The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	0	5563	5489451		uncultured_virus(25.0%)	7	NA	NA
WP_000331707.1|348_735_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|751_1075_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|1170_1686_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_044805164.1|1702_3553_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.4	1.6e-102
WP_001124469.1|3554_3890_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|3901_4102_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_044805163.1|4279_5563_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 2
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	15447	15879	5489451		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_044805161.1|15447_15879_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 3
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	24708	31193	5489451		Escherichia_phage(66.67%)	7	NA	NA
WP_000937895.1|24708_26079_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
WP_001299507.1|26240_27707_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|27775_29353_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755172.1|29447_29987_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
WP_001317257.1|30002_30521_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000076001.1|30831_31023_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|31040_31193_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 4
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	37428	41430	5489451		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|37428_38067_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001341612.1|38066_39104_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|39428_40055_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|40140_41430_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 5
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	62681	63395	5489451		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|62681_63395_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 6
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	81442	82393	5489451		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|81442_82393_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 7
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	100947	105885	5489451		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|100947_101817_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|102030_102456_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001325675.1|102442_102892_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_106884213.1|102952_103528_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|103623_104523_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|104580_105885_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 8
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	109363	115182	5489451		Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
WP_000517439.1|109363_110155_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
WP_000290223.1|110325_111342_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458406.1|111341_112175_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852685.1|112174_113050_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021040.1|113039_114137_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|114270_115182_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
>prophage 9
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	119512	124732	5489451		Streptococcus_phage(50.0%)	4	NA	NA
WP_000034402.1|119512_120484_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|120668_121430_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|121659_122646_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|122716_124732_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 10
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	150269	151004	5489451		Clostridioides_phage(100.0%)	1	NA	NA
WP_106884211.1|150269_151004_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.0	1.0e-12
>prophage 11
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	154822	155764	5489451		Morganella_phage(100.0%)	1	NA	NA
WP_044805140.1|154822_155764_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.5	3.1e-70
>prophage 12
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	159455	167032	5489451		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|159455_161150_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|161219_162164_+	transporter YfdV	NA	NA	NA	NA	NA
WP_044805138.1|162237_163383_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001443604.1|163438_167032_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 13
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	173683	270911	5489451	terminase,head,tail,lysis,tRNA,holin,capsid,integrase,protease,transposase	Stx2-converting_phage(40.0%)	111	178306:178323	239291:239308
WP_000194515.1|173683_175117_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_044805134.1|175332_176247_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197016.1|176318_177566_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|178094_178295_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
178306:178323	attL	TCCCCTGCAGGAATCGAA	NA	NA	NA	NA
WP_001102873.1|178456_179083_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	29.3	3.5e-09
WP_044805132.1|179958_180195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077787575.1|180268_180451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044805183.1|180508_181201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|181702_182719_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_173913234.1|184261_185305_-	replication protein	NA	NA	NA	NA	NA
WP_096835758.1|185380_185767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611586.1|185763_185958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096835757.1|186040_186232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106884208.1|186280_186472_-	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
WP_096264167.1|186628_187369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106884207.1|187361_188648_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.5	6.4e-66
WP_001277767.1|188938_189118_-	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_044805131.1|189214_189952_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	51.0	4.2e-54
WP_069720661.1|189953_190724_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.8	4.7e-141
WP_000763383.1|190720_190942_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001386642.1|191040_191322_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|191332_191524_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682299.1|191496_191679_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	98.3	3.7e-28
WP_000186759.1|191675_192356_-	YqaJ viral recombinase family protein	NA	H6WZG6	Escherichia_phage	98.7	1.8e-131
WP_001373974.1|192352_193138_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000995439.1|193143_193440_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|193514_193658_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|193626_193791_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000776961.1|193863_194175_-	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_000167595.1|194318_194789_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|194847_195231_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_001278657.1|195737_196358_-	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_001207140.1|196354_196789_-	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_000885926.1|196859_197201_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_000428098.1|197261_197966_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|198079_198313_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438541.1|198451_198748_+	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000185456.1|198780_199719_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788906.1|199715_200417_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|200413_200704_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000127.1|200774_201053_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|201186_201402_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001303571.1|201605_202052_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_106884204.1|202048_202576_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	99.4	2.1e-100
WP_001254218.1|202572_202755_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567000.1|202751_202922_+	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001591711.1|202914_203526_+	recombination protein NinG	NA	Q716C3	Shigella_phage	98.0	9.6e-97
WP_001028858.1|203522_204194_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|204184_204673_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_106884203.1|205741_207592_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_024164617.1|207875_208091_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_001135289.1|208090_208588_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_106878689.1|208584_209022_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	1.2e-69
WP_000839224.1|209224_209722_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|209718_209976_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095741.1|210268_210469_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_085947772.1|210594_211808_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000958416.1|212417_212981_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_106910244.1|212977_214639_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_001502569.1|214702_216640_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.1	0.0e+00
