The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	225472	276784	2912017	tRNA,transposase	Streptococcus_phage(33.33%)	52	NA	NA
WP_002303667.1|225472_226813_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_002288234.1|226998_228063_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002288233.1|228059_229145_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_002288232.1|229157_230135_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_002288231.1|230127_231072_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_002322895.1|231393_232047_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.3	1.1e-58
WP_002294163.1|232131_233037_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002294161.1|233038_233671_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002293357.1|233990_234515_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
WP_002289309.1|234586_234787_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002289310.1|234839_235199_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002289312.1|235450_236788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289314.1|236835_238965_+	hydantoinase	NA	NA	NA	NA	NA
WP_002289315.1|238939_239629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289316.1|240036_240723_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002315615.1|240858_241053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289317.1|241102_241543_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002289318.1|241546_242392_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002294157.1|242540_243959_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002289860.1|244015_244963_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002289862.1|245185_245536_-	peptidase	NA	NA	NA	NA	NA
WP_002294156.1|245735_246815_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002287837.1|246958_247279_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287838.1|247300_247765_+	universal stress protein	NA	NA	NA	NA	NA
WP_002294153.1|247969_248575_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_002294152.1|248613_249903_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
WP_002287841.1|250330_250810_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002296569.1|250894_251404_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	34.8	2.8e-17
WP_002296570.1|251503_252154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291914.1|252604_253543_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_002291912.1|253555_254608_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296392.1|254873_255509_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002296391.1|255699_256491_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_106914351.1|256970_257879_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002295755.1|257934_258432_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002340421.1|258468_259152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296262.1|259498_259765_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002296261.1|259791_260091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296259.1|260264_260816_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|260961_261255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304106.1|261247_261544_+	peptidase	NA	NA	NA	NA	NA
WP_002296256.1|261618_262617_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|262708_263662_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294735.1|263760_264477_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002296623.1|264675_265971_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_025478783.1|266017_268066_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_002294732.1|269275_270517_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_002294730.1|270663_271299_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_002294728.1|271489_272230_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002296909.1|272374_274012_-	membrane protein	NA	NA	NA	NA	NA
WP_002346735.1|274144_275104_-|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|275605_276784_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	732045	828966	2912017	portal,integrase,transposase,head,terminase,holin,tail,capsid,protease	Enterococcus_phage(23.91%)	108	733928:733987	832491:832526
WP_000195429.1|732045_733218_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
733928:733987	attL	GGCTCTTTGTCAATAAGGACTGATGGGTTGTACAAAATCAAATCTGGGTCAGAATGAACC	NA	NA	NA	NA
WP_002297185.1|734009_735305_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
733928:733987	attL	GGCTCTTTGTCAATAAGGACTGATGGGTTGTACAAAATCAAATCTGGGTCAGAATGAACC	NA	NA	NA	NA
WP_002287017.1|735613_736426_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002305412.1|736588_736696_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002320736.1|736753_737821_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	28.9	3.6e-38
WP_002296936.1|737962_738166_+	DUF3173 family protein	NA	NA	NA	NA	NA
WP_002287015.1|738225_739428_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	28.5	1.1e-32
WP_002287014.1|740076_741207_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.3	6.0e-84
WP_000222572.1|741320_742274_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002287002.1|742582_742975_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287001.1|743002_744343_+	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	25.6	9.1e-07
WP_002286999.1|745534_747145_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.4	2.3e-145
WP_002294057.1|747436_748306_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002294056.1|748470_749742_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002290332.1|749738_751034_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_002290330.1|751132_751396_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002296225.1|751840_752290_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002289225.1|752346_753765_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002289226.1|753764_754625_+	ketose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002289227.1|754798_755572_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002289228.1|755718_756084_+	DUF2512 family protein	NA	NA	NA	NA	NA
WP_002294047.1|756231_757440_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289230.1|757458_757737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289231.1|757929_758586_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289232.1|759027_759825_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_002289233.1|759821_761006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289234.1|761030_762278_-	virion core protein	NA	NA	NA	NA	NA
WP_002294042.1|762492_764238_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	36.3	1.9e-49
WP_002292337.1|764257_764572_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002296223.1|764596_765193_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002294039.1|765256_765901_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|765915_766245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288071.1|766258_767197_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|767232_768057_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|768049_768397_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|768465_769338_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|769446_770568_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|770621_771224_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|771538_773728_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
WP_002304285.1|774053_774821_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.2	8.0e-32
WP_002288087.1|774810_776853_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002288113.1|777133_777283_+	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_002288089.1|777293_778808_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9KZV5	Tupanvirus	28.5	3.4e-42
WP_002288090.1|778804_780010_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	30.7	1.4e-19
WP_002288092.1|780054_780288_+	D-alanine--poly(phosphoribitol) ligase subunit DltC	NA	NA	NA	NA	NA
WP_002288094.1|780290_781559_+	D-alanyl-lipoteichoic acid biosynthesis protein DltD	NA	NA	NA	NA	NA
WP_002288096.1|781699_782782_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_002288098.1|782781_783585_+	DUF975 family protein	NA	NA	NA	NA	NA
WP_002288100.1|783654_784395_+	MBL fold metallo-hydrolase	NA	S4VYV9	Pandoravirus	26.3	3.9e-07
WP_002288102.1|784405_785410_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_002297185.1|785503_786799_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288103.1|786976_788821_-	membrane protein	NA	NA	NA	NA	NA
785422:786935	attR	GGCTCTTTGTCAATAAGGACTGATGGGTTGTACAAAATCAAATCTGGGTCAGAATGAACCTCATTCTGGCTCAGATTTTTTGTTATCTTACTTTGATTAATTGATTGATCAAAAAGATTCTAATTCTCATGTTCTCAAATGATTTAAATCCGTAGGATACTCGTTTCATTGTCTTTATATGGGTATTCTTCGCTTCTATTTTTCCATTGGTGTAAGGATAGATCATCGCGTTGGTGATGCCTTCTTCATAGGTCAGAAGGTTTTGGAGCTTTTCCCGAAAGCCGTCATCTAACGTTTCGGGAAGTTCTGCCAATAAGGAGAAAAATAAGTCAGGGTCTTTGTCTCGAAAGGCTTCAACTAATTCATGAAAATAGGGATACGCCTCCTTCAGGGACGTAGAAAAGCCAAGCAATCGATCAATCATCATCGCTTCCGTAAGAAATGGGTATTTTGGTGCTCGAAAACTTTTCCATGTTTTGTATTCATAATGGTTGATGTTTGCACGATTTTTTAGCAAAAAGCGCCAGTTCTTTTTCAGTTTTTCTGCCTGACTTTTCTGTCCTACTTTACGAAGTTCATTCATTTCACGGATACGCAACTCATTAAAGGCTTGATTCATGTGTTTGATAATATGAAACCGATCAATCACTACTTTCGCATTTGGCAGAATACGTTTGGTAAGCTGGAAGTAGGCGGCGTTCATGTCTGTGACTAAAAATTTTACTTCTTCAGGATTAGCGCAGCCTAAGAAATAGCTTGTTAATCGAGGCAATTTACGCGTAGGCAAGACATCAATTAATTGTCCTGTTTCGCCATCTGCGCAAATAAAGCTCATTTTATCTTCTATGGAAGCGTGCGAACGAAATTCATCAACCATCAATACTCTGGGGAGAATCCTCTTAGATTGCTTTGGTAAGTAGCTTTTAAACTCTTTCAACGTACGAATAACGGTGGTCAAAGATACCTGACAATTTTTCGCAATAAAAGATAAAGATACTTTTTCAGTCAGTAAAGAAGCAATTTTATATCTGACATGATTCGCGATTGAATGTCTGGGTTGAACAAAATAACTTTGAGCCGTCCAATGGGTTCGACAGTTTTTACAGGTATAGCGCTGCTTTTTTAAGCGCATAACCAAAGGCATGTGATTGTATTGTTCAAAGCGGACAATCGTTTCCTTCTTCCCATTTTTCACTACAATTACTTTCCCGTTTCCATCTACCACAGTAGAACCACAATTTCTACAGGTATGGGGAGCAGGTGAGAAAACAGCATCGACGATCAACGTCTTTTTCTTCTGAAAGGTCTCGTAAGAGACCTCTGTAATCATCAAATCTTTCTCTATTAATCGCAGCATTTTTTTGATAGAATCATTCATATAGCATATCGTCCTCTCAGTTGTTTATTTTGTCGTGATTTAATCATACTAGAGAACGATATGTTTTTTAATACCTAAAATAAAAATGGGGCTGAAGAATCAATTCTGATTCATCAGTCCCATAAATTATAGAGCC	NA	NA	NA	NA
WP_002299609.1|789032_789551_+	signal peptidase I	NA	NA	NA	NA	NA
