The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	70902	149391	2688408	transposase	Bacillus_phage(27.27%)	60	NA	NA
WP_107144986.1|70902_71910_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107144987.1|78128_78428_+	topoisomerase	NA	NA	NA	NA	NA
WP_107144988.1|78675_79683_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003776195.1|80033_80495_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_070859312.1|80517_81066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107144989.1|81136_82234_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.6	3.9e-48
WP_049227523.1|83306_84101_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	68.6	3.5e-107
WP_080613765.1|84160_87079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107144990.1|87903_88800_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	3.5e-55
WP_003761889.1|89143_90313_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_009311116.1|90325_90670_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_107144991.1|91057_92056_+	branched chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_107145882.1|92331_93195_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_107144992.1|93454_94135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045074634.1|94993_95863_-	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	26.5	9.1e-24
WP_080613768.1|95992_96541_-	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_080613769.1|96733_97069_+	porin	NA	NA	NA	NA	NA
WP_107144993.1|97146_98232_-	putative lipopolysaccharide heptosyltransferase III	NA	NA	NA	NA	NA
WP_060975633.1|98443_99316_+	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_080613771.1|99478_101392_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_080614486.1|101680_102559_+	carbon-nitrogen hydrolase family protein	NA	M1HSU7	Paramecium_bursaria_Chlorella_virus	24.2	6.6e-06
WP_107144994.1|102703_103495_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080613772.1|103702_104143_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_107144995.1|104207_105971_-	peptidase	NA	NA	NA	NA	NA
WP_036529476.1|106288_107734_+	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_009312365.1|107757_108369_+	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_003757997.1|108373_108544_+	CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone	NA	NA	NA	NA	NA
WP_081094574.1|108574_109939_+	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_107144996.1|110111_111212_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_045074604.1|111384_112959_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	28.9	6.2e-39
WP_107144997.1|113332_114085_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_107144998.1|114168_114747_-	D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_107144999.1|114784_115870_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
WP_107145000.1|115862_116321_-	cell surface protein	NA	NA	NA	NA	NA
WP_039407350.1|116535_117768_+	Bcr/CflA family drug resistance efflux transporter	NA	NA	NA	NA	NA
WP_107145001.1|118108_119005_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.7	9.6e-53
WP_080613777.1|119169_119466_-	late embryogeneis abundant protein	NA	NA	NA	NA	NA
WP_080613778.1|119721_120780_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_080613779.1|121013_121706_-	M48 family peptidase	NA	NA	NA	NA	NA
WP_080613780.1|121813_123007_-	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_080613781.1|123101_123839_-	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_080613782.1|123825_124755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080613783.1|124751_125399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099048542.1|125454_125559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145002.1|125584_127792_+	DNA helicase II	NA	S5M596	Bacillus_phage	31.2	7.1e-73
WP_107145003.1|127990_129253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070440063.1|129865_130318_+	DUF1775 domain-containing protein	NA	NA	NA	NA	NA
WP_080613786.1|130463_133790_-	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_039862975.1|133960_135418_-	potassium transporter Trk	NA	NA	NA	NA	NA
WP_060975116.1|135669_137304_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.7	3.8e-156
WP_039408654.1|137744_138866_+	porin	NA	NA	NA	NA	NA
WP_039408657.1|139130_140033_-	ribokinase	NA	NA	NA	NA	NA
WP_080614487.1|140236_140521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145004.1|140485_143920_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	35.3	6.9e-176
WP_039408663.1|144262_144724_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_039408665.1|144783_145215_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_080613788.1|145297_145807_+	DUF2199 domain-containing protein	NA	NA	NA	NA	NA
WP_080613789.1|146142_147621_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_107145005.1|147853_148105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145006.1|148857_149391_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	50.0	6.5e-41
>prophage 2
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	270390	325998	2688408	protease,transposase	Bacillus_virus(22.22%)	49	NA	NA
WP_107145035.1|270390_271398_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016687665.1|271477_272221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145036.1|272264_272501_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_107145037.1|272400_273852_-	patatin	NA	NA	NA	NA	NA
WP_060974558.1|274015_274627_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_060974559.1|274683_275034_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_060974560.1|275191_275725_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_060974561.1|275793_276216_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_060974562.1|276409_277393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060974563.1|277559_278528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060974564.1|278621_279098_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_045072406.1|279090_279639_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003763874.1|279651_280203_-	protein CreA	NA	NA	NA	NA	NA
WP_060974565.1|280400_282155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145038.1|282420_283923_+	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	27.3	1.5e-21
WP_070857325.1|283990_285880_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_060975199.1|285880_286918_-	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
WP_060975198.1|286914_288039_-	DNA (cytosine-5-)-methyltransferase	NA	A7XXH6	Thermus_virus	38.5	5.6e-50
WP_060975197.1|288406_289786_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_060975196.1|289772_290003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003760109.1|290270_290717_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.2	2.2e-26
WP_003740867.1|291054_291393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145039.1|291519_293085_+	GMP synthase (glutamine-hydrolyzing)	NA	A0A1V0SH76	Hokovirus	31.7	1.5e-21
WP_107145040.1|293596_294388_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099048413.1|294411_294585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145041.1|294488_295088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083286434.1|295145_296021_+	chorismate mutase	NA	NA	NA	NA	NA
WP_060974910.1|296164_298750_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_060974911.1|298989_300258_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.3	7.6e-128
WP_060974912.1|300578_301520_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_060974918.1|301660_302428_+	M48 family peptidase	NA	NA	NA	NA	NA
WP_060974913.1|302525_302765_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_060974914.1|302938_305701_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_107145042.1|306306_309546_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_107145043.1|309885_311730_-	polymerase	NA	NA	NA	NA	NA
WP_107145044.1|311726_312086_-	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_049225530.1|312222_312873_-	oxygen-insensitive NAD(P)H-dependent nitroreductase NfsB	NA	NA	NA	NA	NA
WP_060975695.1|313233_313728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060975694.1|313828_314302_-	iron-sulfur cluster repair protein DnrN	NA	NA	NA	NA	NA
WP_003759178.1|314536_315373_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_003743550.1|315637_316498_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_060975693.1|316494_317568_+	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	2.6e-28
