NA
WP_032187376.1|728345_729728_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 52
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	734994	741930	4815114		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_107147879.1|734994_737790_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
WP_061103564.1|737834_740207_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628576.1|740244_741930_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 53
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	750759	846712	4815114	transposase,portal,terminase,integrase,lysis,capsid,head,tail	Escherichia_phage(30.65%)	109	737782:737798	843903:843919
737782:737798	attL	TATCTCCATGCGAAAAC	NA	NA	NA	NA
WP_085948316.1|750759_752032_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_001125439.1|754311_755634_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001301023.1|755633_755900_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_122988093.1|756122_756206_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	80.0	2.6e-05
WP_001222729.1|756705_757698_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172488.1|757709_758732_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000558527.1|759646_759937_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286597.1|759993_760752_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001351738.1|760755_761670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854633.1|761876_763328_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558029.1|763554_764973_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.9e-18
WP_001191027.1|765111_765471_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|765470_766397_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156615.1|766460_767849_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366501.1|767949_768831_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258600.1|768908_770024_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|770173_771364_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|771388_772054_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843414.1|772265_772700_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|772719_773103_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803657.1|773134_773353_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_062881609.1|773383_774283_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054183.1|774477_775665_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|775791_775887_+	protein MgtS	NA	NA	NA	NA	NA
WP_097428018.1|776105_776996_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671737.1|777250_777643_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024746.1|777918_778437_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000210373.1|778480_780526_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|780662_781409_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|781497_782184_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|782360_782564_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_107147881.1|782598_784059_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	7.3e-42
WP_000347482.1|784147_785431_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|786035_786149_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_107147882.1|786217_786451_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_032187390.1|786767_787358_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885587.1|787455_788031_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
WP_107147883.1|788030_791054_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_001230352.1|791118_791718_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_107147884.1|791784_795183_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	87.8	0.0e+00
WP_000090891.1|795243_795876_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_089587466.1|795812_796556_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152624.1|796561_797260_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000847331.1|797259_797589_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840337.1|797585_800165_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
WP_000459471.1|800157_800592_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	5.8e-64
WP_000479135.1|800573_800996_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.1	2.4e-70
WP_001543784.1|801011_801752_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_107147885.1|801759_802155_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	7.2e-69
WP_107147886.1|802151_802730_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	1.1e-78
WP_021514936.1|802741_803095_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	7.6e-62
WP_107147887.1|803106_803502_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	1.3e-54
WP_107147888.1|803543_804569_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	3.6e-189
WP_001299443.1|804624_804957_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123317.1|804966_806286_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	5.6e-235
WP_001345555.1|806266_807868_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|807864_808071_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|808067_809993_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453611.1|809967_810513_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|810901_811135_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|811192_811603_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|811754_811928_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|812099_812255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|812333_812399_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|812401_812590_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|812600_812813_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|813174_813672_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001515369.1|813668_814202_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_001515370.1|814257_814572_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	97.1	1.6e-50
WP_001515371.1|814576_814792_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	1.3e-32
WP_001146314.1|814982_815696_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085947598.1|816325_817487_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000780584.1|818515_819040_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|819195_819573_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_032187401.1|819590_820640_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	2.2e-112
WP_001515373.1|820641_820920_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_001463433.1|820986_821238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|821454_821610_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|821681_821969_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|821968_822208_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_072134164.1|822232_822538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|822740_823073_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589013.1|823509_824850_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|825027_825210_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001315552.1|826514_826871_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	6.3e-40
WP_001151262.1|826867_827290_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_073544560.1|827330_828296_-	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.5e-54
WP_000705355.1|828276_828798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|828781_829009_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|829090_829498_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379588.1|829666_829822_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171952.1|829981_830200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|830203_830368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|830767_830956_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|830952_831144_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001515375.1|831237_833709_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|833796_834033_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876979.1|834067_835348_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	8.6e-156
WP_021531328.1|835367_835478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598292.1|836938_837265_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|837399_837741_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|837775_838336_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|838338_839049_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|839156_839462_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041681.1|839660_842087_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001340362.1|842147_844571_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
843903:843919	attR	TATCTCCATGCGAAAAC	NA	NA	NA	NA
WP_000213028.1|844581_845199_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|845200_846055_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|846097_846712_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 54
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	875852	877664	4815114		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|875852_877664_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 55
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	897540	898815	4815114	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|897540_898815_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 56
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	905726	907225	4815114		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|905726_906248_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|906328_907225_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 57
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	916027	924908	4815114		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|916027_916843_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|916970_917552_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|917786_918956_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|919121_919211_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|919509_920535_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|920531_921464_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|921576_922788_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|923078_924227_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|924266_924908_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 58
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	930412	932679	4815114		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587525.1|930412_931225_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|931228_932014_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|932010_932679_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 59
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	940968	946052	4815114		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|940968_942189_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|942185_943457_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|943431_944178_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
WP_000089364.1|944187_945675_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|945683_946052_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 60
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	965473	985013	4815114	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000869246.1|965473_967120_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
WP_000069375.1|967176_969555_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|969887_970721_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|970877_971924_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|972055_972247_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175606.1|972250_973687_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001301292.1|973749_974463_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|974709_975174_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|975251_976001_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_061103841.1|976000_976552_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|976614_977595_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|977695_977995_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_107147893.1|977999_980387_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|980401_981385_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|981668_981713_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|981835_982192_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|982244_982442_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|982538_983081_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|983084_985013_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 61
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	996309	998571	4815114		Tupanvirus(100.0%)	1	NA	NA
WP_032187424.1|996309_998571_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 62
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1004900	1005728	4815114		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|1004900_1005728_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 63
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1013204	1014425	4815114		Klosneuvirus(100.0%)	1	NA	NA
WP_000081986.1|1013204_1014425_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 64
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1021189	1021843	4815114		Planktothrix_phage(100.0%)	1	NA	NA
WP_001300558.1|1021189_1021843_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 65
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1027440	1029402	4815114		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|1027440_1029402_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 66
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1034328	1039989	4815114		Tupanvirus(50.0%)	2	NA	NA
WP_001135066.1|1034328_1034970_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_032187550.1|1036491_1039989_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
>prophage 67
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1043079	1044352	4815114	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085948316.1|1043079_1044352_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 68
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1047506	1048487	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000723723.1|1047506_1048487_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 69
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1057297	1058152	4815114		Indivirus(100.0%)	1	NA	NA
WP_001186374.1|1057297_1058152_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 70
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1061470	1066047	4815114		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|1061470_1062754_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|1062900_1064376_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_107147897.1|1064556_1066047_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
>prophage 71
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1081925	1090031	4815114	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_097500421.1|1081925_1083611_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	2.0e-35
WP_000290576.1|1083815_1084397_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_032187432.1|1084436_1085132_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1085189_1087100_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1087231_1087576_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1087937_1088297_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1088416_1088596_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855022.1|1088669_1090031_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 72
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1093893	1095450	4815114		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1093893_1095450_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 73
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1101090	1101300	4815114		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1101090_1101300_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 74
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1106630	1108679	4815114		Moraxella_phage(100.0%)	1	NA	NA
WP_001055779.1|1106630_1108679_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
>prophage 75
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1116175	1120645	4815114		Escherichia_phage(33.33%)	7	NA	NA
WP_000812732.1|1116175_1116832_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	8.0e-57
WP_000976472.1|1117227_1117569_-	YebY family protein	NA	NA	NA	NA	NA
WP_107147900.1|1117581_1118454_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_107147901.1|1118457_1118832_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1118970_1119201_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_107147902.1|1119302_1119959_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944258.1|1119982_1120645_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 76
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1128701	1130177	4815114		Cyanophage(100.0%)	1	NA	NA
WP_000301719.1|1128701_1130177_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	3.7e-78
>prophage 77
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1134175	1141239	4815114		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|1134175_1135498_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1135513_1136446_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1136524_1137280_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|1137276_1138062_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1138208_1139219_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1139227_1139839_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|1139977_1140043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024932.1|1140113_1140716_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1140717_1141239_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 78