785422:786935	attR	GGCTCTTTGTCAATAAGGACTGATGGGTTGTACAAAATCAAATCTGGGTCAGAATGAACCTCATTCTGGCTCAGATTTTTTGTTATCTTACTTTGATTAATTGATTGATCAAAAAGATTCTAATTCTCATGTTCTCAAATGATTTAAATCCGTAGGATACTCGTTTCATTGTCTTTATATGGGTATTCTTCGCTTCTATTTTTCCATTGGTGTAAGGATAGATCATCGCGTTGGTGATGCCTTCTTCATAGGTCAGAAGGTTTTGGAGCTTTTCCCGAAAGCCGTCATCTAACGTTTCGGGAAGTTCTGCCAATAAGGAGAAAAATAAGTCAGGGTCTTTGTCTCGAAAGGCTTCAACTAATTCATGAAAATAGGGATACGCCTCCTTCAGGGACGTAGAAAAGCCAAGCAATCGATCAATCATCATCGCTTCCGTAAGAAATGGGTATTTTGGTGCTCGAAAACTTTTCCATGTTTTGTATTCATAATGGTTGATGTTTGCACGATTTTTTAGCAAAAAGCGCCAGTTCTTTTTCAGTTTTTCTGCCTGACTTTTCTGTCCTACTTTACGAAGTTCATTCATTTCACGGATACGCAACTCATTAAAGGCTTGATTCATGTGTTTGATAATATGAAACCGATCAATCACTACTTTCGCATTTGGCAGAATACGTTTGGTAAGCTGGAAGTAGGCGGCGTTCATGTCTGTGACTAAAAATTTTACTTCTTCAGGATTAGCGCAGCCTAAGAAATAGCTTGTTAATCGAGGCAATTTACGCGTAGGCAAGACATCAATTAATTGTCCTGTTTCGCCATCTGCGCAAATAAAGCTCATTTTATCTTCTATGGAAGCGTGCGAACGAAATTCATCAACCATCAATACTCTGGGGAGAATCCTCTTAGATTGCTTTGGTAAGTAGCTTTTAAACTCTTTCAACGTACGAATAACGGTGGTCAAAGATACCTGACAATTTTTCGCAATAAAAGATAAAGATACTTTTTCAGTCAGTAAAGAAGCAATTTTATATCTGACATGATTCGCGATTGAATGTCTGGGTTGAACAAAATAACTTTGAGCCGTCCAATGGGTTCGACAGTTTTTACAGGTATAGCGCTGCTTTTTTAAGCGCATAACCAAAGGCATGTGATTGTATTGTTCAAAGCGGACAATCGTTTCCTTCTTCCCATTTTTCACTACAATTACTTTCCCGTTTCCATCTACCACAGTAGAACCACAATTTCTACAGGTATGGGGAGCAGGTGAGAAAACAGCATCGACGATCAACGTCTTTTTCTTCTGAAAGGTCTCGTAAGAGACCTCTGTAATCATCAAATCTTTCTCTATTAATCGCAGCATTTTTTTGATAGAATCATTCATATAGCATATCGTCCTCTCAGTTGTTTATTTTGTCGTGATTTAATCATACTAGAGAACGATATGTTTTTTAATACCTAAAATAAAAATGGGGCTGAAGAATCAATTCTGATTCATCAGTCCCATAAATTATAGAGCC	NA	NA	NA	NA
WP_002288107.1|789678_790362_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_002288109.1|790902_791262_+	DUF1304 family protein	NA	NA	NA	NA	NA
WP_002340354.1|791384_793016_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_002289449.1|793077_793719_-	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_002289450.1|794000_794309_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002289451.1|794335_794680_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002289452.1|794692_794986_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002301539.1|795078_796227_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	40.1	3.0e-67
WP_002305409.1|796238_796550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002321996.1|796602_796998_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002305405.1|797033_797378_-	helix-turn-helix transcriptional regulator	NA	A0A126GGL0	Streptococcus_phage	52.6	1.2e-24
WP_002349274.1|797678_797900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305403.1|798026_798803_+	hypothetical protein	NA	B2ZYU5	Staphylococcus_phage	54.8	2.8e-72
WP_002305401.1|798799_798994_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.9	1.2e-08
WP_002349273.1|798995_799280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305400.1|799300_799489_+	hypothetical protein	NA	D2IZW5	Enterococcus_phage	60.3	7.4e-08
WP_002305399.1|799814_800054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305398.1|800059_800746_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	71.4	2.6e-90
WP_002305397.1|800748_801579_+	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	1.5e-52
WP_002305396.1|801595_802447_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002305394.1|802443_802803_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	3.1e-18
WP_002290675.1|802817_802979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305393.1|802975_803281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|803280_803637_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|803596_803842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305391.1|804026_804494_+	ArpU family transcriptional regulator	NA	D7RWH7	Brochothrix_phage	28.5	2.4e-07
WP_002349267.1|804768_805005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305389.1|805028_805370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020944850.1|805362_805542_-	YegP family protein	NA	NA	NA	NA	NA
WP_002305387.1|805763_806411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305386.1|806670_807015_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|807019_807301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|807403_807718_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|807695_809390_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|809409_810588_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|810550_811237_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|811236_812397_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|812406_813282_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|813278_813590_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|813579_813933_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|813922_814324_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|814316_814721_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002305379.1|814732_815338_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.6	1.1e-33
WP_002286510.1|815357_815720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|815722_815905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305374.1|815921_819341_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	41.5	8.7e-78
WP_106914364.1|819391_820129_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002305372.1|820138_822430_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.2	1.7e-90
WP_002305370.1|822453_824544_+	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	49.6	9.6e-88
WP_002286491.1|824706_825153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|825154_825292_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|825329_825623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|825619_825844_+|holin	holin	holin	NA	NA	NA	NA
WP_002286484.1|825840_826866_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|827804_828966_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
832491:832526	attR	AAGTGTCTGTTTATCCAGTAGCTCAAGAAGCTTAAT	NA	NA	NA	NA
>prophage 3
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	867310	942894	2912017	portal,integrase,transposase,head,terminase,holin,tRNA,tail,capsid,protease	Enterococcus_phage(26.32%)	90	924572:924587	927923:927938
WP_002286621.1|867310_870109_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|870157_871684_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|871698_872346_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|872529_872859_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|873035_873764_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|873779_874793_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|874792_876070_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|876132_878835_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|878986_879304_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|879333_879654_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|879761_881222_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|881289_881511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|881541_881724_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|881723_882137_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|882259_883441_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286587.1|883971_885111_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|885409_886045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|886157_886793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|886826_887288_-	DUF4429 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002296613.1|887417_887849_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|887866_888187_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|888485_889262_+	phage antirepressor protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|889276_889480_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002317757.1|889495_889816_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002351655.1|889997_890780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105459839.1|890845_891538_+	phage regulatory protein	NA	D2IZW4	Enterococcus_phage	41.3	2.3e-38
WP_060809376.1|891715_892057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074394502.1|892049_892721_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.8	5.5e-29
WP_002335419.1|892726_893413_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.5	1.1e-88
WP_106914365.1|893485_894664_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_105459878.1|894743_895604_+	replication protein	NA	A0A1S5SFJ6	Streptococcus_phage	66.7	2.4e-48
WP_002343405.1|895615_895885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|896046_896349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|896345_896507_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|896503_896809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|896808_897165_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002296604.1|897124_897370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|897366_897786_+	hypothetical protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|897782_898340_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|898336_898633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|898709_899123_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002300143.1|899580_899856_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|900309_900516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|900711_900879_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|900904_901249_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|901253_901535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|901636_901951_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|901928_903623_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|903642_904821_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|904783_905470_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|905469_906630_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|906639_907515_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|907511_907823_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|907812_908166_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|908155_908557_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|908549_908954_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|908965_909574_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|909593_909956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305377.1|909958_910141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286502.1|910157_913589_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|913639_914377_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002296595.1|914386_916678_+	hypothetical protein	NA	A0A1D3SNL1	Enterococcus_phage	30.0	1.6e-88