WP_107145045.1|317713_318679_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.1e-37
WP_060974796.1|318742_320035_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_060974797.1|320031_320910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060974798.1|321013_321667_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_107145889.1|321947_322667_-	SCO family protein	NA	NA	NA	NA	NA
WP_107145046.1|325369_325684_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	48.5	3.0e-17
WP_003761891.1|325698_325998_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	52.1	9.4e-21
>prophage 3
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	359517	369066	2688408	transposase	Staphylococcus_phage(16.67%)	8	NA	NA
WP_107145059.1|359517_361191_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	28.8	3.9e-31
WP_039409279.1|361259_362240_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	47.8	2.8e-45
WP_003764533.1|362341_364498_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2K9L285	Tupanvirus	33.8	9.2e-09
WP_003740638.1|364606_364813_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_070635924.1|364872_365490_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	29.1	1.1e-12
WP_107145060.1|365656_366448_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_009311093.1|366487_367048_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	2.6e-32
WP_107145061.1|367218_369066_+	lytic murein transglycosylase	NA	A0A0S2SXL7	Bacillus_phage	38.5	6.2e-14
>prophage 4
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	551778	622765	2688408	transposase	Equid_alphaherpesvirus(11.11%)	58	NA	NA
WP_107145114.1|551778_552570_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_003778466.1|552959_553457_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_107145115.1|553567_554227_-	uracil-DNA glycosylase	NA	A0A2K9QQR6	Equid_alphaherpesvirus	48.8	5.8e-55
WP_107145116.1|554329_556135_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_003743074.1|556406_557063_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_039407301.1|557059_558853_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_039407304.1|559089_559650_+	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_107145895.1|559776_562269_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	37.4	2.6e-71
WP_107145117.1|563037_564078_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_107145118.1|564173_566546_-	ferric enterobactin receptor	NA	NA	NA	NA	NA
WP_080613989.1|567238_568255_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_080614502.1|568258_569044_+	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.9	1.1e-07
WP_107145119.1|569308_569647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145120.1|569794_570751_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.6	3.8e-31
WP_107145121.1|571144_574513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145122.1|574958_575966_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_105165193.1|576019_576259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080613993.1|576704_577265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145896.1|577383_578811_-	oxidoreductase	NA	NA	NA	NA	NA
WP_107145123.1|578999_579692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060975166.1|579935_580913_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_107145124.1|582288_582978_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_099048553.1|582974_583697_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.9	7.8e-37
WP_003742463.1|584085_584568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145897.1|584743_585181_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_107145125.1|585264_586299_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	1.5e-70
WP_107145126.1|586503_587574_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_039406352.1|587642_587816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003778025.1|587838_588555_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_107145127.1|588797_591074_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_045073345.1|591210_592089_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_003742471.1|592432_592630_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
WP_107145128.1|592890_593502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003764447.1|593637_593979_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_107145129.1|594064_594427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145130.1|594505_596368_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.6	2.3e-109
WP_107145131.1|596564_597413_+	squalene synthase HpnD	NA	NA	NA	NA	NA
WP_107145132.1|597409_598723_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003742488.1|599023_599743_+	KR domain-containing protein	NA	NA	NA	NA	NA
WP_107145133.1|599928_600879_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.9	4.9e-63
WP_107145134.1|601156_602158_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_107145135.1|602311_603037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145136.1|603175_603442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145137.1|603625_605167_+	MFS transporter	NA	NA	NA	NA	NA
WP_107145138.1|605511_606408_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.4	2.5e-53
WP_107145139.1|606709_608263_-	DUF945 domain-containing protein	NA	NA	NA	NA	NA
WP_107145114.1|608543_609336_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145140.1|609395_610805_-	MFS transporter	NA	NA	NA	NA	NA
WP_003763626.1|611232_612012_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_107145141.1|612008_612710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145142.1|612706_614161_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_107145143.1|614465_616325_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_039410380.1|616681_617161_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_039410379.1|617231_617903_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_107145144.1|617972_618695_+	nuclease	NA	NA	NA	NA	NA
WP_080614010.1|618764_620600_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_107145145.1|620738_621059_-	stress response protein	NA	NA	NA	NA	NA
WP_107145146.1|621917_622765_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	628814	703867	2688408	tRNA,transposase	Vibrio_phage(12.5%)	52	NA	NA
WP_107145150.1|628814_629662_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107145151.1|629701_630427_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_107145898.1|630726_632406_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_045075228.1|632525_632888_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_107145152.1|633244_634141_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003755171.1|634180_634888_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	57.4	1.3e-52
WP_107145899.1|634936_635434_+	transporter	NA	NA	NA	NA	NA
WP_107145153.1|635794_636642_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107145154.1|638038_638831_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145155.1|639647_640877_+	ATPase	NA	NA	NA	NA	NA
WP_107145156.1|640900_642313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145157.1|642410_643217_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_039855721.1|643582_644152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003742232.1|644217_644700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145900.1|644849_645632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145158.1|645744_646404_+	phosphoesterase	NA	A0A2P9FID1	Pseudomonas_phage	35.3	4.6e-28
WP_107145159.1|646670_647339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145160.1|647657_647981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145161.1|649088_650054_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.8	8.0e-37
WP_107145162.1|650099_650552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009312963.1|650499_651639_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003743445.1|651635_652217_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_045073326.1|652661_653915_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_070441678.1|654063_654855_-	spermidine synthase	NA	NA	NA	NA	NA