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1145257	1147308	4815114		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|1145257_1146076_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_032187439.1|1146128_1146524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019590.1|1146564_1147308_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 79
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1153924	1155658	4815114	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|1153924_1155658_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 80
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1160910	1166554	4815114		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1160910_1161300_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036361.1|1161314_1162364_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_032187443.1|1162366_1163227_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483239.1|1163245_1164847_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_032187445.1|1164892_1166554_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 81
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1176641	1178156	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|1176641_1178156_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 82
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1190148	1190901	4815114		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1190148_1190901_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 83
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1203122	1203791	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334608.1|1203122_1203791_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	7.3e-82
>prophage 84
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1217807	1230242	4815114		Bacillus_phage(28.57%)	12	NA	NA
WP_001564714.1|1217807_1219502_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_000009306.1|1219739_1219922_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_107147906.1|1220000_1220918_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001507517.1|1221090_1222011_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1221999_1222470_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_107147907.1|1222450_1223869_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
WP_000365561.1|1223935_1224631_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|1224670_1225036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824370.1|1225602_1226661_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
WP_000218214.1|1227253_1228105_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826787.1|1228212_1229571_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	6.6e-05
WP_001339045.1|1229570_1230242_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 85
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1233786	1237468	4815114	integrase	Escherichia_phage(33.33%)	4	1235964:1236023	1245158:1245237
WP_001079074.1|1233786_1234317_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_107148154.1|1235069_1235867_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1235964:1236023	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_000055688.1|1236205_1236736_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	6.8e-30
WP_089637206.1|1236829_1237468_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
1245158:1245237	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 86
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1247807	1250515	4815114	transposase,integrase	Stenotrophomonas_phage(33.33%)	3	1239256:1239270	1252632:1252646
1239256:1239270	attL	GATGATGGGCATCGC	NA	NA	NA	NA
WP_000055683.1|1247807_1248338_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	1.4e-30
WP_001292569.1|1248431_1249070_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
WP_085948316.1|1249242_1250515_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
1252632:1252646	attR	GATGATGGGCATCGC	NA	NA	NA	NA
>prophage 87
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1258132	1259299	4815114		Stx2-converting_phage(100.0%)	1	NA	NA
WP_032176408.1|1258132_1259299_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.7e-227
>prophage 88
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1266480	1267380	4815114		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1266480_1267380_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 89
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1274732	1277554	4815114		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704863.1|1274732_1275899_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
WP_053273174.1|1276147_1277554_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
>prophage 90
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1284372	1293028	4815114		Enterobacteria_phage(42.86%)	7	NA	NA
WP_052925274.1|1284372_1285464_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	64.4	1.9e-140
WP_052925276.1|1286712_1287267_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.3	1.7e-47
WP_052925277.1|1287275_1288151_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_053273168.1|1288208_1289108_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	9.7e-29
WP_053286085.1|1289107_1290193_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.0e-100
WP_052925279.1|1290565_1291459_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.0	7.9e-47
WP_107147914.1|1291633_1293028_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
>prophage 91
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1299125	1306095	4815114		Bacillus_phage(25.0%)	6	NA	NA
WP_029396032.1|1299125_1300496_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000079286.1|1300864_1302301_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	7.4e-47
WP_000699762.1|1302303_1303527_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479838.1|1303523_1304003_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|1304005_1304971_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|1304973_1306095_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 92
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1310339	1320815	4815114		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|1310339_1311179_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137129.1|1311356_1313519_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|1313521_1313965_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1313970_1315110_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001300971.1|1315768_1317352_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_029396028.1|1317625_1319479_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|1319500_1320082_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|1320173_1320815_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 93
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1325532	1326885	4815114		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_021570883.1|1325532_1326885_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
>prophage 94
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1340734	1347568	4815114	tRNA	Bacillus_phage(40.0%)	7	NA	NA
WP_000675150.1|1340734_1342138_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|1342134_1342857_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1343047_1343380_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476009.1|1343526_1344888_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	1.6e-216
WP_001318299.1|1345218_1345536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|1345941_1346841_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_000481293.1|1346914_1347568_-	HAD-IA family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	24.8	9.0e-08
>prophage 95
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1360532	1364089	4815114		Serratia_phage(50.0%)	4	NA	NA
WP_000846215.1|1360532_1361537_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	5.8e-14
WP_000011993.1|1361533_1362499_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1362472_1363219_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107147919.1|1363270_1364089_-	glycoside hydrolase family 25 protein	NA	I3VYU7	Thermoanaerobacterium_phage	34.0	6.6e-16
>prophage 96
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1374737	1376771	4815114	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350533.1|1374737_1376771_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 97
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1388402	1397844	4815114		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|1388402_1389539_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001423058.1|1389535_1391536_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001373589.1|1391660_1392122_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|1392162_1392633_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1392679_1393399_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1393395_1395081_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1395302_1396034_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1396093_1396201_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1396181_1396913_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_107147921.1|1396917_1397844_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.2	1.3e-23
>prophage 98
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1424198	1427984	4815114		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|1424198_1424867_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|1425124_1425961_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|1425992_1427984_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 99
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1432054	1432912	4815114		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|1432054_1432912_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 100
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1447459	1451760	4815114		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001491191.1|1447459_1448926_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	8.7e-43
WP_000198822.1|1449043_1450030_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001300998.1|1450068_1450782_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|1451193_1451760_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 101
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1457514	1465162	4815114		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|1457514_1459104_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|1459107_1459452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107147924.1|1459784_1460975_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	3.8e-20
WP_001234850.1|1461002_1461698_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578061.1|1461846_1463607_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_000494183.1|1463731_1464016_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|1464154_1465162_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 102
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1469362	1470636	4815114	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085948316.1|1469362_1470636_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 103
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1478372	1478990	4815114		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1478372_1478990_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 104
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1488446	1494251	4815114		Bacillus_phage(25.0%)	5	NA	NA
WP_000422188.1|1488446_1490090_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000885006.1|1490165_1490816_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_107147926.1|1490815_1491880_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
WP_000406085.1|1491953_1493009_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865600.1|1493120_1494251_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	1.1e-117
>prophage 105
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1498528	1503371	4815114		Hokovirus(50.0%)	2	NA	NA
WP_000876011.1|1498528_1501378_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559135.1|1501544_1503371_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 106
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1518294	1520922	4815114		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|1518294_1520922_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 107
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1526366	1532513	4815114		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|1526366_1528652_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|1528885_1530016_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|1530015_1530270_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|1530323_1530974_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779105.1|1531436_1532513_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 108
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1538405	1542916	4815114	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|1538405_1539305_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|1539317_1539503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|1539543_1540347_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001295288.1|1540364_1541654_-	MFS transporter	NA	NA	NA	NA	NA
WP_032187530.1|1541710_1542916_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	2.1e-26
>prophage 109
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1546519	1551523	4815114		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|1546519_1547122_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|1547429_1548569_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|1548572_1549541_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|1549540_1551523_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 110
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1585938	1589166	4815114		Salmonella_phage(50.0%)	3	NA	NA
WP_000813859.1|1585938_1586538_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|1586596_1588429_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|1588515_1589166_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 111
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1599725	1601586	4815114		Sodalis_phage(50.0%)	2	NA	NA
WP_000156149.1|1599725_1600616_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|1600812_1601586_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 112
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1605797	1607315	4815114		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|1605797_1607315_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 113
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1613791	1614928	4815114		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|1613791_1614928_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 114
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1623464	1624550	4815114		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|1623464_1624550_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 115
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1643775	1654336	4815114	transposase,integrase	Enterobacteria_phage(30.77%)	13	1641750:1641766	1658011:1658027
1641750:1641766	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|1643775_1644708_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_106485336.1|1645019_1646177_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	1.8e-221
WP_106485335.1|1646272_1647379_+	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	30.8	8.0e-41
WP_159038690.1|1647409_1649089_-	hypothetical protein	NA	Q716G1	Shigella_phage	44.3	5.3e-20
WP_107147936.1|1649063_1650238_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.5e-170
WP_085947771.1|1650296_1651459_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_107147937.1|1651533_1652046_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	79.8	3.4e-79
WP_071447822.1|1652047_1652239_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	4.7e-26
WP_107147938.1|1652241_1652985_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	51.5	1.8e-60
WP_107147939.1|1653169_1653397_+	hypothetical protein	NA	K7PKY3	Enterobacterial_phage	100.0	2.5e-34
WP_106485417.1|1653583_1653838_+	hypothetical protein	NA	A0A220IH78	Escherichia_phage	82.1	7.2e-06
WP_000545733.1|1653910_1654078_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_107147940.1|1654135_1654336_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	98.5	1.2e-32
1658011:1658027	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 116
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1662199	1669776	4815114		Bacillus_phage(50.0%)	4	NA	NA
WP_001355656.1|1662199_1665793_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_001296867.1|1665848_1666994_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|1667067_1668012_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283490.1|1668081_1669776_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 117
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1673470	1674391	4815114		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1673470_1674391_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 118
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1678208	1678943	4815114		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|1678208_1678943_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 119