WP_002286495.1|916701_918828_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002286491.1|918990_919437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|919438_919576_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|919613_919907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|919903_920128_+|holin	holin	holin	NA	NA	NA	NA
WP_002286484.1|920124_921150_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|922089_923251_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|924174_924582_+	hypothetical protein	NA	NA	NA	NA	NA
924572:924587	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|924595_924997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|924998_925370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|925405_925708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286470.1|925956_926157_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002286469.1|926461_927694_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|927947_928517_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
927923:927938	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002286465.1|928694_929135_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|929292_930057_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|930088_931012_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|931087_932227_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|932219_933020_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|933019_933847_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|933824_934559_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|934658_935525_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|935538_936111_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002296544.1|936132_937161_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.2	2.2e-69
WP_002294531.1|937258_938110_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.3e-38
WP_002296543.1|938144_940178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060805065.1|940221_941502_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002297218.1|941598_942894_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 4
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	967939	1093279	2912017	tRNA,transposase,protease	Streptococcus_phage(35.42%)	115	NA	NA
WP_002296623.1|967939_969235_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_106914367.1|969723_970677_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	7.4e-35
WP_000997695.1|971749_972928_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296840.1|973160_974348_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002296840.1|974783_975971_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002289162.1|976117_977740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289161.1|978006_979176_-	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_002289159.1|979379_980555_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289156.1|980690_981170_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002292871.1|981338_982070_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289154.1|982066_983134_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002289153.1|983140_983773_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289151.1|983912_984578_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002303172.1|984605_984899_+	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289148.1|984966_985914_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002289147.1|986091_986895_-	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002317368.1|987040_987955_+	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002292862.1|988002_988473_+	GtrA family protein	NA	NA	NA	NA	NA
WP_002295401.1|988557_989166_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292860.1|989299_989500_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295400.1|990253_991480_+	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296956.1|991587_992058_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002292856.1|992379_992958_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_002295399.1|993131_994514_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002295398.1|994620_995418_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002296955.1|995410_996589_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002290817.1|996682_997216_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002290819.1|997293_997728_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002301399.1|997893_998853_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002354485.1|999257_999944_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000751236.1|1000068_1000521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000718009.1|1000534_1001224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|1001348_1003700_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_002304891.1|1003779_1004175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|1004499_1005117_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000366408.1|1005157_1005457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824191.1|1005490_1005658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321606.1|1005702_1006308_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	36.9	2.0e-25
WP_000343406.1|1006432_1009420_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.3	7.3e-206
WP_029756604.1|1010070_1010427_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	60.9	3.4e-25
WP_005228365.1|1010940_1011108_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	64.0	8.1e-14
WP_002405437.1|1011195_1013136_-	tetracycline resistance ribosomal protection protein Tet(S)	NA	A0A2K5B2A5	Erysipelothrix_phage	78.7	6.0e-294
WP_002354485.1|1013808_1014495_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002354485.1|1015367_1016054_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001096887.1|1016140_1016935_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000627290.1|1017027_1017570_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001255866.1|1017566_1018475_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000662263.1|1018507_1019242_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_000233000.1|1019222_1020092_-	hypothetical protein	NA	A0A1X9I6C9	Streptococcus_phage	90.7	6.7e-152
WP_000205227.1|1020106_1020331_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002390960.1|1020473_1022018_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	88.7	1.8e-256
WP_000323438.1|1022037_1022454_-	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	98.6	1.2e-71
WP_002354485.1|1022590_1023277_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000599739.1|1023474_1024080_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_000170424.1|1024095_1024668_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_073120187.1|1025140_1025713_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_086953888.1|1025813_1026976_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002322130.1|1027016_1027271_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_000199136.1|1027381_1027636_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|1027828_1028104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|1028075_1029029_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_000947691.1|1029640_1031134_+	replication protein RepR	NA	NA	NA	NA	NA
WP_000053907.1|1031268_1031565_+	replication control protein PrgN	NA	NA	NA	NA	NA
WP_000222573.1|1031588_1032548_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	7.5e-11
WP_002354485.1|1033404_1034091_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002354485.1|1035286_1035973_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002295395.1|1037026_1038403_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002295394.1|1038803_1040384_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002297218.1|1040560_1041856_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002287661.1|1042103_1042328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290825.1|1042532_1042853_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002287598.1|1043000_1045235_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_002287602.1|1045713_1045980_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002287603.1|1045979_1047707_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	35.9	9.3e-20
WP_002287604.1|1047837_1048917_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002287605.1|1048933_1050157_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002287606.1|1050245_1051133_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002287607.1|1051218_1051449_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_002287608.1|1051505_1052471_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_002287610.1|1052776_1053217_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287612.1|1053226_1054189_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002287614.1|1054241_1054466_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002296950.1|1054572_1055490_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002287617.1|1055501_1056239_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	4.1e-17
WP_106914368.1|1056257_1057493_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002287620.1|1057495_1057972_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002287621.1|1057996_1058416_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002287622.1|1058423_1059803_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002287623.1|1059803_1060673_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_002287624.1|1060665_1061451_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_002287626.1|1061630_1062158_+	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_002302927.1|1062154_1063264_+	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_002287630.1|1063279_1063591_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002322947.1|1063603_1064251_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	33.2	4.8e-22