WP_107145163.1|655267_656114_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107145164.1|656559_657360_-	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_107145165.1|660481_661669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145166.1|661674_662436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145901.1|663490_664459_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.7	3.8e-31
WP_107145167.1|664845_665259_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107145168.1|665532_666498_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	2.6e-35
WP_107145169.1|666559_667879_-	MFS transporter	NA	NA	NA	NA	NA
WP_107145902.1|667964_668060_+	pilS cassette	NA	NA	NA	NA	NA
WP_107145170.1|668220_669081_-	proline/glycine betaine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	2.1e-25
WP_107145171.1|669067_669931_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107145172.1|671425_672838_-	cell filamentation protein Fic	NA	A0A1V0E025	Clostridioides_phage	29.6	4.6e-25
WP_107145173.1|674595_675675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145174.1|675696_676143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145175.1|676222_677164_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_107145176.1|677477_678269_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145177.1|678920_679670_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003763541.1|679901_680150_-	CsbD family protein	NA	NA	NA	NA	NA
WP_107145903.1|680278_681808_-	glycine/betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_070442663.1|681884_682094_-	copper chaperone	NA	A0A218MNH0	uncultured_virus	62.1	7.0e-15
WP_107145178.1|682526_685013_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_107145179.1|685020_685743_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_107145180.1|685739_687782_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_070491066.1|687803_688643_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_107145181.1|688657_689308_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_107145182.1|689893_690907_+	subtype I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_107145183.1|690981_691275_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_107145184.1|703074_703867_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	708464	753599	2688408	integrase,tRNA,transposase	Cronobacter_phage(16.67%)	39	690940:690968	732288:732316
690940:690968	attL	TTTCAGACGACCTCTAAAGCAGCCTGCAC	NA	NA	NA	NA
WP_049226264.1|708464_709475_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_107145186.1|709733_712307_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.2	8.4e-118
WP_107145187.1|712420_713329_-	peroxidase	NA	NA	NA	NA	NA
WP_107145188.1|713461_714547_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_107145189.1|714752_715349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039405640.1|715813_716668_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_107145190.1|716779_717910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039405645.1|718003_718168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145191.1|718219_719110_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_003756652.1|719258_720767_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_107145905.1|721049_721679_+	transglycosylase	NA	NA	NA	NA	NA
WP_070774016.1|721808_723191_+	MFS transporter	NA	NA	NA	NA	NA
WP_003742079.1|723194_723710_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	62.3	6.1e-36
WP_107145192.1|723859_725149_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_070870746.1|725324_726647_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_070495264.1|726649_728692_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_003756631.1|728693_729104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145193.1|729189_729606_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	66.4	1.6e-50
WP_070514239.1|729650_730787_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	54.1	4.3e-114
WP_029609556.1|731460_732243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145194.1|732356_733016_+	phosphoesterase	NA	A0A2P9FID1	Pseudomonas_phage	35.3	1.3e-27
732288:732316	attR	TTTCAGACGACCTCTAAAGCAGCCTGCAC	NA	NA	NA	NA
WP_107145195.1|733230_734037_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_107145196.1|734109_734973_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_040667827.1|735056_735266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145197.1|735337_737101_-	potassium transporter	NA	NA	NA	NA	NA
WP_019269930.1|737769_738735_-	TIGR03571 family LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_019269929.1|738914_739814_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003755202.1|740032_741376_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	43.9	2.1e-96
WP_099048401.1|742419_743214_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145198.1|743390_744398_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145199.1|744501_746061_+	transporter	NA	NA	NA	NA	NA
WP_107145200.1|746329_747991_+	MFS transporter	NA	NA	NA	NA	NA
WP_107145201.1|748077_749232_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_003742067.1|749218_749398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145202.1|750496_750676_+	endonuclease	NA	NA	NA	NA	NA
WP_019271712.1|751252_751447_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_107145203.1|751459_751981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039404636.1|752060_752363_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107145204.1|752792_753599_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	841930	908721	2688408	tRNA,plate,transposase	uncultured_Caudovirales_phage(38.89%)	54	NA	NA
WP_099048434.1|841930_842827_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.1	3.3e-53
WP_107145239.1|843187_844981_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.6	1.2e-09
WP_107145240.1|845119_845362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145241.1|845875_849511_-	exodeoxyribonuclease V subunit beta	NA	S5M596	Bacillus_phage	31.6	7.2e-06
WP_060974782.1|850187_851195_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_060974783.1|851278_851911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070441905.1|852051_853482_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_070441908.1|853582_854455_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_060974786.1|854454_855912_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_009312923.1|856082_856373_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_049225500.1|856601_857639_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_107145242.1|857650_858490_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_070441923.1|858497_859001_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_083286431.1|859010_861050_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_049225497.1|861042_862206_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003741339.1|862217_862874_+	MarC family protein	NA	NA	NA	NA	NA
WP_107145243.1|863050_863422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145244.1|863520_864417_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.4	3.3e-53
WP_060974927.1|864791_866093_-	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_107145245.1|866061_867546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145246.1|867549_869922_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.8	9.4e-23
WP_107145247.1|870551_871559_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145910.1|871644_871956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145248.1|871859_872453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003741335.1|872611_873178_-	deoxycytidine triphosphate deaminase	NA	S5VM63	Pseudomonas_phage	71.0	1.1e-73
WP_003757911.1|873249_873666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009312388.1|873729_874629_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	35.1	1.9e-45
WP_070442419.1|876396_877458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060975458.1|877510_877777_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_060975453.1|877849_879379_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003760099.1|879419_879917_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_060975454.1|880085_881432_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_070442422.1|881433_882093_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_070442425.1|882111_883752_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	38.0	3.6e-05