WP_001063023.1|216684_216906_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|219106_219433_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007911.1|219442_219793_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|219789_220236_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|220232_220577_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106883934.1|220643_221360_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_001030047.1|221365_221740_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001453698.1|221835_222045_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807940.1|225332_225674_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106878693.1|225673_226372_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_001302649.1|226388_226709_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|226816_226990_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_106884279.1|227060_227984_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.7	1.1e-176
WP_106878694.1|228038_228776_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	9.4e-147
WP_072148837.1|228721_229354_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.2	2.5e-103
WP_106884086.1|229602_233082_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.6	0.0e+00
WP_106884200.1|233148_233748_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	1.3e-109
WP_000279020.1|233812_235126_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	1.5e-78
WP_106878697.1|235127_235397_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.7e-43
WP_000491545.1|235537_236413_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|236637_237288_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_044805449.1|237966_239124_-|integrase	prophage integrase IntS	integrase	K7P7E1	Enterobacteria_phage	99.0	9.1e-221
WP_000368131.1|239435_240368_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
239291:239308	attR	TCCCCTGCAGGAATCGAA	NA	NA	NA	NA
WP_000776768.1|240661_241417_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000937833.1|241598_242657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296861.1|243022_244363_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001296869.1|244734_245019_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_044805446.1|245198_246509_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_044805445.1|246508_248653_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|248855_249341_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|250024_250588_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001112824.1|250669_253315_+	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000482748.1|253334_254087_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000018471.1|254102_254612_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|254608_255097_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000844750.1|255093_255633_+	fimbrial protein	NA	NA	NA	NA	NA
WP_044805443.1|255634_256486_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|256558_257110_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001295704.1|257275_258208_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000918470.1|258242_259328_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001043815.1|259331_260156_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_044805439.1|260155_260965_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089232.1|260964_261513_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000559764.1|261546_261825_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|261945_263952_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|264110_265331_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000127749.1|265614_266793_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615813.1|266789_267785_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699121.1|267883_269020_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_001289165.1|269085_270099_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283576.1|270098_270911_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	275496	277014	5489451		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|275496_277014_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 15
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	281225	283086	5489451		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|281225_281999_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156114.1|282195_283086_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	4.0e-67
>prophage 16
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	293645	296873	5489451		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|293645_294296_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|294382_296215_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|296273_296873_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 17
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	333203	338199	5489451		Tupanvirus(33.33%)	3	NA	NA
WP_106884192.1|333203_335186_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
WP_000461661.1|335185_336154_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001297077.1|337596_338199_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 18
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	341351	342254	5489451	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|341351_342254_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 19
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	348147	362203	5489451		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000779084.1|348147_349224_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|349686_350337_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|350390_350645_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_044805424.1|350644_351775_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	4.3e-175
WP_001075177.1|351863_354149_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001427555.1|354844_358579_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_000990754.1|358706_359429_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|359575_362203_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 20
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	371903	374753	5489451		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|371903_374753_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 21
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	378916	384682	5489451		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865576.1|378916_380008_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|380119_381175_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_106884188.1|381248_382313_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_044805418.1|382312_382963_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422230.1|383038_384682_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 22
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	393450	394068	5489451		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|393450_394068_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 23
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	405673	413321	5489451		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|405673_406681_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|406819_407104_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|407228_408989_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|409137_409833_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213360.1|409860_411051_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|411383_411728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194876.1|411731_413321_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
>prophage 24
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	419075	423376	5489451		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|419075_419642_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_044805410.1|420053_420767_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_106910247.1|420805_421792_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_044805407.1|421909_423376_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	1.7e-43
>prophage 25
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	437871	438729	5489451		Catovirus(100.0%)	1	NA	NA
WP_044805404.1|437871_438729_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 26
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	442798	446584	5489451		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|442798_444790_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425428.1|444821_445658_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|445915_446584_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 27
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	450278	451799	5489451		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_044805399.1|450278_451799_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	3.4e-10
>prophage 28
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	472132	481573	5489451		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569327.1|472132_473059_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|473063_473795_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|473775_473883_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|473942_474674_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|474895_476581_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_044805392.1|476577_477297_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|477343_477814_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_004982296.1|477853_478315_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.1e-75
WP_106884185.1|478439_480440_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292774.1|480436_481573_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 29
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	494137	496171	5489451	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|494137_496171_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 30
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	506818	510375	5489451		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001297420.1|506818_507637_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|507688_508435_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|508408_509374_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|509370_510375_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 31