WP_002287635.1|1064234_1064828_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_033582077.1|1064884_1065208_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_002287639.1|1065211_1065952_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002287640.1|1066168_1067320_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002287641.1|1067450_1068170_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287642.1|1068348_1068996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287644.1|1069088_1071368_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002287647.1|1071645_1073469_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.1	6.5e-64
WP_002287649.1|1073515_1073695_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_002287651.1|1074031_1075972_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.2	3.3e-114
WP_002287653.1|1076195_1077044_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302928.1|1077337_1079491_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_002297218.1|1079723_1081019_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296740.1|1081198_1082008_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002295362.1|1082300_1083737_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	3.8e-43
WP_002290958.1|1083906_1085103_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002295359.1|1085164_1085350_-	YjzD family protein	NA	NA	NA	NA	NA
WP_002311576.1|1085580_1088895_+	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.0	1.8e-149
WP_002304759.1|1089062_1090025_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002295355.1|1090098_1091883_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000122610.1|1091986_1093279_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
>prophage 5
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	1106699	1157789	2912017	transposase	Lysinibacillus_phage(25.0%)	47	NA	NA
WP_002297185.1|1106699_1107995_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002317647.1|1108316_1109192_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002288811.1|1109295_1110060_+	carbohydrate deacetylase	NA	NA	NA	NA	NA
WP_002298714.1|1110076_1111489_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002288815.1|1112842_1113301_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_045136022.1|1113592_1114894_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002295336.1|1114920_1115181_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002288819.1|1116179_1117415_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_002288821.1|1117981_1118809_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002288823.1|1119081_1119852_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_045136021.1|1120069_1121137_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_010728432.1|1121154_1121616_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002324626.1|1121635_1123120_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_045136020.1|1123162_1123462_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002288832.1|1123476_1124115_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_002289048.1|1124119_1124980_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002295327.1|1124969_1125680_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002289050.1|1125911_1126346_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289065.1|1126442_1126742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1127045_1128224_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289063.1|1128356_1128551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295324.1|1128778_1129540_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002307018.1|1129859_1130105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002307017.1|1130288_1131038_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.7	7.1e-17
WP_044383301.1|1131223_1131928_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002307014.1|1131967_1132525_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_106914365.1|1132989_1134168_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002307011.1|1135016_1135448_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_010728428.1|1135461_1136907_+	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
WP_010728427.1|1137192_1138818_+	acetyltransferase	NA	A0A193GZ69	Enterobacter_phage	30.6	4.3e-19
WP_002307007.1|1139449_1139803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101699706.1|1141855_1143034_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002297404.1|1143927_1145178_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288285.1|1145587_1145887_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_044383392.1|1145959_1147321_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288318.1|1147342_1147603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288278.1|1147616_1148369_+	aldolase	NA	NA	NA	NA	NA
WP_002294361.1|1148462_1149068_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002297941.1|1149123_1150098_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_077940815.1|1150475_1151255_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294365.1|1151321_1152593_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002297943.1|1152745_1154143_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002289467.1|1154223_1154664_+	universal stress protein	NA	NA	NA	NA	NA
WP_002289468.1|1154810_1155137_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289470.1|1155137_1155887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302217.1|1155912_1156323_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002297271.1|1156829_1157789_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	1301005	1310143	2912017		unidentified_phage(16.67%)	9	NA	NA
WP_002348948.1|1301005_1302394_+	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.0	7.0e-10
WP_002297115.1|1302557_1302935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1303190_1303919_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1303918_1304173_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1304174_1304846_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1304846_1307069_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1307053_1308493_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002321731.1|1308524_1309568_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1309564_1310143_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 7
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	1582284	1624126	2912017	transposase,protease	Lysinibacillus_phage(16.67%)	51	NA	NA
WP_002297218.1|1582284_1583580_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002290686.1|1583798_1584041_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002295944.1|1584072_1584630_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002295945.1|1584642_1584831_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002295947.1|1584843_1585410_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002287525.1|1585844_1586993_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1587009_1587414_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002295138.1|1588530_1589004_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_002295139.1|1589012_1589240_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002295142.1|1589875_1590247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1590502_1590745_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1590776_1591679_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1591691_1591880_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1591893_1592457_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002296675.1|1592494_1593388_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	8.9e-59
WP_002296674.1|1593465_1594404_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1594437_1594788_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1594820_1595723_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1595715_1596573_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002296669.1|1596906_1597716_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1597755_1598253_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1598897_1599221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1599384_1599639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1599708_1599954_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296662.1|1600029_1600395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1600455_1601019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|1601670_1602966_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002302440.1|1603204_1604506_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002293303.1|1604609_1604810_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296656.1|1605561_1606275_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1606267_1607353_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1607369_1607813_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1607846_1608200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1608311_1608713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1608749_1609259_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1609280_1610138_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1610155_1610989_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1611002_1611800_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1611832_1612117_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1612113_1613115_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_102993993.1|1613116_1614019_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.0	1.8e-51
WP_002296639.1|1614182_1615031_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1615675_1615882_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1616083_1617085_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1617089_1619003_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_002296634.1|1619170_1619677_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1619836_1620277_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1620302_1621460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296631.1|1621462_1621819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1622116_1623091_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_102993991.1|1623286_1624126_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	1627277	1660069	2912017	transposase,integrase	Streptococcus_phage(30.0%)	32	1631568:1631583	1641289:1641304