WP_003760091.1|883823_884312_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_060975457.1|884383_887203_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.1	9.3e-94
WP_107145249.1|887207_889907_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.4	5.7e-24
WP_060974612.1|889915_890479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060974611.1|890493_892290_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A127AWA8	Bacillus_phage	43.1	6.5e-24
WP_060974610.1|892301_892721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145250.1|892764_895440_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	8.2e-23
WP_060974453.1|895436_897104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145251.1|898306_899272_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	4.0e-36
WP_107145252.1|899328_900831_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.0	3.5e-47
WP_107145253.1|900840_901386_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_107145254.1|901499_902531_+	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.0	1.8e-42
WP_107145255.1|902527_902911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145256.1|903044_903914_+	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.9	2.3e-35
WP_107145257.1|903915_904338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049230851.1|905126_905684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145258.1|905795_906614_+	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	5.9e-33
WP_107145259.1|906635_907013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145260.1|907114_907510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145261.1|907824_908721_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.4	1.3e-52
>prophage 8
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1005679	1098825	2688408	holin,tRNA,plate,transposase	uncultured_Caudovirales_phage(29.41%)	83	NA	NA
WP_107145278.1|1005679_1006526_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080614207.1|1007558_1007822_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	3.0e-07
WP_080614208.1|1008034_1011310_+	type VI secretion protein IcmF	NA	NA	NA	NA	NA
WP_080614209.1|1011309_1012935_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_009310842.1|1012944_1014711_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_060974590.1|1014674_1015784_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003765178.1|1015804_1016344_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_003758401.1|1016343_1016757_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_105165203.1|1020059_1021178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080614213.1|1021248_1022781_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_080614214.1|1022707_1023997_-	DUF2931 domain-containing protein	NA	NA	NA	NA	NA
WP_049226182.1|1024018_1024228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145279.1|1024248_1026732_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.5	4.7e-25
WP_080614217.1|1030781_1031354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101809934.1|1031364_1031808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080614219.1|1031919_1032462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080614220.1|1032486_1033239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145280.1|1033242_1035720_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	22.9	2.6e-23
WP_107145281.1|1035851_1036733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080614226.1|1036782_1037664_-	DUF1911 domain-containing protein	NA	NA	NA	NA	NA
WP_107145282.1|1037676_1038312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145283.1|1038887_1039784_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	1.0e-54
WP_107145284.1|1039844_1040564_-|tRNA	glutamyl-tRNA amidotransferase	tRNA	NA	NA	NA	NA
WP_107145285.1|1041554_1042520_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.1e-37
WP_107145286.1|1042547_1042835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145287.1|1044043_1044890_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107145288.1|1044883_1046140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145289.1|1048323_1049559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145913.1|1049816_1050785_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.7	3.8e-31
WP_107145290.1|1050720_1050981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145291.1|1051705_1052173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049248963.1|1052076_1052427_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083286419.1|1052731_1053841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145292.1|1053857_1054043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145293.1|1054327_1055953_-	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.7	1.1e-25
WP_107145294.1|1055954_1056668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145295.1|1056672_1056897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145296.1|1056926_1057718_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145297.1|1057841_1058681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145298.1|1058683_1059658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145299.1|1059678_1060500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145300.1|1060501_1062667_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.5	9.5e-22
WP_003760633.1|1063461_1063980_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080614245.1|1064043_1064409_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_060975556.1|1064500_1064890_+	epimerase	NA	NA	NA	NA	NA
WP_003760641.1|1064886_1065369_+	DUF2269 domain-containing protein	NA	NA	NA	NA	NA
WP_107145301.1|1065409_1066249_+	epimerase	NA	NA	NA	NA	NA
WP_080614247.1|1066482_1067175_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_070680102.1|1067459_1068296_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_107145302.1|1068304_1068511_+|holin	choline transporter	holin	NA	NA	NA	NA
WP_039405907.1|1068467_1069256_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.6	1.3e-40
WP_060975652.1|1069907_1070099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070441698.1|1070519_1071500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145303.1|1071496_1072324_-|plate	phage baseplate protein	plate	A0A0M3LQN4	Mannheimia_phage	51.6	2.6e-68
WP_070859681.1|1072888_1073830_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_107145304.1|1073836_1074568_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_107145305.1|1074703_1075681_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	3.1e-36
WP_049225366.1|1075856_1076219_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.5	1.0e-16
WP_045072243.1|1076424_1076988_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_070860577.1|1077092_1077908_+	squalene synthase HpnC	NA	NA	NA	NA	NA
WP_107145306.1|1078225_1079635_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_003742453.1|1079862_1080294_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_039408462.1|1080286_1080562_+	RnfH family protein	NA	NA	NA	NA	NA
WP_045072236.1|1080628_1081207_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_060974479.1|1081234_1081441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045072234.1|1081437_1081821_+	VanZ family protein	NA	NA	NA	NA	NA
WP_003677477.1|1081910_1082180_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	61.8	1.1e-20
WP_080614256.1|1082208_1082391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060974480.1|1082364_1084827_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.7	5.4e-215
WP_003756826.1|1085026_1085293_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_060974481.1|1085294_1085912_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_070440882.1|1085911_1086898_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003765802.1|1087056_1088868_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_003755417.1|1089502_1089967_+	bacterioferritin	NA	NA	NA	NA	NA
WP_003755415.1|1089989_1090463_+	bacterioferritin	NA	NA	NA	NA	NA
WP_107145307.1|1090880_1093166_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.4	6.0e-168
WP_003759661.1|1093458_1094271_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.6	8.0e-22
WP_009173410.1|1094505_1095552_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.7	4.0e-119
