The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	42922	58795	2883877	transposase	Streptococcus_phage(83.33%)	16	NA	NA
WP_101706165.1|42922_44176_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	28.4	9.1e-17
WP_002301399.1|44162_45122_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_000421279.1|45980_46295_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
WP_001234191.1|46315_46693_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
WP_000185761.1|46702_47476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001130244.1|47497_48901_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.5	2.2e-176
WP_000426689.1|49082_50267_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
WP_000055376.1|50263_50554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009054.1|50550_50772_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000675717.1|50813_51593_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_000425404.1|51653_52154_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.0	1.7e-54
WP_000248477.1|52209_52848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000723887.1|52919_53315_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
WP_000331165.1|53298_55752_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.9	0.0e+00
WP_000192393.1|55748_57776_+	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	65.3	5.1e-195
WP_000768373.1|57772_58795_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
>prophage 2
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	63422	70750	2883877	integrase	Streptococcus_phage(57.14%)	9	59789:59802	74128:74141
59789:59802	attL	TTGATAAAAAATTG	NA	NA	NA	NA
WP_000868795.1|63422_63920_-	trimethoprim-resistant dihydrofolate reductase DfrG	NA	G3MBI7	Bacillus_virus	49.1	4.0e-40
WP_001803271.1|65440_65608_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	62.0	2.3e-13
WP_001227350.1|65665_66019_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
WP_010924747.1|66250_66361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000675479.1|66489_66972_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	8.5e-48
WP_000845143.1|66968_67199_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
WP_000633907.1|67696_67897_+	DUF3173 family protein	NA	NA	NA	NA	NA
WP_000237797.1|67923_69117_+|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
WP_002298578.1|69184_70750_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	30.6	3.5e-18
74128:74141	attR	CAATTTTTTATCAA	NA	NA	NA	NA
>prophage 3
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	139003	180879	2883877	transposase,tRNA	Faecalibacterium_phage(20.0%)	39	NA	NA
WP_002287909.1|139003_139300_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|139654_140011_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002287911.1|140020_140920_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_002326691.1|141316_142396_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	36.2	9.2e-50
WP_002296745.1|142825_143557_+	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_002345015.1|143701_145729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311353.1|145836_146934_+	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|147089_148277_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002287917.1|148715_149174_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000997695.1|149271_150450_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|151583_152537_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002290500.1|152689_153424_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.4	1.4e-25
WP_002297153.1|153750_154161_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|154153_154855_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002321200.1|154854_156441_+	M protein trans-acting positive regulator	NA	NA	NA	NA	NA
WP_002290506.1|156459_156681_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297149.1|156677_157439_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	5.5e-17
WP_002297147.1|157818_158328_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_002297145.1|158402_158942_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|159081_159693_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002304049.1|160008_160806_+	formate/nitrite transporter	NA	NA	NA	NA	NA
WP_002297142.1|160833_161469_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|161488_162262_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297139.1|162669_163467_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297137.1|163444_163858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297135.1|163841_166487_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002297134.1|166504_168613_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002294256.1|168634_169195_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297133.1|169279_171268_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|171490_172204_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|172280_172727_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_060806767.1|172896_173499_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|173511_174513_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002289813.1|174541_175120_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289814.1|175171_175654_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|175770_176145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|176574_177753_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002294246.1|178226_179579_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002326691.1|179799_180879_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	36.2	9.2e-50
>prophage 4
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	264593	310044	2883877	transposase	unidentified_phage(42.86%)	40	NA	NA
WP_002297218.1|264593_265889_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289312.1|266169_267507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302676.1|267554_269684_+	hydantoinase	NA	NA	NA	NA	NA
WP_002289315.1|269658_270348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002315615.1|271577_271772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289317.1|271821_272262_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002289318.1|272265_273111_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002294157.1|273259_274678_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002289860.1|274734_275682_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002289862.1|275904_276255_-	peptidase	NA	NA	NA	NA	NA
WP_002294156.1|276454_277534_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002287837.1|277677_277998_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287838.1|278019_278484_+	universal stress protein	NA	NA	NA	NA	NA
WP_002294153.1|278688_279294_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_002294152.1|279332_280622_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
WP_002287841.1|281049_281529_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002287843.1|282352_283522_+|transposase	IS256-like element ISEfa13 family transposase	transposase	NA	NA	NA	NA
WP_002287844.1|283821_284514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974289.1|285024_286104_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002287845.1|286334_286727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154067201.1|287098_287266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287847.1|287308_287884_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	54.5	4.4e-51
WP_159037555.1|289574_291047_+	glutamate:gamma-aminobutyrate antiporter	NA	NA	NA	NA	NA
WP_002287852.1|291059_292460_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_002301399.1|298391_299351_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002298774.1|299486_300461_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002312606.1|300442_300904_+	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298777.1|300953_301418_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002298779.1|301431_302181_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002312607.1|302180_303011_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298781.1|303010_303658_+	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002312609.1|303755_304532_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002312610.1|304675_305635_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002323668.1|305751_306060_+	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002312614.1|306086_306386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312616.1|306559_307111_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_002296258.1|307256_307550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312617.1|307542_307839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002312618.1|307909_308914_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002301399.1|309084_310044_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
>prophage 5
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	895420	988593	2883877	tail,protease,holin,integrase,plate,capsid,head,portal,transposase,tRNA,terminase	Streptococcus_phage(33.93%)	103	911176:911216	956430:956470
WP_002296623.1|895420_896716_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002320964.1|896821_898090_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	1.9e-54
WP_002297196.1|898362_900834_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002297195.1|900936_902673_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002293705.1|902669_903374_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297194.1|903504_904008_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293708.1|903967_904306_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293709.1|904326_905745_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293710.1|905856_906435_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002297192.1|906438_906960_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293714.1|907038_907593_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002290274.1|907845_908121_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002290277.1|908132_908384_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002297190.1|908508_909300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293716.1|909469_909991_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002293717.1|909980_910742_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002286913.1|910877_911225_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
911176:911216	attL	TACGTGCATTACACGGAAAAGCTGCTCGTATCAAAGAAATC	NA	NA	NA	NA
WP_077974390.1|911356_912493_-|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	37.1	1.7e-54
WP_077974389.1|912608_913523_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_070676686.1|913613_914042_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002337457.1|914046_914421_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	44.6	6.9e-21
WP_002315391.1|914706_914892_+	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002325021.1|914903_915152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|915182_915362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|915404_915875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|915961_916660_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|916837_917179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|917171_917843_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_077974388.1|917848_918535_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	68.6	7.0e-88