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	519594	526467	5489451	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000807362.1|519594_520494_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|520908_521226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476011.1|521555_522917_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|523019_523316_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|523317_523614_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|523822_524155_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|524344_525067_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675146.1|525063_526467_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 32
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	539357	540410	5489451		Klebsiella_phage(100.0%)	1	NA	NA
WP_001109199.1|539357_540410_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
>prophage 33
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	544765	551338	5489451		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|544765_545782_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|546042_547515_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|547582_548371_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|548499_548649_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113001.1|548814_549588_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|549587_550277_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|550279_551338_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 34
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	561048	615891	5489451	terminase,portal,head,tail,lysis,holin,capsid,integrase,protease,transposase	Enterobacteria_phage(33.87%)	74	558269:558284	624930:624945
558269:558284	attL	TGGTCGCCTGAAAGTG	NA	NA	NA	NA
WP_000533654.1|561048_562119_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|562096_562315_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|562421_562766_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_024238366.1|563033_563318_-	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	91.5	2.6e-44
WP_024238365.1|563317_563539_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
WP_106878750.1|563637_563919_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	1.6e-46
WP_000548536.1|563929_564121_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|564093_564276_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_024243933.1|564272_564950_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.3e-130
WP_000100847.1|564946_565732_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|565737_566034_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372924.1|566109_566253_-	host cell division inhibitory peptide Kil	NA	A0A0N7C011	Escherichia_phage	100.0	1.2e-18
WP_001198860.1|566221_566386_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_106884179.1|566458_566827_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.7e-64
WP_000213978.1|567009_567210_-	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	95.5	2.5e-30
WP_106884178.1|567379_567805_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	100.0	6.8e-49
WP_000624718.1|567801_568152_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_106884177.1|568182_569775_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	6.7e-182
WP_001066173.1|569942_570524_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
WP_000088203.1|570540_570813_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438342.1|570790_570973_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968517.1|571249_572002_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|571998_572556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096002361.1|572595_573291_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_000067727.1|573364_573580_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|573720_574017_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000788871.1|574945_575647_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000145926.1|575643_575934_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000736913.1|576007_576448_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001254218.1|576444_576627_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_033804992.1|576623_576794_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	1.8e-24
WP_001591711.1|576786_577398_+	recombination protein NinG	NA	Q716C3	Shigella_phage	98.0	9.6e-97
WP_001028854.1|577394_578060_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_106884175.1|578271_579231_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|579571_579694_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|579708_580398_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|580582_581326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|581411_581570_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023271.1|581868_583719_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_024164617.1|584157_584373_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075132.1|584372_584870_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|584866_585304_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000881326.1|585453_586071_+	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_106884174.1|586258_586453_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	9.7e-27
WP_000235436.1|586848_587358_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032205109.1|587329_589258_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.2e-262
WP_000258991.1|589241_589448_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001430223.1|589444_591037_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_106884043.1|591026_592532_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	9.3e-101
WP_000256818.1|592568_592916_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522623.1|592973_594002_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|594053_594437_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204560.1|594429_594783_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000974985.1|594798_595332_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_000683079.1|595328_595724_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|595731_596484_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479116.1|596497_596929_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533403.1|596955_597369_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_106884044.1|597349_599929_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.4	0.0e+00
WP_000847304.1|599925_600255_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_044804844.1|600254_600953_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_106884045.1|600958_601702_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	9.2e-150
WP_123006696.1|601647_602280_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	95.7	4.6e-102
WP_000649829.1|602470_602998_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106910249.1|603131_606611_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.7	0.0e+00
WP_106884047.1|606677_607277_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	5.2e-111
WP_094282965.1|607341_608655_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001023452.1|608656_608926_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_159032890.1|609050_610226_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|610671_611055_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_106884050.1|611672_612791_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|612787_614581_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|614599_615307_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|615303_615891_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
624930:624945	attR	CACTTTCAGGCGACCA	NA	NA	NA	NA
>prophage 35
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	630217	642472	5489451		Morganella_phage(20.0%)	12	NA	NA
WP_000066490.1|630217_630430_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|630440_630629_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|630603_630834_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|630823_630997_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|631044_632118_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071829672.1|632189_634934_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	7.8e-37
WP_001264955.1|635016_636045_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|636017_636710_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_106884052.1|638011_640558_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|640554_641154_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|641246_641552_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|641551_642472_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 36
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	646384	746660	5489451	terminase,head,tail,tRNA,holin,capsid,protease,transposase	Enterobacteria_phage(30.38%)	119	NA	NA
WP_000013654.1|646384_647695_-	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_001208773.1|647747_648032_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_032204557.1|648066_648234_-	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	98.2	1.8e-26
WP_024226604.1|648276_648900_-	antA/AntB antirepressor family protein	NA	A0A0P0ZDY7	Stx2-converting_phage	95.2	1.0e-106
WP_106910349.1|649223_649967_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	98.7	6.2e-122
WP_106910250.1|650016_650301_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	7.0e-50
WP_044806858.1|650293_650578_-	DUF4752 family protein	NA	G9L657	Escherichia_phage	96.8	2.9e-48
WP_106884055.1|650577_650916_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	85.4	3.6e-37
WP_000207903.1|650912_651269_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_106910251.1|651782_652382_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	99.0	4.4e-110
WP_001214453.1|652378_652546_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_044806723.1|652556_652850_-	DUF2856 family protein	NA	Q9MCT7	Escherichia_phage	97.9	1.6e-49
WP_044806722.1|652873_653257_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	97.6	1.2e-65
WP_044806721.1|653256_653862_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	1.2e-107
