The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	554705	611740	5074586	tRNA,portal,head,capsid,protease,tail,integrase,terminase,holin,lysis	Enterobacteria_phage(37.93%)	70	592780:592794	617656:617670
WP_000912345.1|554705_556091_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143516.1|556126_556648_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|556755_556968_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|556969_557836_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001298992.1|558198_559362_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_012599996.1|559217_559673_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
WP_000206813.1|559588_559894_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242717.1|559893_560256_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000008165.1|560246_560783_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081290.1|560910_561735_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000135682.1|561800_562163_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_012599998.1|562886_563579_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	2.4e-120
WP_001191669.1|563676_563937_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000515850.1|563929_564487_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	96.8	1.1e-96
WP_001087327.1|564483_565632_+	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	86.4	2.7e-177
WP_000620684.1|565628_566495_+	peptidase	NA	K7PLX4	Enterobacteria_phage	75.5	9.4e-114
WP_000620687.1|566491_566716_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	95.9	2.4e-37
WP_000061508.1|566712_567531_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.1	2.8e-123
WP_001387484.1|567527_568022_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	1.5e-84
WP_000066917.1|568021_568675_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|568671_568998_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|568994_569390_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|569552_570368_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001358491.1|570375_571365_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001204814.1|571382_571754_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	59.2	8.3e-35
WP_000360285.1|571829_572447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917737.1|572725_572923_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000301784.1|573057_573765_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874508.1|574534_576496_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.5	6.6e-240
WP_001304601.1|576632_576815_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	86.7	4.6e-23
WP_001514225.1|576852_577122_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
WP_000284510.1|577197_577413_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001037011.1|577417_577768_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	91.1	6.0e-51
WP_000992063.1|577831_578365_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	2.1e-100
WP_001082564.1|578663_579101_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	2.3e-68
WP_001028465.1|579302_579824_+	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000347013.1|580532_580673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|580805_580991_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000867568.1|581386_581935_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000258997.1|583816_584023_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|584019_585612_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253910.1|585601_587107_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_000256840.1|587143_587491_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|587548_588577_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|588628_589003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204545.1|588995_589349_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	5.8e-38
WP_001007373.1|589360_589939_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	3.9e-79
WP_000683147.1|589935_590331_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
WP_001306179.1|590338_591079_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
WP_000479165.1|591094_591517_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	1.5e-69
WP_000459451.1|591498_591933_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_000840203.1|591925_594487_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.6	0.0e+00
592780:592794	attL	CCGCCTGAAAGAGAA	NA	NA	NA	NA
WP_000847312.1|594483_594813_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	4.7e-58
WP_001514118.1|594812_595511_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	1.2e-127
WP_000194708.1|595521_596265_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	4.9e-143
WP_122994946.1|596210_596843_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	92.8	7.2e-95
WP_000514736.1|597186_600879_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.7	0.0e+00
WP_001228272.1|600946_601546_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	9.8e-102
WP_000216562.1|601697_603758_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	7.1e-152
WP_001204581.1|603754_604033_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_000355700.1|604042_604336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|604375_604474_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_023148666.1|604528_605197_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226381.1|605742_607227_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201822.1|607413_608367_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001331488.1|608841_609150_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A088CD23	Shigella_phage	81.8	7.4e-37
WP_001304815.1|609169_609469_-|integrase	tyrosine-type recombinase/integrase	integrase	B9UDL9	Salmonella_phage	80.0	6.5e-30
WP_000259980.1|609526_609832_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
WP_000239877.1|609886_610555_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201816.1|610786_611740_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
617656:617670	attR	TTCTCTTTCAGGCGG	NA	NA	NA	NA
>prophage 2
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	920848	1030539	5074586	tRNA,portal,capsid,head,holin,transposase,protease,plate,integrase,terminase,tail,lysis	Escherichia_phage(30.77%)	97	934611:934628	1001505:1001522
WP_000188147.1|920848_922795_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|922867_923092_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|923414_923735_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|923765_926042_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|926754_927738_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|927734_930968_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|931297_932605_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|933535_934537_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|934547_935102_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
934611:934628	attL	GCGGCGTTATTTGCAAAA	NA	NA	NA	NA
WP_001040187.1|936143_936362_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|936646_937351_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202198.1|937392_939114_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043638.1|939114_940881_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_000537432.1|941003_941969_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|942512_943007_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077107.1|943141_947185_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|947343_947955_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|947965_949309_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|949399_950692_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850286.1|950930_953375_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
WP_000213098.1|953385_954003_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534662.1|954004_954868_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165876.1|954903_955530_-	hydrolase	NA	NA	NA	NA	NA