WP_079200755.1|918537_919368_+	replication protein	NA	C9E2N2	Enterococcus_phage	43.9	2.6e-52
WP_002323158.1|919383_920235_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002317837.1|920231_920591_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	1.1e-18
WP_079200798.1|920763_921069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200797.1|921068_921380_+	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	56.0	2.0e-26
WP_079200796.1|921546_921963_+	DNA-packaging protein	NA	D2IZL0	Enterococcus_phage	54.0	6.9e-30
WP_079200795.1|921962_922631_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	45.7	1.5e-21
WP_101706191.1|922627_923005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200794.1|923001_923301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002318885.1|923542_923959_+	autolysin	NA	C9E2P5	Enterococcus_phage	68.1	4.8e-47
WP_002287522.1|924310_924715_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|924731_925880_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_060809367.1|926409_926598_+	hypothetical protein	NA	F0PII8	Enterococcus_phage	83.3	2.2e-20
WP_060809366.1|926587_926848_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	50.0	1.0e-15
WP_060809365.1|926888_927116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200793.1|927180_927753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974384.1|927753_928065_+	HNH endonuclease	NA	A0A1S5SFB3	Streptococcus_phage	59.2	6.3e-28
WP_071244186.1|928055_928316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073357560.1|928476_928836_+	hypothetical protein	NA	A0A2H4JAH7	uncultured_Caudovirales_phage	67.2	5.2e-34
WP_073357561.1|928832_930476_+|terminase	terminase large subunit	terminase	A0A1S5SF58	Streptococcus_phage	65.3	1.8e-206
WP_158182303.1|930510_931593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073357563.1|931636_932809_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	46.6	6.8e-83
WP_002371767.1|932795_933500_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	45.9	9.5e-48
WP_071244203.1|933504_934665_+|capsid	phage major capsid protein	capsid	D2XR18	Bacillus_phage	39.7	8.3e-65
WP_002371763.1|934740_935019_+	hypothetical protein	NA	A0A1W6JQ66	Staphylococcus_phage	48.2	1.8e-13
WP_073357576.1|934999_935371_+|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	55.4	1.2e-28
WP_073357564.1|935386_935791_+	hypothetical protein	NA	A0A2H4J7V9	uncultured_Caudovirales_phage	38.5	7.7e-18
WP_077974383.1|935787_936198_+	hypothetical protein	NA	A0A059T681	Listeria_phage	48.0	1.6e-23
WP_077974382.1|936258_936846_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	41.0	1.6e-35
WP_002371755.1|936918_937386_+	Ig domain-containing protein	NA	C9E2K1	Enterococcus_phage	43.9	8.1e-19
WP_002337251.1|937431_937740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974380.1|937934_944669_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	36.6	2.0e-17
WP_002342059.1|944672_945545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974378.1|946129_946591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200791.1|946594_947419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200790.1|947436_949479_+|plate	BppU family phage baseplate upper protein	plate	A0A096XSZ6	Enterococcus_phage	46.8	2.0e-82
WP_002332429.1|949638_950085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002327992.1|950086_950224_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|950260_950554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|950550_950775_+|holin	holin	holin	NA	NA	NA	NA
WP_079200789.1|950771_951791_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002286474.1|952967_953375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|953388_953790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|953791_954163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|954237_955539_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_101706188.1|955699_955999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070647711.1|956004_956235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286921.1|956851_957514_+	hypothetical protein	NA	NA	NA	NA	NA
956430:956470	attR	TACGTGCATTACACGGAAAAGCTGCTCGTATCAAAGAAATC	NA	NA	NA	NA
WP_002286925.1|960931_961246_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286926.1|961258_961633_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002305701.1|961633_961987_+	DNA-damage-inducible protein J	NA	NA	NA	NA	NA
WP_002286930.1|962057_963410_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002286932.1|963469_964612_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|964636_964891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|965146_966331_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|966327_966465_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|967210_969121_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|969224_969449_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002288934.1|969461_969962_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002288935.1|970058_971906_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002297208.1|971908_972805_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|972854_973244_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002321772.1|973230_975576_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002296840.1|975668_976856_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002289059.1|977156_979286_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002289057.1|979282_980290_+	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289055.1|980306_981218_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289053.1|981345_982074_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002321361.1|982070_983480_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289051.1|983807_984929_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|985348_985585_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002343922.1|985537_986491_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305710.1|986829_987339_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087040414.1|987431_988593_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
>prophage 6
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1002504	1058250	2883877	transposase,tRNA,integrase	Streptococcus_phage(50.0%)	50	996116:996131	1010474:1010489
996116:996131	attL	AATGTAATAGGTGATT	NA	NA	NA	NA
WP_002299190.1|1002504_1004052_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002300928.1|1004918_1005233_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|1005336_1006515_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002288970.1|1006916_1007210_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002305732.1|1008052_1010380_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002352916.1|1010505_1010835_+	hypothetical protein	NA	NA	NA	NA	NA
1010474:1010489	attR	AATCACCTATTACATT	NA	NA	NA	NA
WP_158003446.1|1010874_1011879_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002288979.1|1011875_1012322_+	cell wall anchor	NA	NA	NA	NA	NA
WP_002288981.1|1012471_1013287_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_010721614.1|1013492_1014665_+	class C sortase	NA	NA	NA	NA	NA
WP_010721943.1|1014826_1015321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010721616.1|1015903_1016326_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_010721617.1|1016491_1017685_-	MFS transporter	NA	NA	NA	NA	NA
WP_002302962.1|1017908_1018286_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016631212.1|1018745_1019189_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_010721620.1|1019449_1020265_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_077974320.1|1020274_1020937_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002297645.1|1021144_1022809_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_077974323.1|1022821_1023532_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|1023661_1024159_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|1024343_1024604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|1024965_1025205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|1025490_1025805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288592.1|1026775_1027549_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|1027692_1028043_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002293942.1|1028023_1028740_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|1028739_1030188_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|1030257_1030767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297641.1|1030756_1031482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002333083.1|1031704_1033825_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	1.7e-220
WP_002322842.1|1034054_1035233_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
WP_002326253.1|1035248_1036007_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	6.5e-26
WP_002288577.1|1036029_1036515_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288576.1|1036585_1037839_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|1037956_1039306_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|1039417_1040764_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|1041071_1041458_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002312603.1|1041681_1043145_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.3e-125
WP_002311774.1|1044181_1045141_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002297633.1|1046003_1046216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|1046493_1048293_-	glycerophosphoryl diester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|1048416_1049013_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287760.1|1049204_1050158_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296337.1|1050429_1050774_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296336.1|1050774_1051194_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1051285_1051636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021415240.1|1051601_1052822_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296332.1|1053187_1053754_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997695.1|1054998_1056177_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002322125.1|1056786_1058250_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	2.0e-124
>prophage 7
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1229846	1258263	2883877	transposase,tRNA,integrase	Streptococcus_phage(22.22%)	27	1229699:1229716	1267311:1267328
1229699:1229716	attL	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002297218.1|1229846_1231142_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288335.1|1231346_1232048_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|1232044_1233166_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|1233180_1234413_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|1234544_1235453_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002305633.1|1235487_1235760_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|1235770_1236817_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002326691.1|1237127_1238207_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	36.2	9.2e-50