WP_002287107.1|1627277_1628528_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296760.1|1628669_1629665_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1629682_1630237_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289422.1|1630224_1630716_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289421.1|1630708_1632577_-	HTH domain-containing protein	NA	NA	NA	NA	NA
1631568:1631583	attL	AAAGGATACTTTTTTT	NA	NA	NA	NA
WP_002289420.1|1632595_1633396_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289418.1|1633619_1633835_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1633973_1634459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1634914_1635328_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002322258.1|1635464_1635725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321532.1|1635842_1636133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1636378_1637557_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_060804964.1|1637712_1638666_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002288357.1|1638722_1639850_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_010729348.1|1640067_1641210_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.4	4.5e-39
WP_010729347.1|1641214_1641400_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
1641289:1641304	attR	AAAAAAAGTATCCTTT	NA	NA	NA	NA
WP_002353648.1|1641753_1641999_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729346.1|1641992_1642394_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_010729345.1|1642580_1644389_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	48.4	2.3e-154
WP_010729344.1|1644411_1646178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729343.1|1646190_1646985_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_010729700.1|1646994_1648371_-	MFS transporter	NA	NA	NA	NA	NA
WP_010729341.1|1648490_1649138_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_010729340.1|1649221_1650649_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_010729339.1|1650722_1651802_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_010729338.1|1651804_1653436_-	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010729337.1|1653739_1654411_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002287525.1|1654727_1655876_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1655892_1656297_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_000122610.1|1657091_1658384_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_159037556.1|1658526_1658724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|1658896_1660069_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 9
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	1697718	1753507	2912017	tRNA,transposase	Lysinibacillus_phage(20.0%)	52	NA	NA
WP_002288335.1|1697718_1698420_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002297218.1|1698624_1699920_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288333.1|1700165_1700606_-	lipoprotein	NA	NA	NA	NA	NA
WP_002288331.1|1700734_1701661_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	41.3	5.1e-33
WP_002288329.1|1701660_1703034_-	Replication initiation and membrane attachment	NA	NA	NA	NA	NA
WP_002288327.1|1703056_1703548_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002288325.1|1703859_1704192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288324.1|1704243_1704873_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002288323.1|1704836_1705673_-	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.2	1.8e-24
WP_002296395.1|1705717_1708363_-	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.7	3.0e-54
WP_002296397.1|1708488_1709172_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002296398.1|1709164_1709650_-	dehydratase	NA	NA	NA	NA	NA
WP_002303667.1|1710058_1711399_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_002296400.1|1711498_1712833_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002296401.1|1712963_1713725_-	YdcF family protein	NA	NA	NA	NA	NA
WP_002296402.1|1713740_1714223_-	SprT family protein	NA	NA	NA	NA	NA
WP_002296403.1|1714242_1716423_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002296404.1|1716566_1717298_-	serine/threonine protein phosphatase	NA	A7KV25	Bacillus_phage	30.8	1.7e-15
WP_002296405.1|1717366_1718308_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_002296407.1|1718487_1718856_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_002297218.1|1719218_1720514_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002295194.1|1720988_1722380_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002291995.1|1722592_1722979_-	DUF1149 family protein	NA	NA	NA	NA	NA
WP_002295196.1|1723034_1723658_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002295197.1|1723721_1724390_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002322028.1|1724401_1724842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295199.1|1724900_1725572_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_002287525.1|1725757_1726906_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1726922_1727327_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002295200.1|1727647_1728046_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_002296408.1|1728042_1728816_-	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
WP_002296409.1|1728812_1729496_-	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
WP_002289130.1|1729662_1730550_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002289132.1|1730546_1731416_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002289133.1|1731552_1732839_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002289134.1|1733111_1733690_+	response regulator	NA	NA	NA	NA	NA
WP_002289135.1|1733689_1734619_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002289136.1|1734615_1736352_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.6	5.0e-21
WP_002289137.1|1736414_1737251_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_002289138.1|1737247_1737757_-	shikimate kinase	NA	NA	NA	NA	NA
WP_002289139.1|1737749_1739045_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002289140.1|1739057_1740149_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002289142.1|1740165_1741332_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.3	1.6e-39
WP_002289143.1|1741333_1742398_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_002289144.1|1742430_1743453_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_002289516.1|1744111_1745086_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_002289518.1|1745066_1746950_-	glycoside hydrolase family 2	NA	L0N6M2	Herpes_simplex_virus	34.4	1.1e-98
WP_002296412.1|1746967_1749193_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002296414.1|1749307_1750342_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296415.1|1750408_1751422_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	23.3	7.9e-11
WP_002288466.1|1751499_1751688_-	hypothetical protein	NA	A0A218MNE0	uncultured_virus	50.9	2.6e-08
WP_002297185.1|1752211_1753507_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 10
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	1838668	1891230	2912017	tRNA,transposase,protease	unidentified_phage(14.29%)	52	NA	NA
WP_002347409.1|1838668_1840378_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1840445_1841714_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_106914070.1|1841874_1842675_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1842671_1843484_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002293875.1|1843678_1844236_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1844238_1844961_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1845096_1845978_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1846076_1846859_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1847217_1847697_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326249.1|1847913_1849005_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002293884.1|1848997_1849783_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002293885.1|1850128_1851820_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.8	9.9e-75
WP_002288434.1|1852241_1853189_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1853303_1854323_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1854413_1855643_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1856103_1856805_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297185.1|1856976_1858272_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002301319.1|1858935_1859952_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1859948_1860413_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288446.1|1860419_1860962_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1860945_1861770_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1861858_1862839_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1862862_1864347_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1864358_1865348_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1865595_1865763_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1865824_1867636_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1867632_1867998_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1868160_1868556_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1868573_1869536_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1869535_1869748_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1869768_1870467_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1870486_1871029_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1871160_1872165_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293904.1|1872161_1873151_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1873147_1873954_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_002293906.1|1874119_1875076_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1875152_1875671_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1875758_1875908_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1876135_1876582_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1876776_1878672_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1878996_1879971_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1880536_1881103_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296334.1|1881358_1882690_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1882655_1883006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297629.1|1883097_1883517_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296337.1|1883517_1883862_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1884127_1885087_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1885276_1885873_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1885996_1887796_+	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1888073_1888286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1889149_1890109_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1890321_1891230_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	1896220	1954250	2912017	tRNA,transposase	Streptococcus_phage(33.33%)	56	NA	NA