WP_106919428.1|955843_956992_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067979.1|957088_957886_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|957917_958913_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|959006_959318_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|959422_959779_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000217684.1|959956_960457_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_000557709.1|960520_960733_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	92.9	8.6e-29
WP_000185625.1|960747_960993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789843.1|960989_961280_+	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	81.7	5.5e-34
WP_001113271.1|961279_961504_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	8.5e-35
WP_000027674.1|961500_961776_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_000268586.1|961765_964051_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.2	0.0e+00
WP_001600138.1|964050_964503_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
WP_000554770.1|964502_964709_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	94.0	1.5e-30
WP_000379684.1|964932_965664_+	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	77.4	4.2e-107
WP_000864673.1|965775_966558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038148.1|966906_967941_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	3.2e-201
WP_001298859.1|968135_969677_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|969691_970438_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000156837.1|970527_972300_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085953.1|972473_973328_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_001248548.1|973386_974460_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	98.9	1.6e-200
WP_000203470.1|974463_975207_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	98.8	8.6e-124
WP_000988633.1|975306_975816_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|975815_976019_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|976022_976304_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144092.1|976303_976801_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	9.9e-92
WP_000736581.1|976815_977241_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	4.0e-57
WP_000088794.1|977228_977654_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	8.0e-66
WP_001440152.1|977625_977799_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917195.1|977761_978229_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	1.3e-80
WP_001001807.1|978221_978674_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	4.1e-76
WP_001093745.1|978740_979376_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	2.7e-110
WP_000127164.1|979372_979720_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121497.1|979724_980633_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_001285330.1|980625_981156_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	96.6	8.9e-99
WP_106919429.1|981166_983908_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	99.7	0.0e+00
WP_001164151.1|983911_984439_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	92.0	4.9e-89
WP_000711882.1|984860_985703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286679.1|986082_987273_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
WP_001251408.1|987285_987804_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|987860_988136_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|988168_988288_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069915.1|988280_990728_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.8	0.0e+00
WP_000978918.1|990742_991222_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.1	2.1e-83
WP_000887625.1|991221_992385_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.2e-204
WP_000468308.1|992466_992685_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|993004_995287_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|995341_996199_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194828.1|996604_998365_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642837.1|998494_999187_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057124.1|999385_1000474_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	9.2e-82
WP_000445244.1|1000544_1001828_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
1001505:1001522	attR	GCGGCGTTATTTGCAAAA	NA	NA	NA	NA
WP_001313710.1|1001997_1002762_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125016.1|1002934_1003618_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1003728_1005402_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1005561_1005846_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000551259.1|1008347_1010096_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570549.1|1010092_1011079_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056555.1|1011115_1012348_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|1012399_1012582_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011611.1|1012578_1013325_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436900.1|1013478_1014372_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899587.1|1014348_1015128_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001331920.1|1015263_1016049_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288856.1|1016045_1017368_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001514131.1|1017348_1018053_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572616.1|1018052_1022513_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000926021.1|1022773_1024621_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|1024801_1025350_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|1025376_1026024_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|1026073_1027264_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977927.1|1027448_1028537_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|1029138_1030539_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 3
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	1213286	1258488	5074586	tRNA,portal,head,capsid,protease,integrase,terminase,tail,lysis	Enterobacteria_phage(52.63%)	66	1203806:1203819	1233577:1233590
1203806:1203819	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|1213286_1214393_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1214446_1214908_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|1214917_1215571_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1215742_1216993_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1217106_1218249_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1218238_1218475_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1218614_1218854_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1218837_1219164_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1219163_1219385_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1219771_1219963_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1219935_1220118_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1220114_1220795_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1220791_1221577_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|1221582_1221879_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|1221954_1222098_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1222066_1222231_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1222303_1222672_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1222854_1223055_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|1223268_1223850_+	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|1223866_1224139_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1224116_1224299_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1224575_1225328_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1225324_1225882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|1225921_1226617_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1226692_1226908_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1227049_1227346_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1227378_1228278_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1228274_1228976_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1228972_1229263_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1229336_1229777_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1229773_1230301_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1230297_1230474_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1230476_1230818_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950951.1|1230810_1231005_+	protein ninF	NA	NA	NA	NA	NA