WP_169080929.1|653872_654043_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	96.4	2.5e-23
WP_001243355.1|654118_654271_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|654255_654387_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_021500848.1|654411_655380_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
WP_000167589.1|655523_655994_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_001450670.1|656002_656344_-	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_021568301.1|656790_657834_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	26.5	2.3e-13
WP_106884058.1|658090_658804_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	3.1e-131
WP_001560905.1|658904_659105_+	regulatory protein cro	NA	A4KWW0	Enterobacteria_phage	98.5	4.3e-30
WP_000438527.1|659211_659508_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_000166207.1|659540_659687_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_106910252.1|659679_660579_+	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	99.7	4.6e-164
WP_000131492.1|660568_662005_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_001036037.1|662004_662274_+	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_001000130.1|662343_662622_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|662754_662970_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|662980_663217_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|663173_663620_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|663616_664144_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254258.1|664140_664335_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_106910253.1|664591_665266_+	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	96.0	1.7e-123
WP_106910255.1|666268_666937_+	ORF6N domain-containing protein	NA	A0A2L1IV98	Escherichia_phage	98.6	2.1e-121
WP_106910256.1|667192_667873_+	ORF6N domain-containing protein	NA	Q8HA19	Enterobacteria_phage	96.5	6.0e-124
WP_001004008.1|667947_668670_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_106910257.1|668669_669275_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	99.0	2.5e-97
WP_000144764.1|669271_669466_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|669458_669893_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_106910258.1|671114_673052_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.8	0.0e+00
WP_000143458.1|673185_673365_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|673405_673651_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_001072901.1|673728_673944_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|673948_674482_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_106884094.1|674756_675326_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	97.9	2.2e-103
WP_000455406.1|675325_675475_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001208681.1|675702_675888_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001302717.1|676413_676728_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_097586089.1|676809_677034_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	6.6e-19
WP_000279796.1|677075_677441_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958416.1|677729_678293_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_106883932.1|678289_679951_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_106883933.1|680014_681952_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	96.9	0.0e+00
WP_001063023.1|681996_682218_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|684419_684746_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007911.1|684755_685106_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|685102_685549_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|685545_685890_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106883934.1|685956_686673_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_001030047.1|686678_687053_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001453698.1|687148_687358_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807954.1|690645_690987_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_101972849.1|690986_691685_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.7	8.1e-132
WP_000194790.1|691690_692434_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_159028792.1|692379_693009_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	1.1e-100
WP_106910259.1|693249_696726_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.9	0.0e+00
WP_078194555.1|696793_697393_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	6.3e-109
WP_106884099.1|697457_698780_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	99.1	7.0e-76
WP_044805465.1|698781_699051_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_122988840.1|699162_699240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159028793.1|699454_700468_+	peptidase M85	NA	NA	NA	NA	NA
WP_000812724.1|701200_701857_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|701857_702049_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|702153_702390_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|702507_703947_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_044805467.1|704026_706660_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|706628_707912_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|708041_708539_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|708635_709334_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|709353_711402_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|711593_712475_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127216.1|712520_713894_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|714070_714862_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|715004_715244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|715402_715546_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|715620_715908_+	YebO family protein	NA	NA	NA	NA	NA
WP_001295496.1|716576_716720_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|716732_716942_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|717107_717917_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_106910260.1|717913_718480_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|718908_719367_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|719421_720273_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|720285_721086_-	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|721148_722120_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|722582_724139_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001295494.1|724142_725741_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|725871_727236_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|727419_727998_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|728001_729363_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|729436_729616_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|729735_730095_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|730457_730802_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|730933_732844_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220987.1|732901_733597_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044805469.1|733636_734218_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|734422_736108_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_001323996.1|736189_737305_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001287005.1|737358_738324_-	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_000067822.1|738379_739504_-	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_106910261.1|739535_741146_-	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_044805471.1|741396_742482_-	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_106884280.1|742584_743508_+	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000457202.1|743634_744273_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000939317.1|744445_744805_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000513743.1|744808_744997_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000604932.1|745012_745444_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_106884101.1|745451_746660_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	4.1e-208
>prophage 37
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	752611	757188	5489451		Bacillus_phage(100.0%)	3	NA	NA
WP_000766132.1|752611_754102_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616411.1|754282_755758_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|755904_757188_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 38
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	760506	761361	5489451		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|760506_761361_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 39
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	764604	765246	5489451		Tupanvirus(100.0%)	1	NA	NA
WP_044805475.1|764604_765246_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	3.8e-19
>prophage 40
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	770172	772134	5489451		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235820.1|770172_772134_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 41
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	777732	778386	5489451		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882826.1|777732_778386_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
>prophage 42
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	785150	786371	5489451		Klosneuvirus(100.0%)	1	NA	NA
WP_044805483.1|785150_786371_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	1.9e-27
>prophage 43
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	793767	794595	5489451		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|793767_794595_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 44
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	800934	803196	5489451		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|800934_803196_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 45
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	813861	835232	5489451	tRNA,transposase	Tupanvirus(20.0%)	20	NA	NA