WP_002301554.1|1238456_1241066_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002288350.1|1241216_1241888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|1241880_1242375_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|1242394_1243615_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|1243761_1245597_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288357.1|1245690_1246818_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|1246874_1247828_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079200781.1|1247983_1249162_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321532.1|1249407_1249698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002322258.1|1249815_1250076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1250212_1250626_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|1251081_1251567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289418.1|1251705_1251921_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002346994.1|1252144_1252945_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.6	3.4e-09
WP_002289421.1|1252963_1254832_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|1254824_1255316_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|1255303_1255858_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289425.1|1255875_1256871_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1257012_1258263_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
1267311:1267328	attR	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
>prophage 8
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1311749	1379693	2883877	transposase,integrase	Enterococcus_phage(18.18%)	60	1351317:1351333	1374820:1374836
WP_002295743.1|1311749_1312658_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002347026.1|1313469_1315509_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002295931.1|1315617_1316769_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002288181.1|1316922_1317453_-	membrane protein	NA	NA	NA	NA	NA
WP_002288180.1|1317551_1317902_-	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
WP_002288179.1|1318058_1319588_-	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.0	3.9e-38
WP_002288178.1|1319597_1320161_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_002288176.1|1320304_1320967_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106913985.1|1321150_1322797_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002303246.1|1322787_1323870_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002305261.1|1326945_1328025_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002301992.1|1328127_1328568_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288163.1|1328624_1329035_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_002301993.1|1329214_1329649_-	VOC family protein	NA	NA	NA	NA	NA
WP_002303243.1|1329748_1330597_-	YitT family protein	NA	NA	NA	NA	NA
WP_002301996.1|1330985_1332752_+	alpha-glycosidase	NA	NA	NA	NA	NA
WP_002288159.1|1332853_1334113_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002288157.1|1334259_1335561_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288156.1|1335563_1336415_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002295923.1|1336427_1337243_+	maltodextrose utilization protein MalA	NA	NA	NA	NA	NA
WP_002295921.1|1337393_1338560_+	class I SAM-dependent methyltransferase	NA	A0A2K9L4K8	Tupanvirus	39.3	1.6e-47
WP_002297185.1|1338718_1340014_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002295919.1|1340311_1340959_+	lipoprotein	NA	NA	NA	NA	NA
WP_002295918.1|1341042_1341987_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.4	5.2e-65
WP_002295917.1|1342121_1343573_+	amidase	NA	NA	NA	NA	NA
WP_002295916.1|1343593_1344430_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_106913986.1|1344429_1345089_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002298443.1|1345214_1345904_+	hypothetical protein	NA	U5PU21	Bacillus_phage	33.2	1.1e-19
WP_002302623.1|1345909_1346866_+	sce7725 family protein	NA	NA	NA	NA	NA
WP_002302625.1|1346909_1347422_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002295911.1|1347677_1348226_-	AAA family ATPase	NA	S4W1R9	Pandoravirus	29.4	3.3e-11
WP_002295909.1|1348314_1349496_-	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_002302627.1|1349731_1351240_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
1351317:1351333	attL	AAAAAACAAAGAAAATG	NA	NA	NA	NA
WP_002295907.1|1351398_1351590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295906.1|1351792_1352710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295905.1|1352702_1353776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295904.1|1353923_1354442_+	membrane protein	NA	NA	NA	NA	NA
WP_002302628.1|1354422_1354815_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_002295900.1|1354890_1355826_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_002295898.1|1355958_1356738_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002295896.1|1356730_1357048_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_002286080.1|1357291_1358902_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002286075.1|1359058_1359907_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	37.4	9.8e-15
WP_002286073.1|1360137_1360617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286072.1|1360649_1362878_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_002286071.1|1363006_1364650_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_002286070.1|1364722_1365268_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_002286069.1|1365290_1365776_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002286068.1|1365765_1366578_-	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002295743.1|1367849_1368758_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002286066.1|1369404_1370436_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_002286065.1|1371159_1372146_+	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_002286064.1|1372294_1373635_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002286063.1|1373639_1374314_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_002286061.1|1374535_1375609_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
1374820:1374836	attR	AAAAAACAAAGAAAATG	NA	NA	NA	NA
WP_002286060.1|1375614_1376301_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.9e-29
WP_002286057.1|1376308_1376956_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029744192.1|1377028_1377814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287525.1|1378123_1379272_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1379288_1379693_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
>prophage 9
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1464430	1511574	2883877	transposase,tRNA	Lysinibacillus_phage(14.29%)	40	NA	NA
WP_002297185.1|1464430_1465726_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002295819.1|1465834_1466722_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.2	4.5e-18
WP_016171142.1|1466903_1467857_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295818.1|1468034_1470032_-	transketolase	NA	NA	NA	NA	NA
WP_002295816.1|1470133_1470385_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_002322319.1|1470522_1471155_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	59.4	2.3e-16
WP_002297436.1|1471334_1471553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287525.1|1471749_1472898_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1472914_1473319_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002295813.1|1473732_1474245_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	2.4e-32
WP_002296571.1|1474258_1476556_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	1.3e-80
WP_002295811.1|1476697_1477132_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_002296573.1|1477141_1477930_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002295809.1|1477926_1478868_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_002295807.1|1479044_1479632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296575.1|1479851_1481165_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_002289734.1|1481452_1482463_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289735.1|1482547_1483483_-	alpha/beta hydrolase	NA	W5S4D8	Pithovirus	25.4	2.0e-05
WP_002303791.1|1483668_1484628_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002295800.1|1484713_1485808_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002296283.1|1485996_1486758_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	38.0	6.7e-23
WP_002295797.1|1486872_1487313_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002295795.1|1487532_1488288_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_002296282.1|1488397_1489411_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_002295791.1|1489575_1490496_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002295789.1|1490775_1491276_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002288030.1|1491382_1491901_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002296875.1|1491901_1493257_-	ribonuclease PH	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.8	9.2e-15
WP_002317207.1|1493259_1494081_-	glutamate racemase	NA	NA	NA	NA	NA
WP_002296876.1|1494242_1494899_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002288038.1|1494914_1495562_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002288041.1|1495574_1496390_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002296877.1|1496403_1497141_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.7e-32
WP_002288045.1|1497394_1498405_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002296881.1|1498574_1500995_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002295783.1|1500999_1502043_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.6	1.9e-31
WP_002303789.1|1502351_1502693_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296885.1|1502761_1506484_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.3	2.7e-24
WP_002296887.1|1506480_1510008_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_002297218.1|1510278_1511574_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 10
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1575789	1584850	2883877		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1575789_1576368_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002321731.1|1576364_1577408_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1577439_1578879_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1578863_1581086_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1581086_1581758_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1581759_1582014_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1582013_1582742_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1582997_1583375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|1583554_1584850_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 11
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1644858	1698826	2883877	transposase,tRNA,protease	Streptococcus_phage(15.0%)	51	NA	NA
WP_002288421.1|1644858_1646259_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