WP_001099712.1|1231024_1231387_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1231383_1231524_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1231609_1231993_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1232181_1233264_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1233852_1234068_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
1233577:1233590	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_001135277.1|1234067_1234565_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1234781_1234964_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1235054_1235348_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1235828_1236155_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1236361_1236544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867565.1|1237106_1237655_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.8e-57
WP_001304453.1|1237626_1239555_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|1239538_1239745_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831760.1|1239741_1241334_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253914.1|1241323_1242829_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1242865_1243213_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522651.1|1243270_1244299_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|1244350_1244725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106919430.1|1244717_1245071_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	64.1	2.2e-37
WP_001007373.1|1245082_1245661_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	3.9e-79
WP_000683147.1|1245657_1246053_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	8.5e-70
WP_001306179.1|1246060_1246801_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
WP_000479165.1|1246816_1247239_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	1.5e-69
WP_000459451.1|1247220_1247655_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.0e-63
WP_000840240.1|1247647_1250209_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.6	0.0e+00
WP_000847405.1|1250205_1250535_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1250534_1251233_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1251238_1251982_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1251918_1252551_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515327.1|1252611_1256094_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_000290543.1|1256152_1258213_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|1258209_1258488_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 4
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	1337454	1428069	5074586	portal,head,capsid,transposase,protease,tail,integrase,terminase,holin,lysis	Escherichia_phage(30.19%)	96	1330849:1330865	1383766:1383782
1330849:1330865	attL	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001111620.1|1337454_1338654_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|1339446_1340289_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|1340338_1340797_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1340909_1341815_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|1341906_1342920_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1343121_1344030_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1344173_1344587_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1345190_1345808_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|1347265_1349941_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|1350417_1351065_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001297114.1|1351802_1353434_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|1353519_1354440_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1354454_1355363_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|1355374_1356388_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|1356384_1357389_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|1357441_1357771_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|1357805_1359266_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1359408_1359582_+	YciY family protein	NA	NA	NA	NA	NA
WP_001313775.1|1359636_1360890_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1361189_1361486_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|1361709_1362426_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1362465_1362864_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|1362969_1363509_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|1363538_1364282_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|1364637_1365276_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1365321_1366452_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1366429_1366678_-	excisionase	NA	NA	NA	NA	NA
WP_000048435.1|1366742_1369214_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|1369306_1369498_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1369494_1369683_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1370083_1370248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|1370248_1370470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1370629_1370785_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|1371077_1371416_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|1371807_1372050_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|1372033_1372459_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|1372530_1373601_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151217.1|1373641_1374064_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	4.1e-62
WP_014639476.1|1374255_1375218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|1375233_1376235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|1376643_1376751_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013637.1|1376795_1377008_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	98.5	3.1e-26
WP_011478175.1|1377175_1377454_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|1377455_1378502_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|1378514_1378889_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1378885_1379707_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|1379931_1380129_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|1380279_1381329_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_001331709.1|1382603_1382831_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|1383099_1383315_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|1383319_1383664_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|1383629_1383902_-	hypothetical protein	NA	NA	NA	NA	NA
1383766:1383782	attR	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001082537.1|1384840_1385305_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|1385612_1386023_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|1386080_1386314_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|1386700_1387249_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000259002.1|1389131_1389338_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831818.1|1389334_1390927_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.9e-185
WP_001253963.1|1390916_1392422_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_000256823.1|1392458_1392806_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522649.1|1392863_1393892_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	1.0e-114
WP_000201530.1|1393942_1394317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204535.1|1394309_1394663_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.9	6.7e-42
WP_000974980.1|1394678_1395212_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1395208_1395604_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1395611_1396364_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479118.1|1396377_1396809_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|1396835_1397249_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|1397229_1399803_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847398.1|1399799_1400069_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.3	2.7e-43