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1704637	1717291	4815114		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|1704637_1706653_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|1706723_1707710_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|1707939_1708701_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|1708885_1709857_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|1710240_1710498_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|1710542_1712270_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|1712310_1712820_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|1712862_1713714_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|1713818_1714193_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000745534.1|1714225_1714960_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|1715148_1716060_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|1716193_1717291_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 120
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1720308	1721100	4815114		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|1720308_1721100_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 121
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1724578	1729698	4815114		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001327042.1|1724578_1725883_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|1726122_1727022_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|1727117_1727693_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|1727753_1728203_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|1728189_1728615_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102886.1|1728828_1729698_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 122
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1748451	1749402	4815114		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1748451_1749402_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 123
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1766690	1767404	4815114		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1766690_1767404_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 124
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1788655	1792657	4815114		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|1788655_1789945_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|1790030_1790657_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001336050.1|1790981_1792019_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028612.1|1792018_1792657_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 125
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1799092	1805387	4815114		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|1799092_1799266_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_159038691.1|1799579_1800095_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	3.8e-62
WP_000755173.1|1800110_1800650_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|1800742_1802320_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|1802388_1803855_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_107147947.1|1804016_1805387_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.8e-42
>prophage 126
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1814217	1814649	4815114		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1814217_1814649_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 127
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1824859	1831316	4815114		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133592.1|1824859_1826143_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|1826320_1826521_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|1826532_1826868_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|1826869_1828720_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|1828736_1829252_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|1829347_1829671_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|1829687_1830074_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|1830101_1831316_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 128
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1846452	1847964	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032176516.1|1846452_1847964_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.9e-13
>prophage 129
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1853856	1865146	4815114		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|1853856_1855110_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|1855437_1856628_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717691.1|1856672_1857011_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|1857071_1858406_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|1858395_1859109_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_024187693.1|1859273_1860701_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970117.1|1861258_1865146_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 130
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1869265	1869526	4815114		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1869265_1869526_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 131
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1872985	1876727	4815114		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|1872985_1873666_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|1873937_1874912_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|1874927_1876727_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 132
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1882498	1888757	4815114	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_107147952.1|1882498_1883833_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001300638.1|1884041_1884923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1885025_1885613_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1885668_1886052_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1886356_1887046_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|1887093_1888131_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1888337_1888757_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 133
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1894050	1895349	4815114		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|1894050_1895349_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 134
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1901215	1903789	4815114		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1901215_1903789_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 135
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1909695	1910766	4815114		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|1909695_1910766_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 136
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1914187	1989588	4815114	transposase,tRNA,integrase	Salmonella_phage(13.33%)	60	1930956:1930973	1981646:1981663
WP_000264777.1|1914187_1914955_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1914985_1915534_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1915552_1915801_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1916049_1917411_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1917577_1918369_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1918389_1919676_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|1919730_1920324_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|1920446_1921325_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|1921410_1923072_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1923220_1923562_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|1923623_1923914_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|1923903_1924380_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1924511_1924994_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_107148155.1|1925731_1930312_-	adhesin-like autotransporter YpjA/EhaD	NA	NA	NA	NA	NA
WP_072008015.1|1930376_1930496_-	ATPase	NA	NA	NA	NA	NA
WP_071524906.1|1930650_1930869_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
1930956:1930973	attL	TATTGCTGGGTAAGATCA	NA	NA	NA	NA
WP_001347906.1|1933888_1934173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290292.1|1934367_1935684_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.6	3.9e-34
WP_000268405.1|1935813_1936410_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	86.9	3.6e-96
WP_107147953.1|1936491_1938096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265817.1|1938874_1939102_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_107147954.1|1939164_1939911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428286.1|1940192_1940693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000628302.1|1941080_1941695_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_107147955.1|1941722_1942289_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_106424070.1|1942634_1943336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000657153.1|1943411_1943675_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_097594126.1|1944232_1945885_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	28.4	2.2e-39
WP_107147956.1|1945894_1946422_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_107147957.1|1946437_1955677_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	39.6	8.7e-56
WP_107147958.1|1955676_1956012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107147959.1|1957717_1958740_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	9.2e-201
WP_001300609.1|1958736_1959519_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
WP_000624723.1|1959930_1960281_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_107147960.1|1960277_1960703_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	97.9	1.7e-47
WP_113281736.1|1960879_1961284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000899683.1|1961373_1962462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086218821.1|1962461_1964252_-	restriction system-associated AAA family ATPase	NA	NA	NA	NA	NA
WP_000871034.1|1964248_1965802_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	21.5	1.4e-06
WP_107147961.1|1965798_1967463_-	type I restriction-modification system subunit M	NA	A0A1V0SLK8	Klosneuvirus	30.6	4.7e-29
WP_107147962.1|1967477_1970276_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_107147963.1|1970885_1971584_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000981778.1|1971573_1972068_+	DUF3158 family protein	NA	NA	NA	NA	NA
WP_001291903.1|1972755_1973172_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_000101250.1|1973292_1973757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088550861.1|1973749_1974358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336898.1|1974364_1975015_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_000168347.1|1974990_1975524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000683400.1|1975520_1975928_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_096925806.1|1977919_1978186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107147964.1|1978185_1978869_+	TIGR03747 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_085949196.1|1979511_1979850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001486381.1|1980061_1980346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|1980435_1981598_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_024167427.1|1982461_1982932_-	peptidase	NA	NA	NA	NA	NA
1981646:1981663	attR	TATTGCTGGGTAAGATCA	NA	NA	NA	NA
WP_000390952.1|1982918_1984688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000558641.1|1984687_1985986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286317.1|1985985_1987056_-	cGAMP-activated phospholipase CapV	NA	A0A1B2LRS3	Wolbachia_phage	31.6	1.7e-19
WP_097464767.1|1987987_1988413_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	78.4	3.0e-36
WP_107147965.1|1988616_1989588_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 137
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	1999642	2020821	4815114	integrase,portal,terminase,capsid,protease,head,tail	uncultured_Caudovirales_phage(61.54%)	29	2007220:2007268	2022392:2022440
WP_001255978.1|1999642_1999882_+	hypothetical protein	NA	A0A1B2IAG5	Erwinia_phage	47.5	2.0e-13
WP_107147971.1|1999900_2000383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234708.1|2000741_2001560_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	5.5e-47
WP_137432245.1|2001892_2002594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107147972.1|2002986_2003451_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.1	2.9e-13
WP_001186774.1|2003466_2003943_+	RadC family protein	NA	NA	NA	NA	NA
WP_107147973.1|2004011_2004614_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	33.3	4.5e-22
WP_063104706.1|2004663_2005032_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854744.1|2005121_2005499_+	toxin	NA	NA	NA	NA	NA
WP_107147974.1|2005495_2005984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772034.1|2005995_2006193_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000065753.1|2006277_2007123_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
2007220:2007268	attL	ATATGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
WP_080153494.1|2007448_2008870_+|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_107147975.1|2008866_2009667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094322896.1|2009808_2009997_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016231468.1|2010007_2010211_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.1e-16
WP_097346161.1|2010219_2010882_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_107147976.1|2010874_2011195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261487.1|2011201_2011501_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_107147977.1|2011497_2013621_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.2	1.5e-173
WP_016245660.1|2013832_2014255_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_016231462.1|2014272_2014521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107147978.1|2014795_2015965_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.5	3.5e-164
WP_000798773.1|2016019_2016580_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
WP_128391582.1|2016623_2017796_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	89.1	9.2e-205
WP_001287546.1|2017788_2018091_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_001145897.1|2018090_2018531_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_107147979.1|2018819_2019176_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.9	2.3e-50
WP_107147980.1|2019159_2020821_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.6	1.5e-277
2022392:2022440	attR	ATATGGTGGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAGT	NA	NA	NA	NA
>prophage 138
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2029367	2033419	4815114		Klosneuvirus(50.0%)	4	NA	NA
WP_001087611.1|2029367_2030648_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_001295173.1|2030885_2032286_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|2032306_2032969_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|2032969_2033419_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 139
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2037355	2042650	4815114		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2037355_2037601_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|2037597_2038008_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246527.1|2037980_2040125_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|2040134_2041094_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|2041447_2042650_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 140
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2055600	2060986	4815114	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2055600_2055786_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|2056020_2058651_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|2058778_2059279_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2059347_2060409_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|2060488_2060986_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 141
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2066452	2067418	4815114		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|2066452_2067418_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 142
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2074893	2075907	4815114		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300815.1|2074893_2075907_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	9.3e-28
>prophage 143
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2093732	2106915	4815114		Escherichia_phage(50.0%)	12	NA	NA
WP_001272898.1|2093732_2096294_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141322.1|2096399_2097056_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|2097106_2097874_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|2098069_2098978_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|2098974_2100237_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|2100233_2100872_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|2100876_2101653_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|2101741_2103106_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2103199_2104192_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2104254_2105394_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2105533_2106160_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2106153_2106915_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 144
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2110027	2112060	4815114		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|2110027_2110633_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|2110632_2112060_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 145
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2128200	2128986	4815114		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|2128200_2128986_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 146