WP_002288419.1|1646272_1646821_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002287107.1|1647230_1648481_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288415.1|1648640_1649546_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_086953915.1|1650856_1652196_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002320953.1|1652684_1654061_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288411.1|1654029_1656108_-	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002303743.1|1656229_1657087_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002296990.1|1657142_1657910_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002296988.1|1657902_1658763_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002288405.1|1659022_1659421_+	glyoxalase	NA	NA	NA	NA	NA
WP_002288403.1|1659657_1660200_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002294418.1|1660282_1660834_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002288398.1|1660985_1661213_-	YozE family protein	NA	NA	NA	NA	NA
WP_002288397.1|1661209_1661728_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288396.1|1661747_1662461_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002288395.1|1662463_1663360_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288394.1|1663517_1664360_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288393.1|1664491_1665145_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288392.1|1665207_1665735_-	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002294416.1|1665754_1666702_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288390.1|1666713_1668600_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002324658.1|1668764_1670837_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002290188.1|1670849_1671125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1671519_1672815_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290187.1|1673008_1673464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101706181.1|1673617_1674826_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	51.7	1.5e-45
WP_002290045.1|1674937_1675270_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_002294412.1|1675417_1676293_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.3	5.9e-63
WP_002289878.1|1676374_1676956_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_002289879.1|1676961_1678221_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002294410.1|1678222_1679269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290178.1|1679503_1679779_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	69.7	1.8e-26
WP_002296982.1|1680021_1681332_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_002294406.1|1681513_1682743_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_002303123.1|1682877_1683558_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_002294404.1|1683606_1684242_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002303122.1|1684307_1685711_-	ATP-dependent DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	6.5e-64
WP_002305295.1|1685697_1686729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294401.1|1686759_1686981_+	ferredoxin	NA	NA	NA	NA	NA
WP_002294400.1|1687145_1687883_-	thioesterase	NA	NA	NA	NA	NA
WP_002294399.1|1688035_1689376_-	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002290168.1|1689612_1691136_-	YfcC family protein	NA	NA	NA	NA	NA
WP_002296977.1|1691513_1692125_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002294391.1|1692454_1693171_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296975.1|1693176_1693746_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002305297.1|1693729_1694527_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002294387.1|1694496_1694868_-	protein RibT	NA	NA	NA	NA	NA
WP_002294386.1|1694886_1695774_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002302440.1|1696092_1697394_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002297218.1|1697530_1698826_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 12
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1722182	1795947	2883877	transposase	Lysinibacillus_phage(20.0%)	60	NA	NA
WP_077974289.1|1722182_1723262_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002289270.1|1723463_1724618_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_002289269.1|1724639_1725392_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002294372.1|1725755_1728422_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	30.1	1.6e-82
WP_002289473.1|1728762_1730214_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002289472.1|1730542_1731358_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002289474.1|1731651_1731927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289471.1|1732353_1732809_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002289470.1|1732888_1733638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289468.1|1733638_1733965_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289467.1|1734112_1734553_-	universal stress protein	NA	NA	NA	NA	NA
WP_002296967.1|1734633_1736031_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002294365.1|1736183_1737455_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_077495159.1|1737521_1738301_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288275.1|1738678_1739653_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_002288276.1|1739705_1740311_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002288278.1|1740404_1741157_-	aldolase	NA	NA	NA	NA	NA
WP_002288318.1|1741170_1741431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288281.1|1741452_1742814_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288285.1|1742886_1743186_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1743595_1744846_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002291790.1|1744988_1745321_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002297183.1|1745320_1747183_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|1747407_1748361_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|1748587_1749766_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289063.1|1749973_1750168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289065.1|1750436_1750736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289050.1|1750832_1751267_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002295327.1|1751498_1752209_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_002289048.1|1752198_1753059_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002288832.1|1753063_1753702_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_002288830.1|1753716_1754016_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303570.1|1754058_1755543_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002295331.1|1755562_1756024_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002288825.1|1756041_1757109_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_002288823.1|1757326_1758097_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002288821.1|1758369_1759197_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002288819.1|1759764_1761000_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_002295336.1|1761998_1762259_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002288817.1|1762285_1763587_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288815.1|1763878_1764337_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002303716.1|1764349_1765675_-	maltose-6'-phosphate glucosidase	NA	NA	NA	NA	NA
WP_002303569.1|1765691_1767104_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002288811.1|1767120_1767885_-	carbohydrate deacetylase	NA	NA	NA	NA	NA
WP_002288809.1|1767988_1768864_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002298265.1|1776367_1777873_-	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.1	3.9e-06
WP_002290973.1|1777869_1778556_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.2	4.8e-28
WP_002295350.1|1778748_1780170_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D8KPW3	Synechococcus_phage	31.1	4.2e-34
WP_002297185.1|1780396_1781692_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_060799217.1|1781861_1782041_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002295352.1|1782098_1782668_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_002295354.1|1782853_1783756_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295355.1|1783790_1785575_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002304759.1|1785648_1786611_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002303521.1|1786778_1790093_-	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.0	1.8e-149
WP_002295359.1|1790323_1790509_+	YjzD family protein	NA	NA	NA	NA	NA
WP_077974372.1|1790570_1791767_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002295362.1|1791936_1793373_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.0	3.8e-43
WP_002296740.1|1793665_1794475_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002297218.1|1794651_1795947_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 13
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1828000	1924821	2883877	transposase,tRNA,protease	Streptococcus_phage(21.88%)	78	NA	NA
WP_002302440.1|1828000_1829302_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287603.1|1829467_1831195_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	35.9	9.3e-20
WP_002287602.1|1831194_1831461_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002287598.1|1831939_1834174_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_002290825.1|1834321_1834642_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002295394.1|1835267_1836848_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002295395.1|1837248_1838625_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002290821.1|1838752_1839871_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002297185.1|1840383_1841679_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290817.1|1842046_1842580_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002296955.1|1842673_1843852_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002295398.1|1843844_1844642_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002295399.1|1844748_1846131_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002292856.1|1846304_1846883_-	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_077495118.1|1847204_1847675_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002295400.1|1847782_1849009_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002292860.1|1849762_1849963_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295401.1|1850096_1850705_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292862.1|1850789_1851260_-	GtrA family protein	NA	NA	NA	NA	NA