WP_070440870.1|1095579_1095816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145308.1|1095885_1096926_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003685554.1|1097044_1097416_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_019271290.1|1097498_1097909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070440863.1|1097910_1098825_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1126846	1134448	2688408	protease	Pseudomonas_phage(16.67%)	9	NA	NA
WP_049227362.1|1126846_1127149_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.1	5.9e-15
WP_099048565.1|1127268_1128402_-	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	75.1	2.0e-164
WP_080614269.1|1128620_1129577_-|protease	CAAX protease	protease	A3QSC6	Clostridium_virus	31.2	4.1e-25
WP_080614270.1|1129579_1131859_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	68.4	4.2e-312
WP_107145316.1|1132216_1132723_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_049223989.1|1132805_1133027_+	ribosome alternative rescue factor ArfA	NA	NA	NA	NA	NA
WP_003764837.1|1132986_1133307_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.8e-23
WP_045073670.1|1133371_1133617_-	recombinase RecA	NA	NA	NA	NA	NA
WP_003674559.1|1134061_1134448_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	1.9e-53
>prophage 10
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1243701	1366540	2688408	tRNA,protease,transposase	Bacillus_phage(13.64%)	111	NA	NA
WP_070514239.1|1243701_1244838_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	54.1	4.3e-114
WP_019388955.1|1244882_1245299_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	66.4	1.6e-50
WP_107145919.1|1245501_1247949_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_080614309.1|1248314_1249472_-	sugar transporter	NA	NA	NA	NA	NA
WP_080614310.1|1249607_1249985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060974415.1|1250117_1251368_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.5e-99
WP_080614311.1|1251531_1252437_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_039404698.1|1252669_1253164_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_003778154.1|1253316_1253691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039404694.1|1253933_1255241_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_049226206.1|1255233_1255668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060974419.1|1255810_1256650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145358.1|1256771_1258154_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.2	5.6e-52
WP_070679881.1|1258306_1258735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080614314.1|1259051_1260827_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_070441542.1|1260884_1261562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145359.1|1261710_1264851_+	cell division protein FtsK	NA	G1FGP1	Mycobacterium_phage	48.6	1.5e-84
WP_003742680.1|1265050_1265527_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_107145360.1|1265760_1267881_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_107145361.1|1268118_1268985_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	36.3	1.1e-50
WP_039404730.1|1269152_1270013_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_039404659.1|1271097_1271961_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.3	3.8e-38
WP_049226338.1|1272504_1272753_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_016686532.1|1272916_1273117_-	bacterioferritin	NA	NA	NA	NA	NA
WP_107145362.1|1273365_1274241_-	site-specific tyrosine recombinase XerD	NA	A0A1P8DJJ6	Virus_Rctr41k	29.7	2.5e-13
WP_003742666.1|1274411_1274849_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_003742664.1|1274958_1275594_-	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_070865529.1|1275815_1276313_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003762962.1|1276328_1276703_-	invasion protein expression up-regulator SirB	NA	NA	NA	NA	NA
WP_060975072.1|1276755_1277325_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	45.3	8.5e-39
WP_003755341.1|1277406_1277697_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_107145363.1|1277744_1277942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145920.1|1278065_1279523_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003755348.1|1280104_1280734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039409966.1|1280734_1282030_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_107145364.1|1282843_1283635_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145365.1|1284099_1285023_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_060975074.1|1285127_1286621_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_107145366.1|1286926_1287988_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_107145367.1|1288109_1289333_-	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_107145921.1|1289329_1290697_-	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_107145368.1|1290830_1291565_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_060974803.1|1291845_1292142_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045072512.1|1292157_1293117_-	DNA-binding protein	NA	A0A1V0SF83	Hokovirus	24.7	8.8e-12
WP_039409989.1|1293263_1293659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145922.1|1293878_1294952_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_070773127.1|1295081_1295564_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_107145369.1|1295627_1296032_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107145370.1|1295935_1296832_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.8	1.8e-54
WP_107145371.1|1297159_1297528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145923.1|1298086_1299055_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.7	6.6e-31
WP_107145372.1|1299322_1300588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099048458.1|1300900_1301747_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107145373.1|1301778_1303806_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_049223229.1|1303896_1304229_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	42.7	7.7e-16
WP_107145374.1|1304379_1305927_-	microcin ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.5e-21
WP_107145375.1|1306102_1307644_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	26.1	6.1e-31
WP_107145376.1|1307751_1308774_-	peptide ABC transporter permease	NA	NA	NA	NA	NA
WP_107145377.1|1309029_1310082_-	microcin ABC transporter permease	NA	NA	NA	NA	NA
WP_003757856.1|1310281_1311211_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_003744587.1|1311198_1311675_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_107145378.1|1311931_1312282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003744331.1|1315028_1315589_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_070443035.1|1315690_1316236_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_070443036.1|1316576_1317146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145379.1|1317149_1318661_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
WP_082054531.1|1318667_1318871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145380.1|1318973_1319165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145381.1|1319177_1321157_+	transketolase	NA	NA	NA	NA	NA
WP_107145382.1|1321450_1323463_+	phosphoglycerol transferase	NA	NA	NA	NA	NA
WP_099048434.1|1323805_1324702_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.1	3.3e-53
WP_107145383.1|1324873_1325653_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	24.3	5.0e-13
WP_107145384.1|1326155_1326947_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145385.1|1327068_1327239_-	rubredoxin	NA	NA	NA	NA	NA
WP_107145386.1|1327324_1328413_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003764609.1|1328567_1329116_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_107145387.1|1329381_1331073_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_107145388.1|1331618_1332944_+	MFS transporter	NA	NA	NA	NA	NA
WP_107145389.1|1333487_1337321_+	FAD-linked oxidase	NA	NA	NA	NA	NA
WP_107145390.1|1337700_1339362_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_107145924.1|1339491_1340073_-	peptidase C39	NA	NA	NA	NA	NA
WP_099048577.1|1340215_1340374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060975463.1|1340580_1340958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145391.1|1341015_1341381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049226945.1|1341610_1342024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145392.1|1342073_1342526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145393.1|1342566_1343436_-	meta-pathway of phenol degradation family protein	NA	NA	NA	NA	NA