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2134296	2139216	4815114		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|2134296_2134968_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288228.1|2135106_2135247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268460.1|2135260_2136133_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|2136192_2137491_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_107147987.1|2137578_2139216_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	2.3e-153
>prophage 147
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2143248	2147363	4815114		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_001556187.1|2143248_2144550_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.4	3.3e-38
WP_107147988.1|2144606_2147363_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 148
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2154898	2155747	4815114		Vibrio_phage(100.0%)	1	NA	NA
WP_000100417.1|2154898_2155747_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.7e-41
>prophage 149
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2160605	2161361	4815114		Bacillus_phage(100.0%)	1	NA	NA
WP_107147989.1|2160605_2161361_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	6.5e-10
>prophage 150
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2172888	2188436	4815114	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|2172888_2174094_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|2174093_2174537_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|2174587_2175394_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|2175632_2176730_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|2177308_2178562_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|2178793_2180125_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|2180186_2182013_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_107147990.1|2182012_2185555_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_063122421.1|2185547_2188436_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	2.6e-67
>prophage 151
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2193912	2200685	4815114		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2193912_2194707_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2194713_2195589_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|2195739_2197986_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2197998_2198529_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|2199213_2199903_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2199971_2200685_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 152
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2210315	2212810	4815114		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2210315_2211734_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|2212048_2212810_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 153
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2218764	2220037	4815114	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_107147993.1|2218764_2220037_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	8.0e-170
>prophage 154
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2228046	2229209	4815114	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947598.1|2228046_2229209_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 155
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2238935	2239691	4815114		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|2238935_2239691_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 156
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2246497	2254873	4815114	tRNA	Enterobacteria_phage(20.0%)	9	NA	NA
WP_001295374.1|2246497_2247946_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|2247947_2248073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2248069_2248141_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192790.1|2248195_2248744_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_001618837.1|2248786_2250304_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001701073.1|2250313_2251412_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_032187585.1|2251502_2253236_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	5.4e-60
WP_000715214.1|2253241_2253952_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2253976_2254873_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 157
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2258797	2263270	4815114		Pandoravirus(50.0%)	2	NA	NA
WP_001514525.1|2258797_2260231_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.4	3.0e-32
WP_004017789.1|2260396_2263270_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 158
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2271405	2272638	4815114		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2271405_2272638_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 159
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2300933	2302088	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2300933_2302088_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 160
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2355709	2356882	4815114		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|2355709_2356882_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 161
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2379093	2379978	4815114		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_032187622.1|2379093_2379978_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	4.8e-65
>prophage 162
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2386054	2395405	4815114		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|2386054_2386882_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|2387081_2388008_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|2388058_2388316_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|2388358_2390578_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|2390688_2392101_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|2392175_2392913_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|2393146_2395405_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 163
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2398715	2399108	4815114		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|2398715_2399108_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 164
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2402935	2413898	4815114		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|2402935_2404828_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|2404856_2405438_-	esterase YqiA	NA	NA	NA	NA	NA
WP_107148009.1|2405437_2406265_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|2406289_2406712_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|2406712_2407342_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|2407546_2409028_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|2409175_2409847_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|2409852_2411013_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_159038692.1|2411050_2411866_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|2411981_2412755_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|2412812_2412983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|2413244_2413898_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 165
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2423415	2424849	4815114		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2423415_2424849_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 166
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2429986	2456157	4815114	tRNA,terminase,portal,protease,capsid,head,tail	uncultured_Caudovirales_phage(61.54%)	28	NA	NA
WP_000708487.1|2429986_2431225_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
WP_001405697.1|2431405_2432227_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001295541.1|2432317_2432686_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272796.1|2432790_2433408_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000935209.1|2433420_2434353_-	DNA-binding transcriptional activator TtdR	NA	NA	NA	NA	NA
WP_000986797.1|2434559_2435471_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000722957.1|2435467_2436073_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000804973.1|2436120_2437584_+	anion permease	NA	NA	NA	NA	NA
WP_001264352.1|2437626_2438640_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|2438877_2439093_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|2439203_2440949_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|2441143_2442985_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|2443063_2443570_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_107147981.1|2445053_2445347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107147980.1|2445343_2447005_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.6	1.5e-277
WP_107147979.1|2446988_2447345_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.9	2.3e-50
WP_001145897.1|2447633_2448074_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001287546.1|2448073_2448376_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	1.4e-27
WP_128391582.1|2448368_2449541_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	89.1	9.2e-205
WP_000798773.1|2449584_2450145_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
WP_107147978.1|2450199_2451369_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.5	3.5e-164
WP_016231462.1|2451643_2451892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016245660.1|2451909_2452332_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_107147977.1|2452543_2454667_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	50.2	1.5e-173
WP_001261487.1|2454663_2454963_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_107147976.1|2454969_2455290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097346161.1|2455282_2455945_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_016231468.1|2455953_2456157_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.1e-16
>prophage 167
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2460824	2468994	4815114	tRNA	Salmonella_phage(33.33%)	5	NA	NA
WP_000094721.1|2460824_2462345_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000627220.1|2462651_2464142_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000450594.1|2464183_2464516_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|2464734_2465718_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082856.1|2465901_2468994_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 168
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2481849	2482815	4815114		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|2481849_2482815_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 169
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2503393	2505688	4815114		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|2503393_2505688_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 170
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2513892	2515038	4815114		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|2513892_2515038_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 171
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2539600	2547394	4815114		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|2539600_2540461_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249104.1|2540525_2542562_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246830.1|2542519_2542915_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|2542934_2543525_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|2543534_2544110_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|2544223_2545264_-	permease	NA	NA	NA	NA	NA
WP_001300423.1|2545336_2545972_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|2546099_2546618_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|2546597_2547041_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|2547091_2547394_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 172
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2553096	2554986	4815114		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|2553096_2554986_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 173
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2560467	2567106	4815114		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|2560467_2563140_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|2563164_2564652_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|2564679_2565132_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|2565762_2567106_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 174
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2571188	2574061	4815114	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|2571188_2572037_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|2572126_2574061_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 175
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2580835	2581807	4815114		Indivirus(100.0%)	1	NA	NA
WP_001047336.1|2580835_2581807_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 176
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2586381	2601176	4815114		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|2586381_2587191_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|2587400_2588378_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|2588391_2589378_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|2589398_2589965_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|2589961_2590537_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|2590505_2591063_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|2591069_2591795_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|2591842_2593276_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|2593298_2593586_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|2593703_2594195_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|2594240_2595095_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_032187633.1|2595091_2595364_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|2595577_2596210_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_107148014.1|2596206_2596935_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|2596931_2597585_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|2597814_2600151_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|2600246_2601176_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 177
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2613753	2618501	4815114		Salmonella_phage(50.0%)	5	NA	NA
WP_000445116.1|2613753_2614881_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|2614940_2615405_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_107148015.1|2615401_2616277_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|2616273_2616963_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|2617010_2618501_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 178
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2622205	2622703	4815114	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|2622205_2622703_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 179
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2626669	2629194	4815114	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_032187642.1|2626669_2628037_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	8.7e-21
WP_000497723.1|2628126_2629194_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 180
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2645970	2647014	4815114		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|2645970_2647014_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 181
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2657579	2658455	4815114		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_107148016.1|2657579_2658455_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	28.9	2.9e-22
>prophage 182
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2664959	2669113	4815114		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738568.1|2664959_2665985_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|2666052_2667234_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|2667243_2668347_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|2668354_2669113_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 183
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2679608	2681080	4815114	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|2679608_2680118_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|2680132_2681080_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 184
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2702295	2704248	4815114		Vibrio_phage(100.0%)	1	NA	NA
WP_032187645.1|2702295_2704248_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	7.0e-32
>prophage 185
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2713078	2721637	4815114		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_107148019.1|2713078_2715772_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	1.5e-40
WP_000031783.1|2716063_2717248_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_107148020.1|2717318_2719433_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|2719529_2720000_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|2720096_2720471_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|2720596_2720884_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|2720891_2721251_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|2721250_2721637_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 186