WP_001152522.1|1400128_1400827_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|1400831_1401575_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|1401511_1402114_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1402187_1402526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515771.1|1402592_1406072_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_001233195.1|1406139_1406739_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|1406890_1409998_+	membrane protein	NA	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|1409997_1410582_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|1410636_1411305_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1411361_1411631_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001079492.1|1412403_1412910_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1412955_1413456_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1413541_1413721_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|1414101_1414908_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|1414907_1416101_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|1416112_1417471_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|1417474_1419070_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|1419069_1420632_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1420723_1420768_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|1420905_1421787_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1421783_1422404_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|1422431_1424327_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1424539_1425415_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|1425454_1426045_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|1426041_1426800_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|1427019_1428069_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2207355	2247248	5074586	tRNA,portal,head,capsid,holin,transposase,plate,integrase,terminase,tail,lysis	Escherichia_phage(39.02%)	45	2208862:2208889	2245261:2245288
WP_000476019.1|2207355_2208717_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
2208862:2208889	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2208989_2209208_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882955.1|2209289_2210453_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	7.0e-205
WP_000978907.1|2210452_2210932_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069926.1|2210946_2213394_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_053879341.1|2213386_2213506_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	4.0e-15
WP_001031303.1|2213538_2213814_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251412.1|2213870_2214389_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001286719.1|2214401_2215592_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	2.8e-225
WP_000836023.1|2215922_2216300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514314.1|2216322_2216907_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.5	5.2e-07
WP_000711880.1|2217013_2217856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001164150.1|2218277_2218805_-|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	91.4	8.3e-89
WP_000104708.1|2218808_2221544_-|tail	tail protein	tail	Q858V4	Yersinia_virus	81.7	0.0e+00
WP_001285335.1|2221554_2222085_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.3	7.3e-101
WP_001121504.1|2222077_2222986_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.2e-161
WP_000127164.1|2222990_2223338_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_000853328.1|2223334_2223970_-|plate	phage baseplate assembly protein V	plate	Q858V7	Yersinia_virus	97.6	2.2e-112
WP_001280130.1|2224115_2225195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001802.1|2225275_2225728_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_000917186.1|2225720_2226188_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072130481.1|2226150_2226324_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_000040664.1|2226295_2226721_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	2.3e-65
WP_000736608.1|2226708_2227134_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144107.1|2227148_2227646_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
WP_000123123.1|2227645_2227927_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2227930_2228134_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2228133_2228643_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203432.1|2228742_2229486_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.2	3.3e-123
WP_001298859.1|2230346_2231888_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2231902_2232649_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001085953.1|2233207_2234062_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156872.1|2234235_2236008_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038181.1|2236007_2237042_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	1.2e-200
WP_000997854.1|2237381_2239214_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.1	2.0e-89
WP_000268562.1|2239330_2241613_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027667.1|2241602_2241878_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|2241874_2242099_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277891.1|2242101_2242401_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_000557708.1|2242400_2242625_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_000217677.1|2242688_2243189_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000043869.1|2243366_2243642_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001350698.1|2243756_2244056_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	100.0	3.3e-50
WP_001350699.1|2245615_2245933_-	hypothetical protein	NA	NA	NA	NA	NA
2245261:2245288	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807360.1|2246348_2247248_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
>prophage 6
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2284721	2294166	5074586		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|2284721_2285858_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|2285854_2287858_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|2287982_2288444_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2288484_2288955_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2289001_2289721_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2289717_2291403_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|2291624_2292356_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|2292415_2292523_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|2292503_2293235_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|2293239_2294166_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 7
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2502773	2575523	5074586	tRNA,portal,head,transposase,integrase,terminase,holin,coat,lysis	Enterobacteria_phage(75.44%)	85	2532894:2532910	2575597:2575613
WP_001283598.1|2502773_2503586_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|2503585_2504599_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|2504664_2505801_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|2505899_2506895_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|2506891_2508070_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2508334_2509555_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|2509713_2511720_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2511840_2512119_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089237.1|2512152_2512701_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|2512700_2513510_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|2513509_2514334_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|2514337_2515423_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|2515457_2516390_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2516555_2517107_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|2517426_2518269_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|2518270_2518798_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|2518794_2519274_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|2519270_2519774_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000120670.1|2519790_2520543_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|2520562_2523211_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|2524399_2524885_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425007.1|2525087_2527232_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2527231_2528542_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2528722_2529007_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|2529378_2530719_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2530776_2531532_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2531825_2532758_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