WP_107145394.1|1343668_1344568_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_107145395.1|1345167_1346175_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145396.1|1346171_1346357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145397.1|1346349_1347936_-	cell division protein FtsK	NA	G1FGP1	Mycobacterium_phage	38.2	2.3e-33
WP_107145398.1|1347951_1349997_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_009425188.1|1349999_1350218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145925.1|1350186_1351332_-	DNA phosphorothioation system sulfurtransferase DndC	NA	NA	NA	NA	NA
WP_083310617.1|1351398_1351650_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_107145399.1|1351646_1351925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145926.1|1352008_1352977_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.7	6.6e-31
WP_107145400.1|1352912_1353107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099048411.1|1353856_1354648_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145401.1|1355077_1356496_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_003776493.1|1356869_1357598_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080614351.1|1358115_1358913_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_107145402.1|1359122_1360526_-	DNA polymerase III subunit epsilon	NA	A0A1P8VWC8	Flavobacterium_phage	34.9	1.1e-15
WP_107145403.1|1361036_1361654_+	hemolysin III	NA	NA	NA	NA	NA
WP_107145404.1|1361772_1362666_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016687463.1|1362689_1363049_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_107145405.1|1363091_1363343_-	branched-chain amino acid ABC transporter	NA	NA	NA	NA	NA
WP_002217533.1|1363425_1363629_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	78.8	3.4e-22
WP_107145406.1|1363695_1363962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145407.1|1363941_1364253_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_107145408.1|1364254_1366540_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	8.7e-167
>prophage 11
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1868785	1933257	2688408	tRNA,protease,transposase	Wolbachia_phage(15.38%)	55	NA	NA
WP_107145578.1|1868785_1869790_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_080613387.1|1869913_1871095_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_049225857.1|1871181_1872513_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_107145579.1|1872686_1873217_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_107145580.1|1873580_1877186_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_107145581.1|1877462_1878989_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_107145933.1|1879510_1881022_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4QMK7	Micromonas_pusilla_virus	32.9	6.6e-38
WP_039409657.1|1881169_1882261_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_107145582.1|1882638_1884513_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	39.9	2.5e-55
WP_107145583.1|1884573_1885869_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.8	3.9e-87
WP_107145934.1|1885936_1887106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145584.1|1887675_1888116_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_107145585.1|1888219_1888666_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_107145586.1|1889891_1891934_-	DNA helicase RecG	NA	NA	NA	NA	NA
WP_107145587.1|1892388_1893504_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_107145588.1|1893687_1897170_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_003759828.1|1897296_1899009_-	flotillin family protein	NA	NA	NA	NA	NA
WP_080614448.1|1899164_1900133_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.4	5.0e-31
WP_107145589.1|1900212_1900482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145935.1|1900814_1901798_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	35.4	5.1e-31
WP_107145590.1|1901718_1901979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145591.1|1901866_1902424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003767067.1|1902505_1903171_-	DUF1449 domain-containing protein	NA	NA	NA	NA	NA
WP_107145592.1|1903398_1903881_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_107145593.1|1903949_1904177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145594.1|1904309_1904654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080613402.1|1904703_1905153_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_045072483.1|1905276_1905804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145595.1|1905912_1906575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145596.1|1906617_1907379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080613405.1|1907460_1907751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145597.1|1907860_1908625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009312451.1|1908752_1909253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145598.1|1909320_1909506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145599.1|1909496_1910939_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_107145600.1|1911103_1913377_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_107145601.1|1913522_1914590_+	addiction module protein	NA	D7RWK9	Brochothrix_phage	30.7	6.8e-29
WP_107145602.1|1914866_1915874_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145603.1|1916008_1916284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049226585.1|1916337_1917180_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_070860539.1|1917372_1918041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003680162.1|1918372_1918711_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	52.8	7.6e-27
WP_049226590.1|1918919_1919612_-	phage repressor protein C	NA	A5X9F5	Aeromonas_virus	37.4	5.2e-30
WP_039408258.1|1919906_1920185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145604.1|1920644_1922954_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.4	2.6e-86
WP_003765319.1|1923118_1924708_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_107145605.1|1924700_1926305_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_107145606.1|1926536_1927139_-	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_107145607.1|1927522_1928590_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.1	2.1e-102
WP_070865227.1|1928661_1929528_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.3	5.5e-106
WP_107145608.1|1929680_1930532_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.4	2.2e-30
WP_003743713.1|1931256_1931505_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_060975447.1|1931707_1932241_+	isochorismatase	NA	NA	NA	NA	NA
WP_003743715.1|1932259_1932757_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_107145609.1|1932840_1933257_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.5	1.7e-20
>prophage 12
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	1938933	2010497	2688408	tRNA,transposase	Staphylococcus_prophage(16.67%)	55	NA	NA
WP_107145611.1|1938933_1939726_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145612.1|1939722_1940157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145936.1|1940060_1940372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145613.1|1941370_1942162_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145614.1|1942696_1944325_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016686965.1|1944622_1945660_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_039407636.1|1945879_1947211_+	MFS transporter	NA	NA	NA	NA	NA
WP_060975443.1|1947378_1949487_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_080613420.1|1949815_1950631_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_080614458.1|1953121_1954354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045073460.1|1954489_1955092_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_080613421.1|1955207_1955861_-	acetyltransferase	NA	NA	NA	NA	NA
WP_003776639.1|1957640_1958051_+	DedA family protein	NA	NA	NA	NA	NA
WP_107145615.1|1958155_1959349_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
WP_099048404.1|1959480_1960272_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060975487.1|1960296_1961100_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_099048404.1|1961251_1962044_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145616.1|1962040_1963024_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.3	1.3e-37