WP_002317368.1|1851307_1852222_-	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002289147.1|1852367_1853171_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002289148.1|1853348_1854296_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002289149.1|1854363_1854657_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|1854684_1855350_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002289153.1|1855489_1856122_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289154.1|1856128_1857196_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002292871.1|1857192_1857924_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289156.1|1858092_1858572_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002289159.1|1858707_1859883_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289161.1|1860086_1861256_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_002289162.1|1861522_1863145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287760.1|1864291_1865245_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002297218.1|1865737_1867033_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_079200785.1|1867255_1868551_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_079200786.1|1868735_1870031_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002347285.1|1870254_1871550_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002287105.1|1871705_1872680_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002287107.1|1873089_1874340_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1874625_1874883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008266934.1|1875114_1875528_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_086953915.1|1875806_1877146_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_000997695.1|1877255_1878434_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|1878603_1879942_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_077974309.1|1879982_1880675_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	43.4	5.2e-30
WP_002294835.1|1881111_1881681_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|1881754_1882078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|1882231_1883044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1883397_1884246_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_079200779.1|1884390_1885332_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002296533.1|1887604_1889776_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002289041.1|1889795_1891982_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	1.5e-120
WP_002289040.1|1891981_1892191_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002289038.1|1892203_1892644_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289037.1|1892717_1893257_-	transcriptional regulator	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002297185.1|1893504_1894800_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_077974307.1|1895270_1896737_-	amino acid permease	NA	NA	NA	NA	NA
WP_002296577.1|1897027_1899112_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	4.9e-116
WP_002297218.1|1899370_1900666_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288776.1|1901158_1901518_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002319756.1|1901547_1901889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288769.1|1901885_1902560_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1903735_1905034_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002296294.1|1905073_1906264_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002321579.1|1906284_1906812_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002288763.1|1906858_1909648_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002288762.1|1909794_1909995_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1910446_1910767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1911044_1912340_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_106913987.1|1912791_1913910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|1914379_1915687_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002340453.1|1915805_1917005_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002289547.1|1917031_1918300_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002291751.1|1919516_1920020_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_059355914.1|1920142_1920907_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1921014_1921290_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002312285.1|1921727_1922678_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002312284.1|1922856_1923057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|1923861_1924821_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	1956667	2021298	2883877	transposase,holin	Streptococcus_phage(31.25%)	60	NA	NA
WP_002326809.1|1956667_1957963_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002296623.1|1958220_1959516_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002287318.1|1959670_1960117_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.5	5.3e-20
WP_002287321.1|1960143_1960320_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002287322.1|1960481_1960910_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002304612.1|1961001_1961862_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002296154.1|1961953_1962247_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002299465.1|1962318_1964046_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	63.7	1.5e-211
WP_002296150.1|1964259_1965186_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.4	5.0e-89
WP_002304608.1|1965330_1966764_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002289176.1|1966763_1968167_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002299460.1|1968397_1969300_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002330765.1|1969339_1971220_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002299454.1|1971316_1972168_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002287525.1|1973518_1974667_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1974683_1975088_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002294955.1|1976987_1977212_-	YneF family protein	NA	NA	NA	NA	NA
WP_002296138.1|1977462_1979049_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002294959.1|1979114_1980890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296136.1|1981102_1982005_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.0	1.5e-21
WP_002296135.1|1982283_1984629_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002291653.1|1984965_1985967_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_002296134.1|1986176_1987283_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002296133.1|1987341_1987944_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002289575.1|1987946_1988387_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002289574.1|1988511_1989450_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	4.2e-75
WP_002296128.1|1989464_1990490_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289570.1|1990533_1991364_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002289568.1|1991378_1992317_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289566.1|1992483_1992834_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002322015.1|1992833_1993151_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_002289495.1|1993450_1995019_-	daptomycin-sensing surface protein LiaX	NA	NA	NA	NA	NA
WP_002294975.1|1995118_1995886_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002296593.1|1995882_1996914_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_002289490.1|1997151_1997829_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_002289489.1|1997841_1998600_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.2e-19
WP_002289486.1|1998615_1999422_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	1.8e-13
WP_002296590.1|1999436_2000321_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002292761.1|2000320_2001241_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002292763.1|2001355_2002213_-	phosphate ABC transporter substrate-binding protein PstS	NA	NA	NA	NA	NA
WP_002296589.1|2002549_2003998_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002317241.1|2004149_2005043_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002292768.1|2005026_2005713_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.7	2.5e-29
WP_096157771.1|2005817_2006919_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002296588.1|2007044_2009579_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002296587.1|2009800_2010352_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002299428.1|2010479_2011199_-	ComF family protein	NA	NA	NA	NA	NA
WP_002311272.1|2011195_2012509_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	37.7	4.0e-63
WP_002292778.1|2012589_2012910_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002294988.1|2013017_2013305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296584.1|2013431_2014076_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	50.8	7.9e-49
WP_002292782.1|2014135_2014843_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296583.1|2015603_2015837_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_002296582.1|2015953_2016838_-	ROK family protein	NA	NA	NA	NA	NA
WP_002296580.1|2016922_2017390_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010725912.1|2017453_2017750_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	58.0	3.0e-19
WP_002292789.1|2017884_2018061_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_002289003.1|2018073_2019375_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002289004.1|2019471_2019702_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|2020002_2021298_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 15
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	2039941	2169700	2883877	tail,integrase,capsid,head,portal,transposase,tRNA,terminase	Streptococcus_phage(13.79%)	120	2098463:2098482	2170889:2170908
WP_086953915.1|2039941_2041280_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002292812.1|2041868_2043167_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	81.5	3.6e-194
WP_002292815.1|2043282_2044038_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002295135.1|2044141_2045332_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_002292818.1|2045441_2046443_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002295134.1|2046483_2047521_-	SorC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002295132.1|2047723_2049058_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002295129.1|2049380_2050265_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_002296447.1|2050351_2051251_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_002295126.1|2051267_2051774_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002297218.1|2051978_2053274_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002292825.1|2053484_2054105_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_002296448.1|2054180_2054618_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_002295123.1|2054780_2055611_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_002295121.1|2055594_2056962_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.3	1.5e-25
WP_002295119.1|2056980_2057790_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_002295117.1|2057832_2058276_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_002295115.1|2058409_2058781_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_002295114.1|2058949_2059732_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_002296449.1|2059728_2060700_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_002296450.1|2060791_2062186_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002295106.1|2062377_2063733_-	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_002295103.1|2063762_2064398_-	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_002292842.1|2064404_2065781_-	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_002295101.1|2065773_2067555_-	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002292844.1|2067576_2067888_-	V-type ATP synthase subunit F	NA	NA	NA	NA	NA