2532894:2532910	attL	CTGCAGGGGACACCATT	NA	NA	NA	NA
WP_000958671.1|2533069_2534227_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_106919435.1|2534466_2535264_-	acetyltransferase	NA	C7U0V2	Enterobacteria_phage	99.1	3.1e-79
WP_000129907.1|2535417_2538363_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.4	0.0e+00
WP_001350929.1|2538463_2539366_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	97.0	1.5e-167
WP_000410001.1|2539598_2539751_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051911.1|2539865_2540114_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903306.1|2540113_2540650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198454.1|2540698_2541148_-	hypothetical protein	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|2541156_2541723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|2541919_2542249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868966.1|2542266_2544279_-	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.7	2.9e-97
WP_000257015.1|2544278_2545730_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	61.0	7.5e-148
WP_000964905.1|2545740_2546433_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	99.6	2.5e-117
WP_000627629.1|2546435_2546891_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|2546890_2547592_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|2547591_2549010_-	Packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|2549019_2549481_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|2549461_2549650_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_000370106.1|2549691_2550945_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	99.0	3.1e-235
WP_001016257.1|2551633_2552380_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|2552394_2553936_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_106919436.1|2554050_2554443_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	1.5e-39
WP_000818371.1|2554533_2556732_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|2556733_2558149_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|2558145_2558586_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|2558588_2558831_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|2559058_2559601_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|2559806_2559959_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|2559946_2560384_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|2560380_2560857_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|2560840_2561164_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027551.1|2561760_2562279_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	99.4	3.4e-95
WP_000994516.1|2562275_2562464_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2562460_2562823_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|2562819_2563110_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|2563109_2563832_-	DNA-binding protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950973.1|2563824_2564001_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_000177653.1|2563993_2564419_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	73.3	5.9e-53
WP_001254264.1|2564415_2564592_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	4.3e-26
WP_000814617.1|2564588_2564999_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_000229808.1|2565628_2565835_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_001248388.1|2565907_2567284_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_077635061.1|2567280_2568135_-	replication protein	NA	A5VW95	Enterobacteria_phage	87.6	3.7e-155
WP_001244621.1|2568137_2568410_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2568432_2568726_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|2568834_2569020_-	hypothetical protein	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2569100_2569751_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000219332.1|2570272_2570572_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	98.0	4.5e-31
WP_000167596.1|2570580_2571051_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.8e-87
WP_014532157.1|2571140_2571416_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_000031365.1|2571672_2572278_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|2572277_2572661_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|2572684_2572981_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000215166.1|2573589_2573889_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|2573890_2574463_+	DUF551 domain-containing protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000002106.1|2574740_2575025_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2575097_2575265_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2575322_2575523_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2575597:2575613	attR	CTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 8
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2791544	2915574	5074586	tRNA,portal,head,capsid,transposase,protease,plate,integrase,terminase,tail,lysis	Salmonella_phage(39.18%)	139	2840356:2840401	2874452:2874497
WP_000083664.1|2791544_2792282_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2792413_2793748_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|2793780_2794662_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2794764_2795352_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2795407_2795791_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2796095_2796785_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|2796832_2797870_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2798076_2798496_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2798564_2799263_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082937.1|2799294_2801955_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2802068_2803424_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2803469_2803793_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|2803789_2805088_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001298859.1|2805481_2807023_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2807037_2807784_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001350770.1|2816157_2818731_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|2818860_2819592_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079096.1|2819588_2820569_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2820703_2821441_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2821710_2822052_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2822155_2822203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|2822301_2823462_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|2823504_2824626_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168025.1|2824636_2825707_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2825916_2826282_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2826430_2826949_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|2826938_2828165_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2828180_2828663_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2828739_2829087_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2829128_2829896_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2829926_2830475_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2830493_2830742_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2830878_2832240_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2832406_2833198_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2833218_2834505_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|2834559_2835153_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2835275_2836154_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2836239_2837901_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2838049_2838391_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2838452_2838743_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2838732_2839209_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2839340_2839823_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2840356:2840401	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000391794.1|2840523_2841006_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|2841032_2841251_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_001011796.1|2841319_2842420_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980413.1|2842416_2842902_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001282804.1|2842898_2845976_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|2845968_2846088_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281014.1|2846102_2846405_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	5.9e-39