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2727207	2736748	4815114		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|2727207_2729121_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|2729120_2730143_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|2730136_2730355_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|2730408_2731278_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|2731332_2731737_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|2732038_2732671_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|2732721_2734812_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|2734878_2736099_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|2736184_2736748_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 187
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2760996	2761833	4815114		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|2760996_2761833_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 188
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2778737	2782504	4815114		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|2778737_2780360_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|2780435_2781788_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|2781784_2782504_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 189
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2789086	2789965	4815114		Sodalis_phage(100.0%)	1	NA	NA
WP_000039072.1|2789086_2789965_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	2.5e-69
>prophage 190
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2795999	2798393	4815114		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_001556281.1|2795999_2798393_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 191
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2802772	2803999	4815114		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|2802772_2803999_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 192
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2810053	2812501	4815114		Dickeya_phage(100.0%)	1	NA	NA
WP_000993440.1|2810053_2812501_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 193
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2832870	2834681	4815114		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073599.1|2832870_2833614_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
WP_000907792.1|2833610_2834681_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 194
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2838222	2839705	4815114		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|2838222_2838936_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|2838937_2839705_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 195
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2845439	2848258	4815114		Salicola_phage(50.0%)	3	NA	NA
WP_107148023.1|2845439_2846294_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	2.7e-44
WP_001042003.1|2846538_2847597_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|2847589_2848258_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 196
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2851264	2855396	4815114		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|2851264_2851891_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106551.1|2851964_2854163_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000130621.1|2854264_2854510_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|2854730_2855396_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 197
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2863289	2868941	4815114		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|2863289_2864096_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|2864101_2864503_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_107148024.1|2864705_2868941_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
>prophage 198
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2872316	2875052	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|2872316_2875052_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 199
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2888654	2890697	4815114		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|2888654_2890697_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 200
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2894042	2896177	4815114		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|2894042_2894396_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|2894449_2895739_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|2895751_2896177_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 201
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2899570	2900218	4815114		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|2899570_2900218_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 202
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2946179	2948164	4815114		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|2946179_2947184_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|2947180_2948164_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 203
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2958208	2960542	4815114		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|2958208_2960542_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 204
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2964196	2966196	4815114	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|2964196_2964409_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|2964595_2964748_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|2964827_2966196_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 205
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2970034	2971030	4815114		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|2970034_2971030_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 206
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2976348	2977890	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032187712.1|2976348_2977890_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 207
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	2994745	3004895	4815114	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582470.1|2994745_2996590_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|2996586_2997978_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2998075_2998684_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_001556307.1|2998912_3003046_+	RHS element protein RhsA	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.1e-25
WP_000072850.1|3003066_3003909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001346013.1|3004061_3004895_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 208
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3026816	3038806	4815114	transposase	Rhizobium_phage(14.29%)	10	NA	NA
WP_000024392.1|3026816_3027068_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|3027209_3027641_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_107148029.1|3027885_3029430_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|3029439_3030723_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483847.1|3030726_3031686_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982115.1|3031672_3032707_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646007.1|3032945_3033971_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|3033980_3035177_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_085947771.1|3035633_3036795_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000587764.1|3037873_3038806_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 209
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3053711	3058274	4815114		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|3053711_3054191_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114543.1|3054229_3055039_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3055136_3055304_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3055324_3055561_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001350561.1|3055777_3056446_-	RadC family protein	NA	NA	NA	NA	NA
WP_000050139.1|3056617_3057838_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001393518.1|3057818_3058274_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.2e-48
>prophage 210
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3061647	3068397	4815114		Morganella_phage(25.0%)	6	NA	NA
WP_001350563.1|3061647_3062472_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.9	1.0e-96
WP_000924289.1|3062762_3063380_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870036.1|3063376_3065059_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_001295237.1|3065316_3065940_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3065994_3066270_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|3066288_3068397_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 211
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3072833	3074225	4815114		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3072833_3074225_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 212
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3080504	3081722	4815114	integrase	Enterobacteria_phage(100.0%)	1	3072586:3072602	3096620:3096636
3072586:3072602	attL	ATACTCGTCATACTTCA	NA	NA	NA	NA
WP_107148033.1|3080504_3081722_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.7	5.0e-161
WP_107148033.1|3080504_3081722_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.7	5.0e-161
3096620:3096636	attR	TGAAGTATGACGAGTAT	NA	NA	NA	NA
>prophage 213
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3084764	3085885	4815114	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_107148035.1|3084764_3085885_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	2.3e-51
>prophage 214
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3088890	3098163	4815114		Escherichia_phage(33.33%)	5	NA	NA
WP_107148037.1|3088890_3090579_-	site-specific DNA-methyltransferase	NA	H6W8D6	Escherichia_phage	60.3	1.4e-153
WP_107148038.1|3092518_3095413_-	DEAD/DEAH box helicase family protein	NA	A0A2H4J643	uncultured_Caudovirales_phage	53.8	3.4e-285
WP_054113027.1|3095399_3095600_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107148039.1|3097246_3097672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107148040.1|3097923_3098163_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	44.4	5.2e-06
>prophage 215
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3101463	3103603	4815114	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_085948316.1|3101463_3102737_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_107148045.1|3102820_3103603_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.9	7.1e-44
>prophage 216
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3112127	3113462	4815114		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|3112127_3113462_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 217
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3120766	3129786	4815114		Ostreococcus_lucimarinus_virus(25.0%)	10	NA	NA
WP_021570996.1|3120766_3122455_-	acetolactate synthase large subunit	NA	G9E4W7	Ostreococcus_lucimarinus_virus	28.0	5.9e-19
WP_001312198.1|3122560_3122659_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|3123222_3123312_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|3123591_3124776_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|3124783_3125281_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3125277_3125640_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3125629_3125977_-	YidH family protein	NA	NA	NA	NA	NA
WP_107148050.1|3126084_3126534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061103782.1|3126580_3128074_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_001087145.1|3128070_3129786_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 218
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3136138	3137092	4815114		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|3136138_3136567_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3136678_3137092_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 219
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3141519	3142668	4815114		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3141519_3142668_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 220
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3147374	3154743	4815114		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3147374_3149789_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|3149817_3150891_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3150890_3151991_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3151995_3153399_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|3153695_3153776_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|3154005_3154146_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3154162_3154522_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3154485_3154743_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 221
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3164941	3166279	4815114		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|3164941_3166279_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 222
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3177264	3184872	4815114		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|3177264_3178038_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251998.1|3178220_3179111_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3179110_3180070_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3180156_3181197_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|3181510_3183340_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_021516599.1|3183501_3184872_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 223
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3196826	3197819	4815114		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845113.1|3196826_3197819_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 224
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3200987	3206840	4815114		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3200987_3202856_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001301979.1|3203022_3203442_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|3203449_3204955_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3204959_3205925_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3205949_3206840_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 225
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3220232	3221879	4815114		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012608.1|3220232_3221879_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 226
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3230311	3235723	4815114		Bacillus_phage(33.33%)	4	NA	NA
WP_001238890.1|3230311_3232333_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_000535975.1|3232379_3233864_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3233997_3235263_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3235393_3235723_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 227
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3239765	3245909	4815114		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|3239765_3240896_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|3240892_3242155_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226602.1|3242154_3243222_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.0e-101
WP_000676056.1|3243240_3244122_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|3244099_3244774_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|3244778_3245909_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 228
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3253993	3255649	4815114		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032187741.1|3253993_3255649_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.5	3.0e-44
>prophage 229
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3265958	3269817	4815114		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3265958_3266855_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3266854_3267571_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|3267654_3269817_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 230
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3275535	3277365	4815114		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3275535_3277365_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 231
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3289897	3293184	4815114		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|3289897_3291538_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001351992.1|3291616_3291886_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|3291889_3292405_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3292407_3293184_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 232
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3302065	3302680	4815114		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|3302065_3302680_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 233
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3316537	3319324	4815114		uncultured_virus(100.0%)	1	NA	NA
WP_000250007.1|3316537_3319324_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	2.2e-71
>prophage 234
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3323347	3325818	4815114		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|3323347_3324757_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3324768_3325818_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 235
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3333662	3423439	4815114	transposase,tRNA,portal,integrase,terminase,plate,lysis,capsid,protease,head,tail,holin	Escherichia_phage(40.82%)	98	3376673:3376719	3407497:3407543
WP_085948316.1|3333662_3334935_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_001279695.1|3335176_3336580_-	MFS transporter	NA	NA	NA	NA	NA
WP_000018367.1|3336619_3338005_-	MFS transporter	NA	NA	NA	NA	NA
WP_107148058.1|3338050_3339916_-	sulfoquinovosidase	NA	NA	NA	NA	NA
WP_000870913.1|3341212_3342454_-	sulfoquinovose isomerase	NA	NA	NA	NA	NA