WP_002304547.1|2067877_2068864_-	V-type ATPase subunit	NA	NA	NA	NA	NA
WP_002296452.1|2068878_2069463_-	V-type sodium ATP synthase subunit E	NA	NA	NA	NA	NA
WP_002292848.1|2069483_2069954_-	V-type ATP synthase subunit K	NA	NA	NA	NA	NA
WP_002296453.1|2069972_2071976_-	V-type ATP synthase subunit I	NA	NA	NA	NA	NA
WP_002320976.1|2071962_2072295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292852.1|2072631_2073351_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_002296455.1|2073649_2075548_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_002296456.1|2075710_2076973_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002295091.1|2076965_2077865_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.1e-23
WP_002296457.1|2078009_2079788_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002290803.1|2079969_2080284_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	40.8	3.6e-15
WP_002296458.1|2080370_2082731_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.7e-24
WP_002295087.1|2083450_2083888_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_002296459.1|2084089_2085007_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_002295084.1|2085262_2086174_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	41.1	5.3e-06
WP_002295080.1|2086576_2087155_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296462.1|2087174_2087843_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.8e-35
WP_002296464.1|2087857_2088928_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296465.1|2089098_2090463_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.7	9.3e-07
WP_002311258.1|2090459_2092019_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296469.1|2092074_2094555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301068.1|2094538_2094874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296471.1|2094887_2095922_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_002296472.1|2096011_2096692_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_002296473.1|2096975_2098079_-	L-lactate oxidase	NA	NA	NA	NA	NA
2098463:2098482	attL	AAAATATGAGGAACTATTTT	NA	NA	NA	NA
WP_002296474.1|2098707_2099178_-	DUF4809 family protein	NA	NA	NA	NA	NA
WP_002296476.1|2099507_2101148_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002296477.1|2101301_2102624_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002296478.1|2102691_2103126_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002296481.1|2104769_2105396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296483.1|2105690_2106026_-|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296484.1|2106012_2106297_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296485.1|2106352_2107876_-|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296486.1|2107868_2109044_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002317249.1|2109047_2109233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296487.1|2109198_2110893_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
WP_002296488.1|2110889_2111363_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_002296489.1|2111431_2111587_-	DUF2292 domain-containing protein	NA	NA	NA	NA	NA
WP_002304527.1|2111720_2112101_-	endonuclease	NA	A0A2I7S865	Vibrio_phage	47.9	1.7e-11
WP_002296491.1|2112104_2112320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296492.1|2112322_2112730_-	DUF3206 domain-containing protein	NA	NA	NA	NA	NA
WP_002296493.1|2112995_2114471_-	helicase	NA	Q4ZD27	Staphylococcus_phage	34.9	7.3e-66
WP_002296494.1|2114460_2115309_-	DNA replication protein	NA	A0A222ZGI2	Arthrobacter_phage	28.3	5.2e-08
WP_002296495.1|2115345_2115708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296499.1|2116628_2116940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296500.1|2116983_2117277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296501.1|2117470_2118118_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296502.1|2118178_2119324_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	33.3	2.0e-50
WP_106913988.1|2119404_2119716_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002296503.1|2119740_2120172_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002290885.1|2120168_2120435_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002296505.1|2120689_2121415_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002289867.1|2121962_2122715_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_002289868.1|2122730_2123210_+	threonine/serine exporter	NA	NA	NA	NA	NA
WP_002296509.1|2123460_2125041_-	ABC transporter	NA	NA	NA	NA	NA
WP_002287741.1|2125033_2125777_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.6e-29
WP_002287742.1|2125952_2126729_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002287743.1|2126976_2127813_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_002287744.1|2127823_2128753_-	permease	NA	NA	NA	NA	NA
WP_002287745.1|2128944_2129298_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002287746.1|2129371_2130028_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287747.1|2130253_2132188_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	1.1e-58
WP_002321414.1|2132273_2133497_-	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_002321415.1|2133490_2135389_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_002287753.1|2135382_2136501_-	glycosyl hydrolase family 88	NA	NA	NA	NA	NA
WP_002287754.1|2136583_2137417_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002287755.1|2137409_2138327_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002287756.1|2138349_2138529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287757.1|2138553_2139678_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002296511.1|2139860_2140769_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002287759.1|2140909_2142523_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000222572.1|2143173_2144127_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2144159_2145389_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2145390_2146308_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2146311_2147049_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2147139_2147667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2147846_2148440_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2148543_2149029_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002302440.1|2149277_2150579_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296291.1|2150682_2150880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2150974_2152735_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2152731_2154462_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2154854_2155067_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2155068_2156748_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2157001_2157202_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_001092058.1|2157729_2158392_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001072201.1|2158900_2159632_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
WP_000067268.1|2159757_2160540_-	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
WP_000361059.1|2160693_2161071_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002300187.1|2161077_2162970_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_002300186.1|2162966_2164052_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	1.2e-12
WP_002287951.1|2164788_2165442_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2165431_2166745_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2167054_2169700_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
2170889:2170908	attR	AAAATATGAGGAACTATTTT	NA	NA	NA	NA
>prophage 16
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	2584057	2615148	2883877	transposase,tRNA,holin	Bacillus_phage(25.0%)	23	NA	NA
WP_002285932.1|2584057_2584237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2584430_2584601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016252731.1|2585024_2586044_-	collagen binding domain-containing protein	NA	NA	NA	NA	NA
WP_002285924.1|2586190_2589262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303189.1|2591168_2591930_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002344993.1|2592029_2593751_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.3e-37
WP_002304835.1|2593765_2595550_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.1e-46
WP_002285917.1|2595930_2597484_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2597831_2600246_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2600672_2602691_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2603060_2603717_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2603716_2604673_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2604672_2605239_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_002299614.1|2605674_2605905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296840.1|2606097_2607285_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_025479400.1|2607381_2607684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297218.1|2607995_2609291_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002303477.1|2609980_2611000_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|2611010_2611217_-|holin	holin	holin	NA	NA	NA	NA
WP_002301399.1|2611349_2612309_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002304713.1|2612511_2613444_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002341521.1|2613515_2613872_+	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_010729461.1|2613969_2615148_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	2759858	2776754	2883877		Streptococcus_phage(92.86%)	18	NA	NA
WP_002297366.1|2759858_2760173_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2760185_2760560_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002311649.1|2760560_2760905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2760987_2762328_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2762405_2763080_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002321810.1|2763312_2763747_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2763747_2764455_+	DNA methylase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2764444_2764735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2764993_2766178_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2766174_2766312_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2767057_2768968_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2769071_2769296_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2769308_2769812_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2769871_2770261_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2770247_2772695_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2772699_2774823_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2774819_2775824_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2775842_2776754_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 18
NZ_CP027497	Enterococcus faecium strain AUSMDU00004167 chromosome, complete genome	2883877	2782957	2850924	2883877	transposase,integrase	unidentified_phage(15.38%)	57	2782851:2782910	2838013:2839394
2782851:2782910	attL	TGGCGGATTTTATAATGAACTTAGCCATTTAAAATAAAAAAAACGCCACGTGAATTCCAT	NA	NA	NA	NA