WP_001207660.1|2846459_2846975_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046126.1|2846984_2848157_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_000356478.1|2848291_2848894_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.9	3.6e-88
WP_000104760.1|2848893_2850519_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	66.2	6.4e-188
WP_001086836.1|2850515_2851121_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000268284.1|2851113_2852022_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_000177573.1|2852008_2852368_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	4.7e-51
WP_001096009.1|2852364_2852943_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	2.1e-93
WP_000400690.1|2853081_2854782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000829140.1|2854837_2855296_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	2.2e-61
WP_001039934.1|2855288_2855720_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	91.6	4.2e-70
WP_001080935.1|2855815_2856244_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_000727853.1|2856240_2856618_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001396370.1|2856619_2857093_-	lysozyme	NA	E5G6N1	Salmonella_phage	89.7	5.4e-79
WP_000171568.1|2857112_2857328_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2857331_2857535_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673520.1|2857534_2857999_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000059196.1|2858094_2858745_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.4	2.8e-110
WP_000742511.1|2858748_2859807_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216229.1|2859823_2860657_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	4.1e-122
WP_001098431.1|2860799_2862566_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520349.1|2862565_2863600_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.4	6.5e-170
WP_000008839.1|2863647_2865057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2865378_2865612_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|2865622_2865811_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_000104172.1|2868401_2869259_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	2.3e-157
WP_000752624.1|2869255_2869483_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
WP_001244228.1|2869482_2869716_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000996717.1|2869783_2870125_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956176.1|2870242_2870539_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460849.1|2870546_2871056_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
WP_000102105.1|2871088_2871331_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932272.1|2871452_2872085_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.9	4.8e-59
WP_000218401.1|2872087_2873107_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	92.9	1.4e-185
WP_001244285.1|2873111_2874335_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	38.8	3.6e-74
WP_000183405.1|2875075_2875864_+	hypothetical protein	NA	NA	NA	NA	NA
2874452:2874497	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000174562.1|2875951_2876245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|2876455_2877229_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|2878280_2880170_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|2880423_2880915_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|2880917_2881361_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|2881332_2881935_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|2881934_2882678_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000539246.1|2882681_2883266_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|2883256_2884315_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|2884301_2884727_-	hypothetical protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|2884726_2885275_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|2885274_2886354_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|2886350_2887679_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|2887739_2889575_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|2889716_2889986_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2889985_2890342_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|2890341_2891838_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|2891821_2891992_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|2892000_2892561_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|2892557_2893064_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|2893038_2893449_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|2893445_2893769_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2893771_2893972_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|2894021_2895227_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|2895241_2895892_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|2895869_2897111_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|2897110_2897293_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|2897304_2898801_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2899034_2899529_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|2899654_2900005_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_000026993.1|2900107_2900548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001332386.1|2900654_2900906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|2900976_2901414_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|2901410_2901887_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000606308.1|2902329_2902665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|2902850_2903603_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|2903616_2904606_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|2904613_2905411_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|2905430_2905820_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|2905816_2906143_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|2906139_2906793_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|2906792_2907287_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|2907283_2908225_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|2908214_2908394_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|2908569_2909121_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|2909164_2909365_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2909455_2910130_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|2910332_2910845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|2911313_2911676_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|2911741_2912566_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|2912693_2913218_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|2913326_2914193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2914234_2914441_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|2914401_2915574_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 9
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	2991234	2998374	5074586		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|2991234_2993796_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001141302.1|2993901_2994558_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	1.1e-50