WP_001310555.1|813861_814878_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001144192.1|815692_817621_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|817624_818167_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|818263_818461_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|818513_818870_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|818992_819037_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|819320_820304_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_106884133.1|820318_822706_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|822710_823010_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956529.1|823110_824091_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|824153_824705_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029479.1|824704_825454_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001209780.1|825531_825996_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001326034.1|826242_826956_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_106884132.1|827018_828455_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|828458_828650_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|828781_829828_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|829984_830818_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_044805490.1|831150_833529_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	7.2e-172
WP_044805534.1|833585_835232_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
>prophage 46
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	853863	858947	5489451		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|853863_854232_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001297388.1|854240_855728_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948855.1|855737_856484_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_044805496.1|856458_857730_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144575.1|857726_858947_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 47
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	867237	869504	5489451		Escherichia_phage(50.0%)	3	NA	NA
WP_001310861.1|867237_867906_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
WP_001069997.1|867902_868688_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587560.1|868691_869504_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 48
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	875008	883806	5489451		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|875008_875650_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|875689_876838_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182363.1|877122_878334_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|878446_879379_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|879375_880401_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|880699_880789_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|880954_882124_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|882269_882851_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101183.1|882978_883806_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 49
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	892608	894107	5489451		Indivirus(50.0%)	2	NA	NA
WP_044805500.1|892608_893505_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|893585_894107_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 50
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	901018	902293	5489451	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|901018_902293_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 51
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	922168	923980	5489451		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945880.1|922168_923980_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 52
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	933875	935177	5489451		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|933875_935177_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 53
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	945277	1018367	5489451	terminase,portal,head,tail,lysis,holin,capsid,protease,transposase	Escherichia_phage(44.12%)	86	NA	NA
WP_001260840.1|945277_946099_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|946198_946282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|946374_946710_-	acid shock protein	NA	NA	NA	NA	NA
WP_044805515.1|947106_948360_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|948466_949360_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|949494_950715_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|950839_951535_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_106910350.1|951487_952780_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|952938_953553_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|953595_954450_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|954451_955069_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_106884282.1|955079_957503_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.4	1.8e-207
WP_044805519.1|957563_959990_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	7.7e-214
WP_001307224.1|960188_960494_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|960601_961312_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|961314_961875_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|961909_962251_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|962385_962712_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|962917_964132_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001310555.1|964617_965634_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_072095801.1|966419_966530_+	transporter	NA	NA	NA	NA	NA
WP_001206147.1|966549_967845_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
WP_000005551.1|967864_968116_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000102122.1|968188_970651_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
WP_000199475.1|970743_970932_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|970928_971117_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000394548.1|971891_972530_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|972541_972694_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|972986_973325_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|973716_973959_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|973942_974368_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_044805521.1|974436_975480_+	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	65.1	3.0e-82
WP_074156321.1|975391_975934_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	7.3e-80
WP_033804986.1|975967_976693_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.2	4.1e-86
WP_001141097.1|976708_977101_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.7e-38
WP_033804987.1|977097_977397_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	96.0	2.8e-49
WP_044805535.1|977443_977854_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	92.9	2.0e-69
WP_033804989.1|977831_978188_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	2.5e-57
WP_001224661.1|978281_978455_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.2e-25
WP_000753068.1|978456_978633_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	5.7e-26
WP_032163038.1|978629_979577_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	97.5	4.1e-179
WP_172900450.1|980201_980435_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	92.2	2.9e-33
WP_000220596.1|980640_980940_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	97.0	2.5e-50
WP_001260977.1|980945_981203_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|981338_981611_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_095593838.1|981612_982662_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	1.3e-109
WP_044805525.1|982674_983034_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	1.5e-36
WP_000640048.1|983042_983573_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_024228427.1|983814_984012_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	4.0e-28
WP_044805527.1|984162_985221_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	88.5	1.2e-184
WP_044805529.1|985663_986095_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.6	6.0e-69
WP_052933949.1|986666_988517_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_024165672.1|988953_989169_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731236.1|989173_989518_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|989568_990102_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_023982659.1|990400_990868_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	1.8e-74
WP_033805057.1|991307_991853_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.3	5.6e-80
WP_106884125.1|991827_993753_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000198153.1|993749_993956_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|993952_995554_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_033805059.1|995534_996854_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001365129.1|996863_997196_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_044806118.1|997251_998277_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.5	7.3e-190
WP_000158897.1|998318_998714_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000753016.1|998725_999079_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|999093_999627_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_033805061.1|999623_1000019_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	1.5e-58
WP_000235090.1|1000026_1000779_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479045.1|1000792_1001215_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1001241_1001655_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_106884124.1|1001635_1004248_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.0	0.0e+00
WP_106884123.1|1004244_1004574_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	1.2e-58
WP_001356552.1|1004573_1005272_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_053895436.1|1005282_1006026_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	99.6	1.1e-150