WP_002288577.1|1896220_1896706_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1896728_1897487_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1897502_1898681_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1898910_1901031_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002297218.1|1901211_1902507_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296838.1|1902775_1903501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1903490_1904000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1904069_1905518_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1905517_1906234_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1906214_1906565_-	SdpI family protein	NA	NA	NA	NA	NA
WP_106914072.1|1906708_1907482_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1908238_1908541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1908822_1910001_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1910337_1910577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1910938_1911199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1911383_1911881_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1912010_1912721_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1912733_1914398_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1914602_1915265_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1915274_1916090_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1916351_1916795_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1916928_1917267_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1917254_1917632_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|1917855_1919049_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1919214_1919637_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1920226_1920682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1920843_1922016_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1925146_1927474_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002288970.1|1928316_1928610_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002286913.1|1928867_1929215_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1929350_1930112_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1930101_1930623_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1930792_1931584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1931708_1931960_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1931971_1932247_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1932499_1933054_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1933132_1933654_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1933657_1934236_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1934347_1935766_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1935786_1936125_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1936084_1936588_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1936718_1937423_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|1937419_1939156_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1939258_1941730_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002326707.1|1942002_1943277_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002289807.1|1943563_1944454_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1944650_1945133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1945340_1945706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|1945928_1947101_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_106914372.1|1947071_1947446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301399.1|1948187_1949147_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002301623.1|1949269_1950244_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1950653_1951904_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1952189_1952447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1952678_1953092_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002295743.1|1953341_1954250_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	2066899	2114424	2912017	transposase,holin	Streptococcus_phage(30.77%)	50	NA	NA
WP_002289566.1|2066899_2067250_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002322015.1|2067249_2067567_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_002289495.1|2067866_2069435_-	daptomycin-sensing surface protein LiaX	NA	NA	NA	NA	NA
WP_002289493.1|2069534_2070302_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_106914373.1|2070298_2071318_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002289490.1|2071567_2072245_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002326757.1|2072257_2073016_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	6.9e-20
WP_002289486.1|2073031_2073838_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.8e-13
WP_002326758.1|2073852_2074737_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002292761.1|2074736_2075657_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002292763.1|2075771_2076629_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_002304589.1|2076965_2078414_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002317241.1|2078565_2079459_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002292768.1|2079442_2080129_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.7	2.5e-29
WP_096157771.1|2080233_2081335_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002289770.1|2081460_2083995_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002289771.1|2084216_2084768_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002304587.1|2084895_2085615_-	ComF family protein	NA	NA	NA	NA	NA
WP_002290048.1|2085611_2086925_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	37.9	1.4e-63
WP_002292778.1|2087005_2087326_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002294988.1|2087433_2087721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304585.1|2087846_2088491_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	50.8	4.6e-49
WP_002292782.1|2088549_2089257_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288997.1|2090017_2090251_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_002288998.1|2090367_2091252_-	ROK family protein	NA	NA	NA	NA	NA
WP_002294994.1|2091336_2091804_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289000.1|2091988_2092285_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	58.0	3.0e-19
WP_002289019.1|2092419_2092596_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_002289003.1|2092608_2093910_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002289004.1|2094006_2094237_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|2094535_2095831_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_049058656.1|2096085_2097381_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.7	5.5e-09
WP_060804931.1|2097622_2098921_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.4	9.6e-54
WP_002289005.1|2099291_2099714_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_002289006.1|2099727_2101134_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_060805069.1|2101156_2102059_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_002317884.1|2102072_2103629_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_002292794.1|2103651_2104194_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_002292796.1|2104180_2104705_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_002292797.1|2104795_2105011_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_002300474.1|2105063_2105783_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002292799.1|2106084_2106549_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	58.5	1.0e-45
WP_002312230.1|2106570_2108928_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.7	6.8e-98
WP_002289016.1|2108930_2109677_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002289017.1|2109788_2110025_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_002296443.1|2110142_2110421_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_002317887.1|2110533_2111502_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002326761.1|2111784_2112693_+	purine nucleosidase	NA	NA	NA	NA	NA
WP_002287522.1|2112854_2113259_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|2113275_2114424_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
>prophage 13
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	2181722	2187395	2912017	portal,head,terminase,tail,capsid	uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_002296483.1|2181722_2182058_-|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296484.1|2182044_2182329_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296485.1|2182384_2183908_-|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296486.1|2183900_2185076_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002317249.1|2185079_2185265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296487.1|2185230_2186925_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002296488.1|2186921_2187395_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
>prophage 14
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	2412313	2445765	2912017	bacteriocin,transposase,protease	uncultured_virus(15.38%)	31	NA	NA
WP_002296840.1|2412313_2413501_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288864.1|2413913_2415539_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	56.8	2.2e-156
WP_002288862.1|2415589_2415874_-	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	40.2	2.0e-12
WP_002288860.1|2416098_2416761_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002288858.1|2416836_2418129_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288856.1|2418298_2418928_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2419030_2419840_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002288853.1|2419894_2420764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288852.1|2420764_2422081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288851.1|2422077_2423913_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	4.0e-37