WP_107148059.1|3342469_3343348_-	sulfofructosephosphate aldolase	NA	NA	NA	NA	NA
WP_000718901.1|3343371_3344268_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621647.1|3344435_3345332_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3345365_3346151_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_001308174.1|3346249_3346849_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_000920762.1|3346842_3347715_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_000560983.1|3347711_3348149_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|3348193_3349135_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|3349987_3350206_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|3350423_3350666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107148060.1|3350995_3351925_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|3351921_3352557_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|3352553_3353456_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077249888.1|3353468_3356519_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753617.1|3356712_3357546_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_107148061.1|3357698_3358754_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931298.1|3358803_3360552_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019484.1|3360551_3361622_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446023.1|3361611_3363063_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|3363073_3363520_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619493.1|3363820_3364135_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_107148062.1|3364144_3364969_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001556342.1|3365051_3366311_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144072.1|3366307_3367777_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217139.1|3368064_3368901_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|3368884_3369823_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063495.1|3369819_3370854_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|3371138_3371759_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001411955.1|3372018_3373002_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001514703.1|3373150_3373825_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580424.1|3373930_3375304_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
WP_001033722.1|3375300_3375999_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|3376148_3376649_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3376673:3376719	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023385.1|3376834_3377815_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001192859.1|3377884_3378178_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	99.0	8.8e-48
WP_000453534.1|3378330_3378603_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|3378772_3379273_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3379336_3379561_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277891.1|3379560_3379860_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_001113273.1|3379862_3380087_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	6.5e-35
WP_000027672.1|3380083_3380359_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	98.9	8.6e-45
WP_000382628.1|3380348_3382646_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.0	0.0e+00
WP_001697730.1|3382732_3383755_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.0	5.5e-113
WP_000373633.1|3383784_3384465_-	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	31.7	9.9e-18
WP_000351260.1|3384466_3385609_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	42.9	1.6e-73
WP_000038188.1|3385982_3387017_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000156872.1|3387016_3388789_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|3388962_3389817_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_107148063.1|3389875_3390949_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	1.9e-201
WP_107148064.1|3390952_3391696_+|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.2	3.5e-125
WP_000988636.1|3391795_3392305_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846409.1|3392304_3392508_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|3392511_3392793_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|3392792_3393290_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_023568551.1|3393304_3393730_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	97.9	8.6e-60
WP_021541103.1|3393717_3394143_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	97.2	2.1e-66
WP_001440152.1|3394114_3394288_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_023565543.1|3394250_3394718_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	1.1e-81
WP_001001795.1|3394710_3395163_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.1e-76
WP_023241483.1|3395229_3395865_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	3.4e-113
WP_000127170.1|3395861_3396209_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	1.9e-57
WP_016239048.1|3396213_3397122_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	3.4e-162
WP_001285341.1|3397114_3397726_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.9e-117
WP_064669696.1|3398935_3399421_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	36.4	9.6e-15
WP_159038693.1|3399392_3399494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094321557.1|3399754_3399943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001286716.1|3400278_3401469_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|3401481_3402000_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|3402056_3402332_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3402364_3402484_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_107148065.1|3402476_3404924_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.7	0.0e+00
WP_000978889.1|3404938_3405418_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882966.1|3405417_3406581_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000468308.1|3406662_3406881_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_021544286.1|3406932_3407334_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	60.0	1.1e-40
WP_001076742.1|3407621_3408524_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3407497:3407543	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|3408704_3409667_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|3409985_3410975_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001514749.1|3411081_3411837_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|3411891_3412659_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|3412766_3413366_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|3413466_3413907_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655989.1|3414118_3414418_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|3414444_3414873_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796332.1|3414877_3415624_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|3415720_3416731_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|3416865_3418374_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|3418396_3419242_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3419666_3419912_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3419996_3420482_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|3420574_3421501_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|3421567_3422899_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|3422908_3423439_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 236
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3440197	3447443	4815114		Synechococcus_phage(33.33%)	4	NA	NA
WP_000424840.1|3440197_3440860_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_107148067.1|3440871_3443373_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000161265.1|3444774_3445095_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_107148068.1|3445145_3447443_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 237
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3464789	3466634	4815114		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|3464789_3466634_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 238
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3475140	3478193	4815114		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|3475140_3476091_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|3477008_3478193_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 239
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3482309	3490638	4815114		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|3482309_3486338_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|3486414_3490638_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 240
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3499855	3501619	4815114		Klosneuvirus(50.0%)	3	NA	NA
WP_032187648.1|3499855_3500527_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.2	2.8e-20
WP_000940106.1|3500569_3501160_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|3501346_3501619_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 241
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3507008	3508598	4815114		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|3507008_3508598_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 242
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3524991	3528675	4815114		Dickeya_phage(100.0%)	1	NA	NA
WP_107148071.1|3524991_3528675_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 243
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3547947	3549063	4815114		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3547947_3549063_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 244
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3558278	3558887	4815114		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3558278_3558887_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 245
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3565477	3568025	4815114		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|3565477_3566893_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|3566945_3568025_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 246
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3572212	3575825	4815114		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_107148072.1|3572212_3575035_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|3575288_3575825_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 247
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3579642	3580992	4815114		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3579642_3580992_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 248
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3586577	3588536	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|3586577_3588536_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 249
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3598271	3600419	4815114		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3598271_3600419_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 250
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3605664	3612033	4815114		Tetraselmis_virus(50.0%)	5	NA	NA
WP_107148077.1|3605664_3607650_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.8	1.9e-149
WP_107148078.1|3607922_3608852_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|3608835_3609531_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|3609541_3610522_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235257.1|3610500_3612033_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.8e-20
>prophage 251
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3618267	3619817	4815114		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_107148079.1|3618267_3618948_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.5	4.3e-05
WP_001075518.1|3619058_3619817_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-16
>prophage 252
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3625421	3626210	4815114		Cedratvirus(100.0%)	1	NA	NA
WP_001193408.1|3625421_3626210_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 253
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3631434	3632937	4815114		Burkholderia_virus(100.0%)	1	NA	NA
WP_001351884.1|3631434_3632937_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.8e-56
>prophage 254
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3654133	3657345	4815114	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|3654133_3655651_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|3655887_3657345_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 255
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3666949	3669105	4815114		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692309.1|3666949_3667171_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001366855.1|3667233_3667710_-	RadC family protein	NA	NA	NA	NA	NA
WP_000844100.1|3667725_3668205_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001175148.1|3668286_3669105_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	2.5e-47
>prophage 256
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3678550	3679764	4815114	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_089613743.1|3678550_3679764_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	3.4e-101
>prophage 257
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3694708	3763901	4815114	transposase,integrase,protease,tRNA	Enterobacteria_phage(17.65%)	64	3708751:3708766	3723979:3723994
WP_077632214.1|3694708_3695185_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_107148082.1|3695288_3696502_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.3	2.7e-167
WP_001309734.1|3697403_3697838_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	1.5e-19
WP_000624688.1|3697834_3698185_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	6.2e-40
WP_000080172.1|3698215_3699829_+|transposase	IS66-like element ISEc43 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	8.3e-172
WP_012311738.1|3700076_3700277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001342709.1|3700366_3700753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774671.1|3700810_3701845_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	42.2	6.7e-66
WP_000350135.1|3701880_3702720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032155801.1|3702722_3703280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000718842.1|3703276_3706513_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_000991122.1|3706512_3707799_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001053122.1|3707798_3709778_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.6	8.4e-33
3708751:3708766	attL	CCATTTTCCGGCGTTT	NA	NA	NA	NA
WP_000648433.1|3709845_3710343_-	addiction module antitoxin	NA	NA	NA	NA	NA
WP_000019340.1|3711329_3711497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001385633.1|3711734_3712481_+	porin family protein	NA	NA	NA	NA	NA
WP_021547790.1|3712655_3714158_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000999868.1|3714517_3715561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107148084.1|3715993_3717184_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	5.8e-122
WP_001188520.1|3717542_3718118_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068922.1|3718154_3719852_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|3719827_3720166_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|3720281_3721583_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|3721700_3723137_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|3723473_3723950_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|3723965_3725222_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
3723979:3723994	attR	CCATTTTCCGGCGTTT	NA	NA	NA	NA
WP_001026276.1|3725497_3725791_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|3725834_3727481_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|3727618_3727972_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008049.1|3728164_3729034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940526.1|3729428_3730457_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|3730498_3731065_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|3731116_3731242_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|3731352_3731499_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|3731680_3731998_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238369.1|3731994_3732528_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001300820.1|3732616_3733750_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|3733812_3734172_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|3734182_3734578_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|3734588_3735323_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192984.1|3735315_3737124_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|3737448_3738426_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001336293.1|3738644_3740147_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|3740198_3740513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|3740509_3740824_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236847.1|3740852_3744176_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|3744197_3745166_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_107148085.1|3745262_3746315_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|3746409_3746955_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|3747697_3747751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|3747733_3748873_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001351889.1|3748871_3750419_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_107148086.1|3750390_3750852_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000640382.1|3750870_3752208_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|3752217_3754065_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|3754057_3755008_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|3755093_3755402_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|3755477_3756758_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|3756843_3758103_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3758105_3759110_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3759191_3759389_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3759492_3760791_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3760995_3761421_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|3761459_3763901_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 258