WP_077974289.1|2782957_2784037_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002297337.1|2784354_2785698_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059355941.1|2785831_2791759_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002332818.1|2792375_2792810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297334.1|2792826_2794032_-	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_002297333.1|2794725_2795112_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002304825.1|2795205_2795397_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002311665.1|2795910_2796243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077828743.1|2796538_2796694_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2798550_2800167_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
WP_002317220.1|2800284_2800503_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2800697_2801159_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2801351_2801591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297324.1|2801614_2803138_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|2803155_2803278_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|2803307_2804291_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2804314_2804464_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2804484_2804862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2804893_2805073_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2805087_2805357_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_010729277.1|2805879_2807622_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-30
WP_002302406.1|2807605_2809360_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002302405.1|2809469_2810039_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002305512.1|2810056_2811481_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.9e-20
WP_010729275.1|2811482_2812151_-	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_074394433.1|2812280_2812865_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297302.1|2813195_2813429_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_010729812.1|2813443_2814394_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010729271.1|2814390_2815233_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010729270.1|2815234_2815954_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.7	1.6e-18
WP_074394656.1|2816645_2816804_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729268.1|2816875_2818102_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002287505.1|2818189_2818582_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002295975.1|2818597_2819041_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002297290.1|2819559_2820027_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_002288118.1|2820146_2821685_-	gluconokinase	NA	NA	NA	NA	NA
WP_002288144.1|2821764_2822451_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288119.1|2822651_2823179_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288121.1|2823262_2823940_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288122.1|2823936_2825067_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	1.6e-73
WP_002288124.1|2825066_2827250_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288127.1|2827246_2828272_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288129.1|2828316_2829144_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002340552.1|2829140_2830208_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288133.1|2830233_2831070_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288134.1|2831066_2831936_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288135.1|2832005_2833289_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002288137.1|2833302_2834988_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288139.1|2835262_2836288_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_077974289.1|2836885_2837965_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002295965.1|2838275_2841929_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.9	8.4e-63
2838013:2839394	attR	ATGGAATTCACGTGGCGTTTTTTTTATTTTAAATGGCTAAGTTCATTATAAAATCCGCCATTTATTTTGCATTCAAAAAATGATCTATCTTTACTTTTGTTGATTGACTTCTCTTGGAAGATGATCGTTCCGATACCTTAATTGGATACGAACCGATGTTGTTAAGATCCTTTCCCACTTTTCTTCTAGTTAGACAAATTATTTTAGACAAACCAAAAAAGAGGTTGTGACAATAATTTGTCACAACCTCTTTTTTAAAATATCTATTTTGTTTGATTGTTCATTGCGTCTTCTGCAGCCATTTGCGCTTCAATATCTGAAATACTGTAGACATTTTCGCTTGCTACACCGACTTCTTTTGGTTCCATGTCACGATAACGTTGCATACCAGTACCAGCTGGGATGATCTTACCTATAATAACATTTTCTTTCAAACCAAGAAGAGGATCTTTCTTACCGCGGATCGCAGCATCCGTCAAGACACGAGTTGTTTCTTGGAATGATGCAGCAGATAAGAAACTATTTGTTTCTAATGATGCTTTTGTGATACCTAGTAAGACAGGTCGAGAAGTTGCAGGAACGCCTCCTGAGACTAGCGTATTGTAGTTTTGATCTTTAAAGTCTGCGATGTCTAATAATGTACCTGGTAAGATATCTGTATCACCTGGATCCATTACACGAACTTTACGCAGCATTTGACGAACCATTACTTCGATATGCTTGTCGCCGATTTCTACCCCTTGCATACGGTAAACACGTTGTACTTCACGAAGCAAGTAGTTTTCAACAGATAATACATCGCGAACTTGCAACAATTGTTTTGGATCGATTGATCCTTCTGTCAATGGTGCACCACGGTGGATCATATCGCCTTCTGCTACTTTCATACGTGCTGTATAAGGAACAGTATACGTACGTGTATCTGTTTTTCCTTTGATTGTTACTTCTTTGGTACGTGTTGCAGGATCTTCTGAGATATCGATGACATCCCCTGTTACTTCTGTGATCACTGCTTGCCCTTTCGGATTACGTGCTTCAAAGATTTCTTGGACACGAGGAAGACCTTGAGTGATATCGTCTCCGGCAACCCCACCTGTATGGAATGTACGCATCGTCAACTGAGTACCAGGTTCACCGATTGATTGAGCGGCGATCGTACCAACTGCTTCTCCGACTTCAACGTCAGAGCCAGTTGCAAGGTTGCGTCCGTAACAATGTTTGCAGACACCATGTTTTGTATTACATGTGAAGACAGAACGGATTGTCACTGTTTCGACACCTGCATCAACGATTTGTTTTGCGATGTCTTCGGAAATCAATTGGTTTCCTGCAATGATCAATTCATTTGTTTCAGGATGACGTACTTCTTTACGGGTGTAACG	NA	NA	NA	NA
WP_002320801.1|2842007_2845634_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	1.5e-48
WP_002289394.1|2846352_2847321_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002289390.1|2847338_2848244_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289388.1|2848240_2849047_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_002297289.1|2849203_2850172_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_002354485.1|2850237_2850924_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
>prophage 1
NZ_CP027498	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence	207001	3393	54637	207001	holin,transposase	Streptococcus_phage(37.5%)	51	NA	NA
WP_002297404.1|3393_4644_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002347694.1|5053_7426_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_060809967.1|7486_8947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305772.1|8957_11162_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002303311.1|11402_11996_+	abortive infection protein	NA	NA	NA	NA	NA
WP_002303312.1|12008_12908_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303313.1|12910_13396_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002316074.1|13536_13740_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002295623.1|13814_14075_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002347218.1|14511_14718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|14717_14969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|14983_15421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303117.1|15413_16121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120991.1|16501_16681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|16885_17290_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|17306_18455_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_000388479.1|18702_18972_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000588503.1|18964_19222_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_001809248.1|19859_20684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|20848_21463_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_002303116.1|21700_22123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299573.1|22132_22336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299575.1|22546_23131_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_086322086.1|23319_24006_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_010729807.1|25330_25963_+	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_077974475.1|26167_26395_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_086322080.1|26391_26730_+	antitoxin	NA	NA	NA	NA	NA
WP_002389879.1|26719_26989_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_002302440.1|27167_28469_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296127.1|28697_30245_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002287659.1|30346_30700_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|30689_30884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729749.1|30962_32255_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002336724.1|33017_33986_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002288615.1|33996_34812_+	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_010729750.1|34879_35590_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288620.1|35625_36867_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_002296840.1|36924_38112_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002298077.1|38646_40047_+	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002322961.1|40079_40247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002350223.1|41112_41973_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002350224.1|42393_43326_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002339141.1|43368_43980_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002339142.1|43999_45220_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_085910366.1|45277_45964_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_002292418.1|46672_47545_-	ROK family protein	NA	NA	NA	NA	NA
WP_002303302.1|47808_49755_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|49939_51379_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|51380_52343_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|52512_53939_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|54181_54637_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
>prophage 2
NZ_CP027498	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence	207001	59853	197620	207001	integrase,transposase	Streptococcus_phage(27.5%)	119	82595:82611	187574:187593
WP_086956687.1|59853_61016_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|62133_62652_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002329899.1|63788_64196_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A0N9SKD8	Staphylococcus_phage	38.9	4.0e-14
WP_002290351.1|64192_64426_-	addiction module antitoxin	NA	NA	NA	NA	NA
WP_002290352.1|64759_65845_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_002290356.1|66947_67097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290357.1|67089_67299_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_002335326.1|68803_70264_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002342361.1|70260_71481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290367.1|71541_73725_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_002290368.1|73764_74595_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002290370.1|74606_75479_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002290371.1|75488_76748_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002329911.1|76895_78206_-	alpha-glucosidase/alpha-galactosidase	NA	NA	NA	NA	NA
WP_002350071.1|78237_79062_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002350067.1|80056_81166_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002338088.1|81459_82485_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