WP_002288850.1|2423917_2424622_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002288847.1|2424811_2425672_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	2.7e-12
WP_002322652.1|2425658_2426228_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|2426857_2427811_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002321654.1|2427807_2427954_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002287810.1|2428057_2428369_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002304799.1|2428370_2428568_-	enterocin	NA	NA	NA	NA	NA
WP_002287807.1|2428961_2430689_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_002287805.1|2430681_2431875_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-29
WP_002287801.1|2432061_2432706_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002290587.1|2432799_2432934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287799.1|2432935_2435068_-	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_002287797.1|2435064_2435538_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_002287795.1|2435938_2436163_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	42.7	1.7e-11
WP_002287793.1|2436321_2438481_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.2	3.8e-265
WP_002287792.1|2438530_2439496_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.4	3.4e-128
WP_002287791.1|2439584_2440724_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002287788.1|2441032_2441746_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	43.7	6.5e-20
WP_002287787.1|2441999_2442701_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002290558.1|2442934_2444467_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	3.3e-45
WP_002295743.1|2444856_2445765_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	2739594	2796672	2912017	tRNA,transposase,integrase	Streptococcus_phage(63.64%)	47	2747999:2748014	2794082:2794097
WP_002287490.1|2739594_2740578_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_002287492.1|2740993_2741764_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287494.1|2741756_2742692_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	35.1	6.1e-26
WP_106914381.1|2743285_2744935_-	DNA mismatch repair protein MutS	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	29.2	6.4e-18
WP_002287497.1|2745129_2746026_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002287499.1|2746018_2746699_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	1.1e-24
WP_002287500.1|2746699_2747482_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002287502.1|2747474_2748392_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.8	4.6e-42
2747999:2748014	attL	TCTTTGCTTTCTTTTT	NA	NA	NA	NA
WP_002287509.1|2748394_2748679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305526.1|2749466_2752694_+	fibrinogen-binding MSCRAMM adhesin Fss3	NA	NA	NA	NA	NA
WP_002303694.1|2752805_2753120_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	51.5	1.9e-24
WP_002302502.1|2753132_2753507_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	63.9	6.4e-35
WP_002305525.1|2753507_2753861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330682.1|2753929_2754946_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	58.7	3.6e-104
WP_002330681.1|2755539_2757414_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_096929203.1|2757539_2757896_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	84.6	1.3e-45
WP_002302494.1|2757940_2759083_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.4	1.6e-129
WP_002305523.1|2759617_2760802_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	63.2	8.3e-145
WP_002302478.1|2760798_2760912_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002298822.1|2760940_2761162_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	87.7	4.5e-28
WP_002302474.1|2761174_2761678_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	60.4	2.0e-52
WP_002302472.1|2761804_2762842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303688.1|2762856_2764554_+	ThiF family protein	NA	NA	NA	NA	NA
WP_002302466.1|2764546_2765008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302464.1|2765020_2765881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106914388.1|2765918_2766296_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	2.7e-41
WP_106914365.1|2766324_2767503_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002302460.1|2767627_2770075_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.4	0.0e+00
WP_002302459.1|2770079_2772188_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.9	4.5e-178
WP_002302457.1|2772184_2773189_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	64.8	5.6e-118
WP_002302456.1|2773207_2774119_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	41.1	3.0e-62
WP_002297343.1|2774780_2774996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094029191.1|2775254_2775422_-|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	75.0	4.4e-12
WP_002303678.1|2777753_2778425_-	hypothetical protein	NA	A0A0C5K996	Enterococcus_phage	33.9	4.1e-08
WP_010727027.1|2778773_2780225_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	46.1	1.9e-18
WP_002303673.1|2780336_2781680_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_106914382.1|2781813_2787270_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002303670.1|2787886_2788192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303669.1|2788336_2789542_-	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_002302419.1|2790235_2790622_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002302418.1|2790719_2790911_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002305515.1|2791424_2791757_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002303668.1|2791666_2791870_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_002348988.1|2792053_2792209_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002303667.1|2792484_2793825_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.0	5.1e-66
WP_002330794.1|2795797_2796016_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2794082:2794097	attR	TCTTTGCTTTCTTTTT	NA	NA	NA	NA
WP_106914383.1|2796036_2796672_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.2e-17
>prophage 16
NZ_CP027501	Enterococcus faecium strain AUSMDU00004142 chromosome, complete genome	2912017	2825111	2885699	2912017	transposase,integrase,protease	Streptococcus_phage(22.22%)	46	2832836:2832851	2853301:2853316
WP_002351803.1|2825111_2826431_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_002303714.1|2827171_2828152_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_002302368.1|2828164_2829043_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_002303713.1|2829058_2829859_-	TrmB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002303711.1|2831250_2831577_+|transposase	transposase	transposase	Q9JMN8	Wolbachia_phage	34.6	8.1e-10
WP_002303710.1|2831584_2832493_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
2832836:2832851	attL	CTTTGTAAATACTCAA	NA	NA	NA	NA
WP_071875986.1|2833121_2833373_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_002302358.1|2833914_2834073_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002303709.1|2834144_2835371_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002287505.1|2835459_2835852_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002295975.1|2835867_2836311_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002297290.1|2836829_2837297_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_076713753.1|2837416_2838955_-	gluconokinase	NA	NA	NA	NA	NA
WP_002288144.1|2839034_2839721_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288119.1|2839921_2840449_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288121.1|2840532_2841210_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288122.1|2841206_2842337_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	1.6e-73
WP_002288124.1|2842336_2844520_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288127.1|2844516_2845542_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288129.1|2845586_2846414_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002288131.1|2846410_2847478_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288133.1|2847503_2848340_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288134.1|2848336_2849206_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288135.1|2849275_2850559_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002288137.1|2850572_2852258_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288139.1|2852532_2853558_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
2853301:2853316	attR	TTGAGTATTTACAAAG	NA	NA	NA	NA
WP_002340553.1|2854152_2857806_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.9	1.1e-62
WP_025479755.1|2857884_2861511_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.6	4.5e-48
WP_002289394.1|2862229_2863198_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048946534.1|2863215_2864121_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289388.1|2864117_2864924_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_010706310.1|2865080_2866049_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_002289384.1|2866365_2866890_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_060804656.1|2867176_2868931_+	collagen-binding MSCRAMM adhesin Scm	NA	NA	NA	NA	NA
WP_002296623.1|2869037_2870333_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002289380.1|2870596_2871583_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002304808.1|2871605_2872172_-	Gx transporter family protein	NA	NA	NA	NA	NA
WP_002294810.1|2872185_2872602_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_002289023.1|2873058_2874993_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002289025.1|2875294_2876230_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_002294811.1|2876319_2877423_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002289029.1|2877435_2878389_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002289031.1|2879323_2880670_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_021415055.1|2880803_2882045_-	U32 family peptidase	NA	Q6DW11	Phage_TP	32.9	1.2e-42
WP_002289033.1|2882062_2882986_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_002289035.1|2883206_2885699_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A0A8J958	Klebsiella_phage	38.3	9.0e-125
>prophage 1