WP_001296319.1|2994608_2995376_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|2995571_2996480_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|2996476_2997739_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|2997735_2998374_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	4859883	4869907	5074586	transposase	Klebsiella_phage(12.5%)	9	NA	NA
WP_001514408.1|4859883_4861386_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
WP_001299662.1|4861515_4862535_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_000594911.1|4863348_4864173_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4864221_4864794_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000747102.1|4864894_4865245_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|4865164_4866316_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000177060.1|4867367_4867625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4868182_4868950_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4868950_4869907_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 11
NZ_CP026853	Escherichia coli strain MS7163 chromosome, complete genome	5074586	4995600	5044529	5074586	portal,tail,integrase,terminase,holin	Enterobacteria_phage(43.48%)	56	4994802:4994816	5024325:5024339
4994802:4994816	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_001218287.1|4995600_4996815_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|4997190_4998186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206727.1|4998753_4999374_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.1	2.6e-118
WP_001242728.1|4999373_4999736_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|4999726_5000263_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081290.1|5000390_5001215_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000135682.1|5001280_5001643_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001311077.1|5002365_5003058_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|5003155_5003416_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526665.1|5003408_5003960_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001087313.1|5003956_5005108_+	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	99.2	1.6e-214
WP_000620695.1|5005104_5005329_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	4.8e-38
WP_000061487.1|5005325_5006144_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_000055034.1|5006146_5006635_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.4e-85
WP_000210132.1|5006634_5006961_+	LexA repressor	NA	U5P451	Shigella_phage	96.3	1.1e-51
WP_000767093.1|5006957_5007347_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.1e-68
WP_001061398.1|5007366_5008164_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
WP_106919443.1|5008171_5009161_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.4	4.7e-194
WP_001047084.1|5009174_5009927_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.4	1.1e-131
WP_016230663.1|5010198_5010288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087756.1|5010342_5010555_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|5010855_5011071_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|5011823_5012039_+|holin	holin	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189904.1|5012043_5012595_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	50.6	4.2e-35
WP_001306174.1|5012542_5012803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|5012916_5013450_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071776.1|5013446_5013944_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|5014307_5014520_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|5014530_5014719_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|5014866_5015022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|5015194_5015368_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|5015663_5015870_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000349509.1|5016422_5016914_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934113.1|5016913_5019016_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|5019012_5019225_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|5019224_5020733_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001097050.1|5022789_5023113_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|5023105_5023381_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001079398.1|5023964_5024366_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
5024325:5024339	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_024166561.1|5025179_5025566_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_001161009.1|5025574_5025904_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_087902893.1|5025875_5028941_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
WP_000447253.1|5028940_5029270_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_087902894.1|5029279_5029978_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	6.2e-132
WP_014639529.1|5029983_5030727_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_106919444.1|5030624_5031272_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	1.6e-110
WP_106919445.1|5033126_5033402_+	hypothetical protein	NA	A5LH43	Enterobacteria_phage	98.9	2.3e-42
WP_064572329.1|5034876_5035476_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	2.6e-102
WP_000235978.1|5038204_5038909_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000355601.1|5038919_5039213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836768.1|5040346_5040580_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_001372053.1|5040648_5040762_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|5041188_5041437_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5041656_5043243_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5043635_5044241_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5044367_5044529_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 1
NZ_CP026855	Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence	84078	0	4678	84078		Sodalis_phage(25.0%)	6	NA	NA
WP_013307862.1|258_564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001134388.1|567_1494_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|1878_2127_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|2123_2561_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457510.1|2560_3832_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	1.7e-143
WP_000587689.1|4051_4678_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
>prophage 2
NZ_CP026855	Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence	84078	24185	25547	84078		Aeromonas_phage(100.0%)	1	NA	NA
WP_001168171.1|24185_25547_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	A0A219YBC2	Aeromonas_phage	42.9	1.1e-23
>prophage 3
NZ_CP026855	Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence	84078	31022	35084	84078		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000842456.1|31022_35084_+	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.4	2.3e-16
>prophage 4
NZ_CP026855	Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence	84078	54462	54930	84078		Moraxella_phage(100.0%)	1	NA	NA
WP_000598962.1|54462_54930_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	34.9	4.0e-18
>prophage 5
NZ_CP026855	Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence	84078	61777	63675	84078		Pandoravirus(50.0%)	2	NA	NA
WP_001043260.1|61777_62593_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_021529707.1|63201_63675_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	34.4	1.8e-18
>prophage 6
NZ_CP026855	Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence	84078	71799	72714	84078	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000038334.1|71799_72714_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.7e-66
>prophage 7
NZ_CP026855	Escherichia coli strain MS7163 plasmid pMS7163B, complete sequence	84078	75764	80398	84078		Escherichia_phage(25.0%)	6	NA	NA
WP_000977998.1|75764_76361_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	56.6	6.9e-15
WP_001276270.1|76357_77077_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001578018.1|77073_77508_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001401579.1|77562_79521_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.9	8.6e-22
WP_001401999.1|79579_79813_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.3	3.3e-05
WP_021532391.1|79870_80398_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	72.6	1.0e-46