82595:82611	attL	AAAAAATATCCGAACAA	NA	NA	NA	NA
WP_002290379.1|82729_84001_-	substrate-binding domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	45.0	4.1e-17
82595:82611	attL	AAAAAATATCCGAACAA	NA	NA	NA	NA
WP_002290380.1|84284_84656_-	glyoxalase	NA	NA	NA	NA	NA
WP_002342357.1|84695_85232_-	glyoxalase	NA	NA	NA	NA	NA
WP_002290382.1|85243_85717_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	44.2	2.3e-13
WP_002290383.1|85889_86444_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002300314.1|86916_88086_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_002319325.1|89105_89723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311006.1|90786_91008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008271463.1|91105_91351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087121905.1|93027_94189_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002344896.1|95103_95370_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002344897.1|95359_95716_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_094868189.1|95844_96531_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_002354485.1|99834_100521_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002303110.1|102323_103361_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002387940.1|103357_103870_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002304894.1|103927_104194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319817.1|105070_105751_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002321606.1|106010_106616_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|106660_106828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|106861_107161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|107201_107819_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|108143_108539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|108618_110970_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_000718009.1|111094_111784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000751236.1|111797_112250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|112380_113061_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|113162_114482_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|114478_115132_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_010729371.1|115419_116694_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.6	1.2e-56
WP_032494987.1|116748_118314_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	2.4e-19
WP_010729372.1|118733_119603_-	ROK family protein	NA	NA	NA	NA	NA
WP_010729373.1|119654_120647_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.8	8.2e-13
WP_010729374.1|120823_122308_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_010729375.1|122308_123916_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005230433.1|123964_124849_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_005233042.1|124864_125857_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_025481119.1|126480_126927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010729377.1|127521_127872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729378.1|128076_128925_+	rep protein	NA	Q3ZVF7	Spiroplasma_phage	45.8	3.0e-11
WP_002351139.1|128971_129166_+	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_010729379.1|129168_130371_+|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	26.2	4.8e-23
WP_002285758.1|130596_130791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|130780_131134_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|131235_132783_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002288609.1|133174_134107_-	hypothetical protein	NA	NA	NA	NA	NA
133047:133063	attR	TTGTTCGGATATTTTTT	NA	NA	NA	NA
WP_002288608.1|134146_135808_-	hyaluronate lyase	NA	NA	NA	NA	NA
133047:133063	attR	TTGTTCGGATATTTTTT	NA	NA	NA	NA
WP_002305865.1|135804_138786_-	glycoside hydrolase family 42	NA	L0N6M2	Herpes_simplex_virus	28.8	2.2e-122
WP_002304880.1|138913_140827_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002304878.1|140856_141468_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_010729380.1|141518_142991_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002289655.1|143014_143926_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002304874.1|143937_144876_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002340467.1|145104_146679_+	ATP-binding protein	NA	Q9EYF3	Enterobacteria_phage	30.0	9.4e-11
WP_002302980.1|146656_147385_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729381.1|147767_149042_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_014748798.1|150635_150971_-	MazF family toxin-antitoxin system	NA	NA	NA	NA	NA
WP_002299921.1|150954_151227_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002299923.1|151677_152481_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002299925.1|152458_153583_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	1.0e-22
WP_002299926.1|153598_154414_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_096157798.1|154403_155285_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002299928.1|155360_156650_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077974472.1|157998_159495_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	4.1e-125
WP_077974474.1|159466_160666_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	24.7	1.3e-25
WP_002298085.1|160795_162172_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|162171_162828_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|162837_164115_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|164364_165526_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_010729386.1|165556_166006_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_010706480.1|166161_166512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014125696.1|167691_168378_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.7e-127
WP_002292681.1|169047_169596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|169596_170454_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002292678.1|171015_171345_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002314366.1|171421_171694_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002297422.1|171693_171957_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002303153.1|172062_172479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102642289.1|173127_174289_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	1.5e-77
WP_002303235.1|174761_175661_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_002305107.1|175681_175954_-	DUF3884 family protein	NA	NA	NA	NA	NA
WP_002290548.1|175976_177383_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.0	3.6e-46
WP_002290549.1|177524_179231_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002290550.1|179230_179548_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002290551.1|179575_180556_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002290553.1|180558_181491_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_002290554.1|181501_182017_-	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002290555.1|182033_182459_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290556.1|182947_183715_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002303240.1|186218_186674_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106913994.1|187191_187527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002319817.1|187647_188328_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_008269238.1|188349_188466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106913993.1|189004_189622_+	Mg2+ and Co2+ transporter	NA	NA	NA	NA	NA
WP_002319817.1|189634_190315_-|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002314359.1|190828_192019_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.2	3.5e-26
WP_002303333.1|192759_193119_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002303335.1|193191_194010_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002324485.1|194423_194774_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010729620.1|194843_195797_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	4.8e-34
WP_002293041.1|195992_196190_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	3.9e-23
WP_002302440.1|196318_197620_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
>prophage 1
NZ_CP027500	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed3, complete sequence	46474	3061	14946	46474	protease,transposase	Streptococcus_phage(33.33%)	13	NA	NA
WP_010730985.1|3061_5011_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	24.7	2.9e-30
WP_002354485.1|5140_5827_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_000599739.1|6024_6630_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_002303206.1|6645_7218_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_073120187.1|7573_8146_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_002354485.1|8820_9507_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_002322130.1|9661_9916_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_000199136.1|10026_10281_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|10473_10749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|10720_11674_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_000947691.1|12285_13779_+	replication protein RepR	NA	NA	NA	NA	NA
WP_002347145.1|13913_14228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002354485.1|14259_14946_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
>prophage 2
NZ_CP027500	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed3, complete sequence	46474	19566	36694	46474	transposase	Streptococcus_phage(71.43%)	21	NA	NA
WP_014748749.1|19566_20253_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.0e-126
WP_002347171.1|20308_20566_+	hypothetical protein	NA	A0A1X9I765	Streptococcus_phage	98.8	9.1e-41
WP_001835296.1|20657_20873_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	97.1	4.2e-31
WP_000301765.1|20889_21162_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	100.0	5.0e-05
WP_001284311.1|21163_22027_+	toxin zeta	NA	NA	NA	NA	NA
WP_023843711.1|22204_22345_-	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	93.0	8.0e-15
WP_001038796.1|22289_23027_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	2.4e-134
WP_031929417.1|23151_23235_-	23S rRNA methyltransferase attenuator leader peptide ErmL	NA	NA	NA	NA	NA
WP_001096887.1|23776_24571_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_106913997.1|25179_26454_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	30.0	1.3e-42
WP_002349227.1|26907_27120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|27281_27800_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|27806_28319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288897.1|28589_29213_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_002354485.1|29302_29989_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
WP_001280781.1|31183_31879_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|31856_33011_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|33225_34194_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|34186_35218_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|35223_35832_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_002354485.1|36007_36694_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	2.0e-127