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3767833	3768997	4815114		Ralstonia_phage(100.0%)	1	NA	NA
WP_107148089.1|3767833_3768997_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.1e-80
>prophage 259
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3809021	3815509	4815114		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|3809021_3809552_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|3809861_3810818_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|3810957_3812460_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001351895.1|3812473_3813496_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|3813482_3814478_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3814510_3815509_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 260
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3819824	3822585	4815114		Vibrio_phage(100.0%)	2	NA	NA
WP_001106226.1|3819824_3820289_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|3820446_3822585_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 261
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3826223	3832320	4815114		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|3826223_3827171_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|3827355_3827409_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|3827549_3830246_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|3830451_3830838_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|3830910_3831372_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|3831384_3832320_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 262
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3840722	3851105	4815114	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_000416407.1|3840722_3843578_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|3843577_3844021_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|3844374_3845886_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_107148095.1|3846152_3847253_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|3847252_3848335_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294550.1|3848453_3849956_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
WP_107148096.1|3850085_3851105_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	2.2e-45
>prophage 263
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3855849	3864206	4815114	transposase	Acinetobacter_phage(25.0%)	5	NA	NA
WP_107148098.1|3855849_3857012_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.2e-50
WP_089541817.1|3857672_3858900_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_032301457.1|3859097_3860654_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.9e-105
WP_032224157.1|3860959_3861793_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_032224160.1|3862151_3864206_+	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	31.0	1.4e-27
>prophage 264
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3867242	3868223	4815114	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_021571040.1|3867242_3868223_-|transposase	transposase	transposase	H6WZJ9	Escherichia_phage	55.4	1.6e-101
>prophage 265
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3871586	3873263	4815114		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3871586_3872189_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3872666_3873263_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 266
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3882389	3883850	4815114		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208222.1|3882389_3883850_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	2.8e-49
>prophage 267
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3890417	3890972	4815114		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151863.1|3890417_3890972_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
>prophage 268
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3898473	3899430	4815114	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_021571043.1|3898473_3899430_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	1.0e-60
>prophage 269
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3917823	3919479	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919549.1|3917823_3919479_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.4	2.1e-13
>prophage 270
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3930092	3931372	4815114		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3930092_3930830_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|3930832_3931372_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 271
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3939303	3942179	4815114		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|3939303_3940893_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3941285_3941891_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3942017_3942179_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 272
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3948218	3949541	4815114		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|3948218_3949541_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 273
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3956284	3961639	4815114		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093813.1|3956284_3957517_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046749.1|3957823_3959491_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409442.1|3959701_3961639_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 274
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3964922	3965612	4815114		Bacillus_phage(100.0%)	1	NA	NA
WP_001188664.1|3964922_3965612_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
>prophage 275
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3978802	3989997	4815114	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130189.1|3978802_3979756_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|3979870_3980458_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3980492_3981059_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|3981207_3981921_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|3981946_3982351_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3982727_3984644_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3984732_3985863_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_107148105.1|3986125_3987238_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001181672.1|3987315_3987525_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_107148106.1|3988830_3989997_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 276
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	3997028	3999845	4815114	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286865.1|3997028_3999845_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 277
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4004288	4005437	4815114		Halovirus(100.0%)	1	NA	NA
WP_001351917.1|4004288_4005437_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 278
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4011031	4016692	4815114		Staphylococcus_phage(50.0%)	4	NA	NA
WP_107148107.1|4011031_4012585_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	3.5e-34
WP_000349924.1|4012658_4013876_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347139.1|4014004_4015147_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|4015177_4016692_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 279
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4021971	4027321	4815114	transposase	Shigella_phage(33.33%)	5	NA	NA
WP_085948316.1|4021971_4023245_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000600725.1|4023344_4023875_+	glutathione-regulated potassium-efflux system oxidoreductase KefF	NA	NA	NA	NA	NA
WP_021570591.1|4023867_4025730_+	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
WP_000624375.1|4025921_4026401_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|4026478_4027321_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 280
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4036457	4041880	4815114		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|4036457_4039364_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035670.1|4039528_4041880_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 281
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4048328	4049027	4815114		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|4048328_4049027_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 282
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4061730	4063455	4815114		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|4061730_4063455_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 283
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4089660	4090704	4815114		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217349.1|4089660_4090704_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	4.8e-104
>prophage 284
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4094949	4095501	4815114		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|4094949_4095501_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 285
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4106630	4108055	4815114		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4106630_4108055_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 286
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4115800	4122423	4815114		Mamastrovirus(33.33%)	5	NA	NA
WP_001189613.1|4115800_4117351_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.1e-18
WP_001297052.1|4117552_4119943_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4120148_4120685_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4120725_4121388_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|4121496_4122423_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 287
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4125685	4126582	4815114		Sodalis_phage(100.0%)	1	NA	NA
WP_000339958.1|4125685_4126582_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	50.2	2.8e-60
>prophage 288
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4138230	4145036	4815114	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|4138230_4139649_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937417.1|4139687_4140614_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4140650_4141106_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396039.1|4141283_4141988_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294678.1|4142002_4142533_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_024184635.1|4142606_4145036_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
>prophage 289
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4150168	4150966	4815114		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4150168_4150966_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 290
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4156877	4157222	4815114		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4156877_4157222_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 291
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4161151	4162576	4815114	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|4161151_4162576_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 292
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4174317	4175076	4815114		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4174317_4175076_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 293
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4183904	4188020	4815114		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569421.1|4183904_4184501_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	6.7e-26
WP_001294737.1|4184537_4188020_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	8.2e-209
>prophage 294
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4201024	4202056	4815114		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4201024_4202056_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 295
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4208576	4216428	4815114		Indivirus(25.0%)	8	NA	NA
WP_107148116.1|4208576_4209380_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_107148117.1|4209376_4210291_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4210531_4211332_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|4212226_4213585_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_107148118.1|4213656_4214412_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001307587.1|4214445_4215168_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4215164_4215632_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_024184597.1|4215696_4216428_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	1.7e-39
>prophage 296
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4219709	4220573	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000011498.1|4219709_4220573_+	DUF3990 domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	51.4	4.1e-24
>prophage 297
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4225748	4229667	4815114		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|4225748_4226327_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|4226532_4227300_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|4227270_4228011_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615980.1|4228166_4228445_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729707.1|4228447_4228708_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543885.1|4228893_4229667_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
>prophage 298
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4239551	4249076	4815114		Streptococcus_phage(40.0%)	13	NA	NA
WP_000749863.1|4239551_4240607_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|4240894_4241998_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|4242009_4243263_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000854680.1|4243834_4244176_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070396.1|4244196_4244514_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|4244532_4244754_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|4244762_4245239_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|4245254_4245713_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_001385283.1|4246126_4246594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649865.1|4246616_4247060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144031.1|4247059_4247296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047649085.1|4247336_4248038_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_023565123.1|4248254_4249076_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.8e-45
>prophage 299
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4254640	4255687	4815114		Bacillus_virus(100.0%)	1	NA	NA
WP_047649078.1|4254640_4255687_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	4.4e-33
>prophage 300
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4264436	4264739	4815114	transposase	Stx2-converting_phage(100.0%)	1	NA	NA
WP_097330448.1|4264436_4264739_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	97.9	5.3e-48
>prophage 301
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4267896	4269222	4815114		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|4267896_4269222_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 302
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4274797	4280717	4815114	holin	Catovirus(50.0%)	4	NA	NA
WP_001159094.1|4274797_4276468_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|4276481_4277954_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|4277967_4278555_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|4278683_4280717_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 303
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4290583	4292470	4815114		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032187176.1|4290583_4292470_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	4.1e-53
>prophage 304
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4295667	4296567	4815114		Lactobacillus_phage(100.0%)	1	NA	NA
WP_107148121.1|4295667_4296567_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 305
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4301107	4305387	4815114		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177906.1|4301107_4304182_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	100.0	0.0e+00
WP_000805902.1|4304304_4305387_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 306
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4310797	4312758	4815114		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|4310797_4311748_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|4311744_4312758_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 307
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4316237	4317347	4815114		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|4316237_4317347_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 308
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4322645	4323413	4815114		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939399.1|4322645_4323413_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 309