WP_149015260.1|1005971_1006604_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	1.0e-104
WP_106884120.1|1006850_1010330_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.7	0.0e+00
WP_001426435.1|1010397_1010997_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
WP_106884119.1|1011061_1012375_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	3.1e-76
WP_001023455.1|1012376_1012646_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001131658.1|1012759_1013335_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|1013407_1014037_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_033805042.1|1014118_1014760_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	1.5e-103
WP_001120551.1|1014921_1015164_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347482.1|1015295_1016579_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_106910263.1|1016667_1018128_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|1018163_1018367_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 54
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1023733	1024624	5489451		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|1023733_1024624_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 55
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1032117	1034250	5489451		Pandoravirus(50.0%)	3	NA	NA
WP_000012618.1|1032117_1033557_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_106910264.1|1033613_1033835_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|1033866_1034250_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 56
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1041995	1043414	5489451		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|1041995_1043414_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 57
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1051295	1052831	5489451		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194888.1|1051295_1052831_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 58
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1056234	1061655	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_106910265.1|1056234_1061655_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.1	1.1e-140
>prophage 59
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1078255	1085191	5489451		Bacillus_phage(50.0%)	3	NA	NA
WP_106884114.1|1078255_1079941_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.9e-10
WP_044805975.1|1079978_1082351_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001245000.1|1082407_1085191_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
>prophage 60
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1090470	1094277	5489451		Bacillus_virus(50.0%)	2	NA	NA
WP_000426272.1|1090470_1091853_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001427328.1|1091877_1094277_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 61
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1098593	1100499	5489451		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193551.1|1098593_1099580_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
WP_001285539.1|1099572_1100499_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
>prophage 62
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1103773	1105215	5489451		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|1103773_1104784_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|1104930_1105215_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 63
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1111227	1111518	5489451		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|1111227_1111518_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 64
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1118403	1119948	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|1118403_1119948_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 65
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1126355	1132740	5489451		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_106910267.1|1126355_1130564_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
WP_000103195.1|1130631_1132740_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-27
>prophage 66
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1137647	1139750	5489451		Salmonella_phage(100.0%)	1	NA	NA
WP_106910268.1|1137647_1139750_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	6.9e-134
>prophage 67
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1144015	1144825	5489451		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|1144015_1144825_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 68
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1148206	1158380	5489451	transposase	Mycoplasma_phage(20.0%)	10	NA	NA
WP_000220396.1|1148206_1149220_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_044805956.1|1149237_1150383_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_044805955.1|1150627_1152034_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|1152112_1152529_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|1152574_1152751_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|1152972_1153203_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|1153294_1155256_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_106884108.1|1155328_1155865_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001307190.1|1155917_1157132_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_064755930.1|1157171_1158380_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	4.6e-207
>prophage 69
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1170182	1171131	5489451		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|1170182_1170356_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|1170600_1171131_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 70
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1175070	1178973	5489451		Klosneuvirus(100.0%)	1	NA	NA
WP_000139567.1|1175070_1178973_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 71
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1210259	1211249	5489451		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|1210259_1211249_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 72
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1216276	1224677	5489451	tRNA,transposase	Escherichia_phage(33.33%)	7	NA	NA
WP_001310555.1|1216276_1217293_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_044805927.1|1217407_1218541_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.8e-117
WP_001295593.1|1218681_1219116_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000081418.1|1219291_1220227_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123745.1|1220355_1221729_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1222206_1223190_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|1223444_1224677_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 73
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1231003	1231519	5489451		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945026.1|1231003_1231519_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
>prophage 74
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1249699	1250782	5489451		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|1249699_1250782_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 75
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1264785	1266051	5489451		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|1264785_1266051_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 76
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1278966	1284624	5489451		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|1278966_1279773_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968850.1|1279840_1280194_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1280561_1281350_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000437858.1|1281494_1282622_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|1282689_1284624_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 77
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1292438	1293029	5489451		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1292438_1293029_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 78
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1297953	1369172	5489451	terminase,head,tail,holin,capsid,integrase,protease	Stx2-converting_phage(30.77%)	77	1362944:1362958	1372988:1373002
WP_001297122.1|1297953_1300551_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|1300930_1301182_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|1301217_1302267_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|1302486_1303245_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|1303241_1303832_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1303871_1304744_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1304844_1305465_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1305461_1306343_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1306480_1306525_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|1306616_1308179_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_044805910.1|1308178_1309774_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_173913236.1|1309774_1311136_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	4.3e-36
WP_000209520.1|1311147_1312341_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1312340_1313147_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1313527_1313707_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1313792_1314293_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1314338_1314845_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001345079.1|1316170_1316821_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|1318327_1318918_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|1319101_1319749_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1319885_1320032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044804821.1|1320459_1320738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950979.1|1322540_1323452_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|1323558_1323681_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106884137.1|1324321_1325635_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	4.6e-80