NZ_CP027502	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence	168778	25323	127866	168778	integrase,transposase,holin	Paenibacillus_phage(17.24%)	95	58611:58670	130562:130807
WP_002340487.1|25323_26283_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	1.1e-35
WP_002311551.1|26776_27064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311552.1|27081_27504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033583488.1|27523_29116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002316755.1|29371_29566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|29701_30952_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002311557.1|31361_33734_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	28.9	1.1e-10
WP_002353044.1|33794_35255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353045.1|35265_35709_+	topoisomerase	NA	NA	NA	NA	NA
WP_002340482.1|35793_37470_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	51.1	2.1e-117
WP_002295629.1|37715_38312_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002340481.1|38324_39224_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002295625.1|39732_39990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311565.1|40148_40283_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|40425_40686_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002295619.1|41134_41341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293542.1|41340_41592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311567.1|41607_42045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293546.1|42725_43121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002314432.1|43102_43369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340480.1|43378_43612_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_002335346.1|43954_44137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340479.1|44126_44348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086956687.1|44388_45550_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002290556.1|46341_47109_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002290555.1|47597_48023_+	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290554.1|48039_48555_+	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002340477.1|48565_49498_+	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002290551.1|49500_50481_+	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002290550.1|50508_50826_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002340476.1|50825_52532_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002290548.1|52673_54080_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.0	3.6e-46
WP_002305107.1|54102_54375_+	DUF3884 family protein	NA	NA	NA	NA	NA
WP_002303235.1|54395_55295_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_106914390.1|55766_56929_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	5.9e-79
WP_106914391.1|57625_58804_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
58611:58670	attL	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGC	NA	NA	NA	NA
WP_002326839.1|58928_59837_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300833.1|60239_62186_+	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_002300835.1|62188_62644_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|62657_63986_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|64019_64304_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|64305_64821_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|64836_65499_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|65505_66078_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002300843.1|66264_67785_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|68027_68213_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|68196_68379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|69332_69932_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|69995_70595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305879.1|71610_72483_-	ROK family protein	NA	NA	NA	NA	NA
WP_002352509.1|72746_74693_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|74877_76317_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|76318_77281_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_002297218.1|77486_78782_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.1	1.0e-42
WP_086953894.1|78972_80399_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|80641_81097_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_106914392.1|81682_81913_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|82142_82961_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|83121_83811_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|83824_85327_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|85339_85816_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|86313_87476_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|88593_89112_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|91187_92273_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|92380_93334_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_106914393.1|93464_94715_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|94733_95660_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|95738_96734_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|96749_97919_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|97934_98669_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|99439_100602_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301811.1|101170_102463_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|102736_102997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317769.1|103169_104342_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000997695.1|104579_105758_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002300493.1|105920_107090_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002300494.1|107414_108734_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|108730_109384_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002348630.1|110512_111229_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_016922460.1|111352_111538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|113144_114176_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|114182_115013_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002302265.1|115009_115816_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|115821_116646_-	type I phosphodiesterase/nucleotide pyrophosphatase	NA	NA	NA	NA	NA
WP_002302268.1|116635_117736_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|117913_118699_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|118731_119115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|119190_119322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322470.1|119290_119527_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002302275.1|119604_120576_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002340465.1|121227_122850_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.5	2.7e-122
WP_002301195.1|123135_124512_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|124511_125168_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|125177_126455_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_102829665.1|126704_127866_+|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
130562:130807	attR	CAACCAATCTAATCGAGTCTTTCAATAAGCAAATTAAAAGATACAGCCGTAGAAAAGAGCAGTTTCAAAATGAAGAATCACTAGAACGCTTTCTAGTCAGCATTTTTGATACATACAATCAAAAATTTCTAAACAGAAGCCATAAAGGTTTTCAACAGGTAACCGATACATTAGTTTCAATGTTTACTGAGTAACTAATTATTTTGCAGGAGGACAATTTATTTACACAAAATTATTGACGCTCCC	NA	NA	NA	NA
>prophage 1
NZ_CP027504	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed3	36024	10888	25631	36024	transposase	Streptococcus_phage(66.67%)	14	NA	NA
WP_001224538.1|10888_11506_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_000366408.1|11546_11846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000824191.1|11879_12047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321606.1|12091_12697_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000343406.1|12821_15809_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	38.3	7.3e-206
WP_029756604.1|16459_16816_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	60.9	3.4e-25
WP_005228365.1|17329_17497_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	64.0	8.1e-14
WP_002405437.1|17584_19525_-	tetracycline resistance ribosomal protection protein Tet(S)	NA	A0A2K5B2A5	Erysipelothrix_phage	78.7	6.0e-294
WP_002354485.1|20197_20884_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002354485.1|21756_22443_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001096887.1|22529_23324_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000627290.1|23416_23959_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001255866.1|23955_24864_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000662263.1|24896_25631_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
>prophage 2
NZ_CP027504	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed3	36024	28981	35413	36024	transposase	Bacillus_phage(42.86%)	8	NA	NA
WP_001015311.1|28981_29662_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000170424.1|30479_31052_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_073120187.1|31524_32097_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_086953888.1|32197_33360_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002322130.1|33400_33655_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_000199136.1|33765_34020_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|34212_34488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|34459_35413_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
>prophage 1
NZ_CP027505	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed4, complete sequence	30710	1656	9330	30710	transposase	Streptococcus_phage(57.14%)	8	NA	NA
WP_002354485.1|1656_2343_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001814874.1|2482_2566_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_106914398.1|2690_3392_+	23S ribosomal RNA methyltransferase Erm	NA	E4ZFQ0	Streptococcus_phage	99.1	2.4e-123
WP_002354485.1|3425_4112_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001280781.1|4812_5508_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|5485_6640_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_000122610.1|6737_8030_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_001059542.1|8361_9330_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