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4326929	4328203	4815114	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085948316.1|4326929_4328203_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
>prophage 310
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4331699	4332857	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830738.1|4331699_4332857_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 311
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4340272	4341388	4815114		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|4340272_4341388_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 312
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4345677	4355753	4815114		Bacillus_phage(60.0%)	6	NA	NA
WP_001298537.1|4345677_4346589_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_032359209.1|4347868_4349053_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_107148126.1|4349178_4352322_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001564482.1|4352318_4353521_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|4353710_4354400_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001556452.1|4354457_4355753_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	3.8e-26
>prophage 313
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4362705	4371686	4815114	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|4362705_4363833_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|4363855_4364188_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|4364215_4366063_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|4366073_4367045_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|4367173_4367521_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|4367697_4368582_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|4368880_4369420_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|4369570_4370020_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|4370023_4371127_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|4371215_4371686_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 314
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4393247	4398294	4815114	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|4393247_4393871_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|4393996_4395271_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|4395458_4397813_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|4398021_4398294_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 315
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4401422	4402118	4815114		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|4401422_4402118_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 316
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4405441	4408988	4815114		Bacillus_phage(100.0%)	2	NA	NA
WP_001235649.1|4405441_4407214_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256174.1|4407206_4408988_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 317
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4417824	4420974	4815114		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|4417824_4420974_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 318
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4427982	4436544	4815114		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|4427982_4428534_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|4428662_4430594_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|4430646_4430976_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|4430975_4431581_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_032187213.1|4431690_4433565_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	8.0e-118
WP_001220233.1|4433745_4434390_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250103.1|4434625_4435588_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801813.1|4435584_4436544_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 319
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4444788	4447950	4815114		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|4444788_4445130_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|4445445_4447950_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 320
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4452489	4453167	4815114		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|4452489_4453167_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 321
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4456303	4464112	4815114		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|4456303_4456990_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|4456986_4459401_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_107148128.1|4459831_4464112_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.2	2.2e-22
>prophage 322
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4471264	4473046	4815114		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_107148130.1|4471264_4473046_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 323
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4479236	4480382	4815114		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|4479236_4480382_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 324
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4491959	4495090	4815114	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|4491959_4493345_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|4493380_4493902_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4494009_4494222_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4494223_4495090_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 325
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4517984	4522744	4815114		Ralstonia_phage(50.0%)	3	NA	NA
WP_000103232.1|4517984_4519886_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.5	3.3e-26
WP_000253838.1|4520622_4522071_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770953.1|4522060_4522744_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 326
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4526014	4529158	4815114		Leptospira_phage(100.0%)	1	NA	NA
WP_107148134.1|4526014_4529158_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 327
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4541444	4547487	4815114		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|4541444_4545326_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096692.1|4545541_4546675_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|4546671_4547487_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 328
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4562033	4563856	4815114		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502936.1|4562033_4562663_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
WP_032187230.1|4562635_4563856_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	5.5e-59
>prophage 329
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4567039	4569154	4815114		Bacillus_virus(50.0%)	2	NA	NA
WP_106888143.1|4567039_4568605_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|4568725_4569154_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 330
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4584579	4585226	4815114		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|4584579_4584789_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|4584842_4585226_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 331
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4590039	4592478	4815114		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|4590039_4591251_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|4591389_4592478_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 332
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4599488	4602071	4815114	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001297565.1|4599488_4602071_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 333
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4609010	4612543	4815114		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|4609010_4610681_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_107148143.1|4610764_4611700_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|4611817_4612543_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 334
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4618426	4619506	4815114		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|4618426_4619506_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 335
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4623601	4625266	4815114		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|4623601_4625266_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 336
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4630032	4633911	4815114	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|4630032_4631979_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|4632246_4633911_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 337
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4638191	4638956	4815114		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|4638191_4638956_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 338
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4647209	4659930	4815114		Bacillus_phage(25.0%)	8	NA	NA
WP_000186076.1|4647209_4647887_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|4647883_4650568_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|4650560_4651133_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|4651141_4653190_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_000741131.1|4653212_4654886_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|4654885_4654975_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|4655287_4655494_+	YbfA family protein	NA	NA	NA	NA	NA
WP_107148145.1|4655736_4659930_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	4.2e-26
>prophage 339
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4665171	4668221	4815114		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|4665171_4666590_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|4666739_4668221_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 340
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4671599	4672391	4815114		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|4671599_4672391_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 341
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4708410	4711930	4815114		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|4708410_4709130_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|4709126_4710068_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|4710181_4710562_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|4710877_4711930_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 342
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4716283	4722857	4815114		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|4716283_4717300_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|4717560_4719033_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|4719100_4719889_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4720017_4720167_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101984.1|4720333_4721107_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|4721106_4721796_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|4721798_4722857_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 343
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4733212	4734502	4815114		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|4733212_4734502_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 344
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4740983	4741892	4815114		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4740983_4741892_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 345
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4752489	4767301	4815114		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996107.1|4752489_4754226_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|4754218_4755214_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_107148161.1|4755216_4755888_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|4756116_4757481_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|4757712_4758195_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|4758314_4760465_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|4760492_4761455_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|4761595_4762681_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4762909_4763170_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|4763434_4763701_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|4763774_4764452_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430057.1|4764493_4766776_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|4767040_4767301_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 346
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4770985	4776210	4815114		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|4770985_4771708_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|4771704_4772364_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4772502_4773249_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4773652_4774156_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|4774454_4775342_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4775576_4775642_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4775694_4776210_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 347
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4781207	4789549	4815114		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|4781207_4782800_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|4783040_4784306_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|4784457_4785273_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_032187256.1|4785418_4787851_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|4787856_4788756_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|4788886_4789549_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 348
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4792764	4794636	4815114		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|4792764_4794636_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 349
NZ_CP028166	Escherichia coli strain CFSAN064036 chromosome, complete genome	4815114	4807185	4808388	4815114		Stx2-converting_phage(100.0%)	1	NA	NA
WP_087934205.1|4807185_4808388_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.4e-99
>prophage 1
NZ_CP028168	Escherichia coli strain CFSAN064036 plasmid pGMI17-004_1, complete sequence	119076	48755	84910	119076	transposase,integrase	Escherichia_phage(35.71%)	41	44208:44222	73187:73201
44208:44222	attL	TGCTCATGATTAAAA	NA	NA	NA	NA
WP_000078704.1|48755_49694_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	3.6e-66
WP_001247862.1|49758_50025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|50118_50553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117611.1|51281_51782_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	2.4e-05
WP_107148162.1|52243_52840_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.3	3.4e-14
WP_001276270.1|52836_53556_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001387500.1|53552_53987_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145485.1|54041_56000_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	7.3e-21
WP_000006020.1|56058_56292_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.2	1.7e-06
WP_001276120.1|56349_56877_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001434357.1|57260_57575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|57645_57837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271705.1|57833_58256_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_014653258.1|58302_58605_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001668483.1|58700_59273_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274500.1|59967_60402_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|60415_60637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086147.1|60637_61321_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_001348080.1|61396_61702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348079.1|61705_62608_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000272884.1|63288_63681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217836.1|63684_64659_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	45.1	3.1e-73
WP_001394937.1|64897_65101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312331.1|65271_65904_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	1.4e-29
WP_001164192.1|66487_67273_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.5	4.0e-55
WP_000465034.1|67274_67688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|68256_68517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194561.1|68513_69104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|69121_69469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107148163.1|69587_69935_+	colicin transporter	NA	NA	NA	NA	NA
WP_001283356.1|69952_71833_-	colicin	NA	NA	NA	NA	NA
WP_001132019.1|72111_73458_-	hypothetical protein	NA	NA	NA	NA	NA
73187:73201	attR	TGCTCATGATTAAAA	NA	NA	NA	NA
WP_000517689.1|73811_74414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|74469_74964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031610367.1|75706_76123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|78852_79557_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001347546.1|79568_79994_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|80143_81004_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|81588_82293_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|82424_83285_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001324342.1|83386_84910_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