WP_060975172.1|1963628_1964708_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_060975171.1|1964887_1965931_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_107145014.1|1966246_1967041_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145937.1|1966997_1967228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145617.1|1967491_1968457_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	4.4e-35
WP_039862830.1|1968588_1969347_-	iron ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.8	8.8e-15
WP_060975589.1|1969418_1970042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060975590.1|1970100_1971966_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	34.2	4.8e-54
WP_080613429.1|1972127_1973126_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_039408344.1|1973115_1974090_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.5	9.8e-51
WP_080613430.1|1974523_1975291_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_080613431.1|1975505_1976306_-	cytochrome c1	NA	NA	NA	NA	NA
WP_060975592.1|1976305_1977829_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_060975593.1|1977847_1978429_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_060975594.1|1978551_1979301_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016686599.1|1979531_1980470_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060975595.1|1980714_1981251_+	phenylphosphate carboxylase subunit delta	NA	A0A140XBD6	Dickeya_phage	44.4	6.0e-26
WP_070495990.1|1981247_1981829_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_107145618.1|1981809_1982340_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003766063.1|1982432_1983167_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	2.0e-24
WP_070440261.1|1983411_1984764_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
WP_003757098.1|1984830_1985145_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_107145619.1|1985328_1986176_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107145620.1|1986596_1987037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145621.1|1987256_1988000_-	ABC transporter ATP-binding protein	NA	M1HS04	Acanthocystis_turfacea_Chlorella_virus	31.2	1.5e-11
WP_107145622.1|1988001_1988934_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_107145623.1|1989161_1989950_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060974922.1|1991777_1994570_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.1	1.0e-76
WP_003743791.1|1994807_1996136_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_060974921.1|1996339_1996747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145624.1|1996959_1998243_+	glutamate-1-semialdehyde-2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	27.4	1.5e-11
WP_107145625.1|1998499_1999432_-	autotransporter	NA	NA	NA	NA	NA
WP_107145938.1|2000597_2003621_+	outer membrane insertion C- signal	NA	A0A2L1IV32	Escherichia_phage	64.1	3.4e-17
WP_107145626.1|2004172_2005180_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080613444.1|2005380_2006187_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_060974820.1|2007056_2008370_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	4.8e-61
WP_107145626.1|2009489_2010497_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	2313926	2384594	2688408	tRNA,transposase	Catovirus(14.29%)	59	NA	NA
WP_070497907.1|2313926_2315984_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.3	6.9e-54
WP_009175125.1|2316221_2317400_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_045072345.1|2317476_2317893_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_107145743.1|2317920_2318817_-	geranyl transferase	NA	NA	NA	NA	NA
WP_029609485.1|2318800_2319028_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_107145744.1|2319161_2321117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039410823.1|2321897_2323355_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.7	1.6e-65
WP_080613595.1|2323444_2324809_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_107145745.1|2325292_2327317_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_107145746.1|2327449_2327578_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_107145947.1|2327822_2327945_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_003743152.1|2328108_2328540_-	hypothetical protein	NA	A0A292GL60	Xanthomonas_phage	43.9	4.8e-18
WP_003743151.1|2328549_2329080_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_107145747.1|2329416_2330049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145748.1|2330190_2331009_+	DNA ligase	NA	F2Y1N0	Organic_Lake_phycodnavirus	32.4	3.4e-28
WP_070539656.1|2331628_2332729_+	UDP-N-acetylglucosamine-peptide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_107145749.1|2332952_2334968_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_107145750.1|2335081_2336038_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_107145751.1|2336276_2337254_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083313615.1|2338023_2338224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145752.1|2338218_2338542_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_107145753.1|2338625_2340803_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_107145754.1|2341311_2341551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070440343.1|2342120_2342483_+	cupin	NA	NA	NA	NA	NA
WP_070440341.1|2342607_2343075_+	damage-inducible protein CinA	NA	B5TK85	Pseudomonas_phage	46.5	5.6e-28
WP_070440340.1|2343276_2343861_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_107145755.1|2344343_2346965_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.2	4.5e-26
WP_003765321.1|2347071_2347989_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_003765335.1|2347985_2348636_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.2	3.6e-25
WP_003744440.1|2348731_2348989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003775962.1|2348969_2349452_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_049223220.1|2349641_2350001_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	39.7	1.2e-17
WP_003768329.1|2350023_2350695_+	YdcF family protein	NA	NA	NA	NA	NA
WP_060975663.1|2350787_2351324_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	45.1	1.6e-23
WP_003767081.1|2351705_2352242_-	porin family protein	NA	NA	NA	NA	NA
WP_107145756.1|2352465_2352690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003759784.1|2352653_2353886_-	twitching motility protein PilT	NA	NA	NA	NA	NA
WP_045074036.1|2354057_2355104_-	type IV pili twitching motility protein PilT	NA	NA	NA	NA	NA
WP_107145757.1|2355283_2355991_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_070491784.1|2356412_2357210_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_060974482.1|2357212_2357767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003767066.1|2357960_2358377_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_107145758.1|2358509_2358737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145759.1|2364491_2364791_+	topoisomerase	NA	NA	NA	NA	NA
WP_099048411.1|2364983_2365775_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145760.1|2366423_2367164_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.5	9.4e-38
WP_107145761.1|2367535_2369041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145762.1|2369513_2370284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145763.1|2370308_2371541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145764.1|2371557_2374845_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_107145948.1|2374907_2375345_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_107145765.1|2375568_2376966_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	31.0	3.0e-45
WP_107145766.1|2377031_2378009_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	3.1e-36
WP_107145767.1|2378188_2379262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145768.1|2380146_2380338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145769.1|2380697_2382170_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_107145770.1|2382228_2383194_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	4.0e-36
WP_107145734.1|2383335_2384232_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.4	3.3e-53
WP_107145771.1|2384135_2384594_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	2436311	2480636	2688408	tRNA,transposase	Bacillus_phage(33.33%)	41	NA	NA