WP_001228290.1|1325786_1326386_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_106884138.1|1326453_1329927_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_159028792.1|1330167_1330797_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	1.1e-100
WP_032316709.1|1330742_1331486_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.7	8.0e-146
WP_106878693.1|1331496_1332195_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000807940.1|1332194_1332536_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001453698.1|1335823_1336033_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030047.1|1336128_1336503_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_106883934.1|1336508_1337225_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_000133388.1|1337291_1337636_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|1337632_1338079_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|1338075_1338426_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000126019.1|1338435_1338762_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063096.1|1341438_1341660_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_106884084.1|1341704_1343645_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_106884083.1|1343708_1345370_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_000958392.1|1345366_1345930_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_025380422.1|1346218_1346584_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000095736.1|1346625_1346853_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|1347277_1347463_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1347690_1347837_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_106884082.1|1347836_1348406_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	97.4	6.4e-103
WP_106878762.1|1348676_1349210_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	9.6e-101
WP_000731236.1|1349260_1349605_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_024164617.1|1349609_1349825_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_106884081.1|1350263_1352114_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_106884080.1|1352910_1353969_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|1354119_1354317_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|1354558_1355089_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000140024.1|1355097_1355463_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_106884079.1|1355463_1356519_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_012817871.1|1356520_1356793_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_000882662.1|1356960_1357173_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000156210.1|1357673_1358771_+	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_001204666.1|1358730_1359309_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_001002672.1|1359614_1359926_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_000004322.1|1359918_1360173_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001151120.1|1360169_1360592_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	1.3e-63
WP_000095671.1|1360632_1361595_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693943.1|1361617_1362043_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_106884078.1|1362039_1362342_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|1362439_1362811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1362831_1363023_+	hypothetical protein	NA	NA	NA	NA	NA
1362944:1362958	attL	CAGCAATTCCCCATG	NA	NA	NA	NA
WP_001303511.1|1363024_1363303_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001240334.1|1363655_1363955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1364026_1364245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|1364248_1364413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1364813_1365002_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1364998_1365190_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106878764.1|1365282_1367754_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	2.5e-58
WP_000003742.1|1367815_1368085_+	excisionase	NA	NA	NA	NA	NA
WP_000074981.1|1368053_1369172_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	2.9e-83
1372988:1373002	attR	CAGCAATTCCCCATG	NA	NA	NA	NA
>prophage 79
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1372618	1376341	5489451		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|1372618_1373440_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|1373455_1374367_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_024168809.1|1374395_1375640_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|1375639_1376341_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 80
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1383629	1383887	5489451		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1383629_1383887_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 81
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1396210	1397853	5489451		Streptococcus_virus(50.0%)	2	NA	NA
WP_044805755.1|1396210_1397215_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|1397211_1397853_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 82
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1401125	1402307	5489451		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|1401125_1401362_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008538.1|1401572_1402307_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
>prophage 83
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1414664	1415606	5489451		Brevibacillus_phage(100.0%)	1	NA	NA
WP_106884076.1|1414664_1415606_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	32.0	9.6e-11
>prophage 84
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1431455	1431701	5489451		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1431455_1431701_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 85
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1436363	1437284	5489451		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1436363_1437284_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 86
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1446592	1447126	5489451		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|1446592_1447126_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 87
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1451260	1452094	5489451		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1451260_1452094_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 88
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1458110	1459372	5489451		Klebsiella_phage(50.0%)	3	NA	NA
WP_001220314.1|1458110_1458332_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001186738.1|1458394_1458871_-	RadC family protein	NA	NA	NA	NA	NA
WP_106884075.1|1458886_1459372_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	4.0e-13
>prophage 89
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1469982	1470408	5489451		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000422760.1|1469982_1470408_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 90
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1483339	1485195	5489451		uncultured_marine_virus(50.0%)	2	NA	NA
WP_106884070.1|1483339_1483978_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	3.6e-54
WP_001285507.1|1483962_1485195_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	5.0e-60
>prophage 91
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1501225	1513570	5489451	protease	Acinetobacter_phage(42.86%)	12	NA	NA
WP_001223350.1|1501225_1503316_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|1503829_1504216_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|1504639_1505215_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|1505283_1505862_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|1505910_1506951_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_044805736.1|1506973_1507429_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|1507451_1508609_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|1508608_1509190_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|1509512_1510571_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_106884069.1|1510580_1511723_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	5.9e-31
WP_001040060.1|1511715_1512489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|1512490_1513570_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
>prophage 92
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1518090	1520507	5489451	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_000088522.1|1518090_1519704_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_106884067.1|1519734_1520085_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	8.9e-39
WP_000435663.1|1520081_1520507_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
>prophage 93
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1524387	1524528	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_001135715.1|1524387_1524528_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
>prophage 94
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1537446	1626618	5489451	portal,terminase,tail,lysis,holin,capsid,integrase,bacteriocin,transposase	Escherichia_phage(51.61%)	91	1593057:1593071	1627469:1627483
WP_001171554.1|1537446_1537827_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1537823_1538171_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_044804944.1|1538220_1539759_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