WP_107145950.1|2436311_2437099_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107145785.1|2437612_2437801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145786.1|2437824_2439720_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_060974790.1|2439860_2441216_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_107145787.1|2441994_2442411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145788.1|2442596_2443055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145951.1|2443188_2444673_+	NTPase	NA	R9TRQ8	Vibrio_phage	31.5	7.2e-13
WP_099048434.1|2445014_2445911_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.1	3.3e-53
WP_107145789.1|2446370_2447681_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_003759233.1|2447677_2448163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003741470.1|2448275_2448917_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_045073307.1|2449168_2449855_+	BAX inhibitor (BI)-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	40.3	2.8e-28
WP_003741463.1|2449984_2450491_+	pantetheine-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_107145790.1|2450753_2452862_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_107145791.1|2452952_2453849_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	3.5e-55
WP_016686442.1|2454301_2454664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145792.1|2454663_2455050_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_107145793.1|2455046_2455535_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_107145794.1|2455703_2456423_-	bifunctional 3-demethylubiquinol 3-O-methyltransferase/2-polyprenyl-6-hydroxyphenol methylase	NA	NA	NA	NA	NA
WP_107145795.1|2456627_2457434_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_003686859.1|2458600_2459320_-	UMP kinase	NA	NA	NA	NA	NA
WP_107145796.1|2459753_2460608_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003759405.1|2460729_2461458_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_045074003.1|2461631_2461874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145797.1|2461951_2462542_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_107145798.1|2462637_2463225_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003776088.1|2463404_2463590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016686457.1|2463600_2465076_+	malate:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_080613318.1|2465559_2466567_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107145799.1|2466636_2467641_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
WP_107145800.1|2467737_2470119_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_107145801.1|2470115_2471111_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_107145952.1|2471341_2471581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145802.1|2471701_2472328_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_107145803.1|2472327_2473278_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_107145804.1|2473359_2474334_+	S49 family peptidase	NA	NA	NA	NA	NA
WP_016686465.1|2474879_2476016_-	molecular chaperone DnaJ	NA	A0A0G2YAM9	Acanthamoeba_polyphaga_mimivirus	30.7	5.2e-19
WP_107145953.1|2476377_2479008_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.8	1.3e-185
WP_107145805.1|2479022_2479289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060975382.1|2479409_2480321_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_107145954.1|2480480_2480636_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP028150	Neisseria mucosa strain ATCC 19696 chromosome, complete genome	2688408	2518737	2596274	2688408	transposase	Vibrio_phage(25.0%)	59	NA	NA
WP_107145824.1|2518737_2519634_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	45.6	1.6e-55
WP_107145825.1|2519537_2519885_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_107145826.1|2519896_2520703_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_107145827.1|2520866_2521841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107145828.1|2522470_2523511_-	S-adenosyl-L-methionine-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003761336.1|2523983_2524439_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_107145829.1|2524435_2525389_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
WP_003761340.1|2525444_2525708_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_107145830.1|2525789_2527538_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_107145831.1|2527562_2529041_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_107145832.1|2529228_2529750_+	M23 family peptidase	NA	NA	NA	NA	NA
WP_070602312.1|2529774_2530635_+	peptidase	NA	NA	NA	NA	NA
WP_083310414.1|2530675_2531407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145833.1|2531457_2532825_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_107145834.1|2532827_2533016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145835.1|2533211_2534294_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_039405734.1|2534457_2535117_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107145836.1|2535113_2536241_-	oxidoreductase	NA	NA	NA	NA	NA
WP_107145837.1|2536391_2536745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145838.1|2536818_2537703_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107145839.1|2537717_2538197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003760310.1|2538209_2538905_+	LrgB family protein	NA	NA	NA	NA	NA
WP_049226714.1|2539214_2541407_-	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_080613687.1|2541455_2541902_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_107145840.1|2542061_2543195_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_107145841.1|2543286_2545179_-	nucleoside-diphosphate sugar epimerase	NA	A0A1V0SAI8	Catovirus	29.1	2.3e-19
WP_107145842.1|2545374_2546550_-	aminotransferase	NA	A0A2K9L0G1	Tupanvirus	49.9	5.4e-104
WP_039405714.1|2546542_2547325_-	formyl transferase	NA	NA	NA	NA	NA
WP_039405711.1|2547372_2548059_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_039405708.1|2548045_2549020_-	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_060974985.1|2549006_2549624_-	sugar transferase	NA	NA	NA	NA	NA
WP_049226722.1|2549616_2550789_-	glycosyl transferase family 1	NA	NA	NA	NA	NA
WP_107145843.1|2550803_2551877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049226727.1|2551890_2553168_-	membrane protein	NA	NA	NA	NA	NA
WP_039405693.1|2553337_2554756_-	polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_070860495.1|2554920_2556228_-	nucleotide sugar dehydrogenase	NA	M1HEP0	Acanthocystis_turfacea_Chlorella_virus	31.8	2.0e-43
WP_039405685.1|2556653_2557310_-	histidine kinase	NA	NA	NA	NA	NA
WP_107145844.1|2557430_2558321_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107145845.1|2558317_2558596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145846.1|2558764_2559385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145847.1|2559450_2559654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145848.1|2560128_2573916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080613694.1|2574112_2575114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080613695.1|2575400_2576723_+	peptidase M23	NA	A8ATH6	Listeria_phage	52.3	2.5e-25
WP_107145613.1|2578587_2579380_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_060975059.1|2579648_2580332_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	61.8	3.9e-62
WP_016686771.1|2580407_2580881_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	68.3	1.1e-50
WP_060975060.1|2581393_2581888_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060975061.1|2581938_2583387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107145849.1|2584126_2585134_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_049225923.1|2585391_2587791_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_039408903.1|2587937_2589047_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_060974923.1|2589048_2589663_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_080613699.1|2589663_2590350_+	pilus assembly protein PilO	NA	NA	NA	NA	NA
WP_060974925.1|2590367_2590922_+	pilin assembly protein	NA	NA	NA	NA	NA
WP_080613700.1|2590940_2593076_+	type IV pilus secretin PilQ	NA	R9TEZ5	Vibrio_phage	22.9	4.5e-16
WP_107145850.1|2593242_2594089_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_060974909.1|2594301_2594718_+	DNA modification methylase	NA	NA	NA	NA	NA
WP_107145850.1|2595426_2596274_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