WP_000136079.1|1540177_1540354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|1540515_1542876_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|1543030_1543594_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|1544414_1545848_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|1546066_1546264_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|1546490_1546787_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|1547898_1549716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000009226.1|1551370_1552057_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000533522.1|1552637_1553426_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_001199164.1|1554044_1555316_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_106910270.1|1555321_1556449_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|1556506_1557337_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018496.1|1558002_1559511_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|1559669_1559879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044805727.1|1559933_1563896_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|1563935_1564574_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001307708.1|1565956_1566649_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_044805726.1|1566660_1567047_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001345413.1|1567054_1567855_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001171.1|1567864_1568455_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|1568465_1568960_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|1568980_1570309_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|1570390_1570564_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_032346983.1|1571522_1571810_+	antA/AntB antirepressor family protein	NA	V5URG2	Shigella_phage	97.9	1.7e-48
WP_106910271.1|1572059_1572683_+	antA/AntB antirepressor family protein	NA	A0A088CBR4	Shigella_phage	85.0	1.2e-97
WP_000763353.1|1572730_1572952_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_001024844.1|1572948_1573233_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_001120841.1|1573710_1574118_+	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_000426668.1|1574117_1574513_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_000935259.1|1574746_1574959_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756595.1|1575078_1575423_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_106910272.1|1575973_1584355_-	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	98.7	0.0e+00
WP_000012450.1|1584424_1585690_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000540391.1|1585700_1585952_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455644.1|1585961_1586408_-	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000509481.1|1586410_1587067_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|1587160_1587562_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|1587618_1587759_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_032320325.1|1587991_1588726_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	99.6	6.3e-135
WP_106910273.1|1588816_1589434_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	99.0	2.8e-120
WP_000455635.1|1589439_1589718_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_016241167.1|1589732_1591001_-	host specificity protein J	NA	A0A0N7C124	Escherichia_phage	98.1	2.1e-218
WP_001146326.1|1590997_1592623_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|1592917_1593106_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
1593057:1593071	attL	ATTAACCAGGATTCT	NA	NA	NA	NA
WP_001023407.1|1593246_1593516_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_032276022.1|1593517_1595455_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_000207923.1|1595451_1596102_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000829200.1|1596101_1596665_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|1596648_1597110_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|1597159_1597549_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|1597604_1598819_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_096844509.1|1598842_1599850_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	99.7	5.2e-180
WP_000787034.1|1600007_1602152_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|1602151_1603858_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|1603838_1604645_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000738505.1|1605053_1605347_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|1605378_1605843_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|1605850_1606000_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|1605999_1606569_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|1606843_1607377_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|1607381_1607597_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290231.1|1607673_1607946_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|1607986_1608166_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106878699.1|1608301_1610239_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_001434745.1|1610716_1611145_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.5	2.6e-64
WP_001059384.1|1611760_1612450_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|1612446_1612812_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|1612812_1613868_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|1613869_1614148_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|1614217_1614475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910274.1|1614695_1614908_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	6.6e-21
WP_001449026.1|1615186_1615945_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1616643_1616808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450683.1|1616804_1617539_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_157825328.1|1617572_1618115_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|1618026_1619067_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000912298.1|1619572_1619800_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|1619876_1620284_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1620548_1620848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|1620920_1621139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1621161_1621569_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|1621546_1621780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143208743.1|1621773_1621941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1622340_1622529_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1622525_1622714_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106884093.1|1622809_1625197_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|1625261_1625510_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1625487_1626618_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
1627469:1627483	attR	AGAATCCTGGTTAAT	NA	NA	NA	NA
>prophage 95
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1634585	1636600	5489451		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|1634585_1635590_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|1635586_1636600_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 96
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1646010	1656198	5489451		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|1646010_1646628_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287380.1|1647232_1647646_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|1647788_1648697_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193437.1|1648898_1649912_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|1650003_1650909_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|1651021_1651480_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|1651529_1652372_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|1653275_1653953_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|1653952_1654663_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|1654659_1656198_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 97
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1667451	1667682	5489451		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_044806014.1|1667451_1667682_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	38.7	2.5e-05
>prophage 98
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1670783	1674791	5489451		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|1670783_1671638_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257045.1|1671673_1672483_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|1672486_1672879_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|1672875_1673709_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|1673708_1674791_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 99
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1677927	1680679	5489451		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|1677927_1678875_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|1678999_1680679_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 100
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1708696	1709116	5489451		Morganella_phage(100.0%)	1	NA	NA
WP_000897378.1|1708696_1709116_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 101
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1717634	1719956	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_001369554.1|1717634_1719956_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
>prophage 102
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1725823	1819934	5489451	terminase,portal,tail,head,tRNA,holin,capsid,integrase,protease	Stx2-converting_phage(27.27%)	108	1745914:1745930	1823415:1823431
WP_000332303.1|1725823_1726555_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|1726775_1727180_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|1727232_1727343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|1727875_1728199_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|1728301_1729552_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|1729723_1730377_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|1730386_1730848_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|1730901_1732008_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1732043_1732685_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1732688_1734059_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|1734226_1734898_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|1734897_1736358_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133425.1|1737214_1737496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127893.1|1737509_1739171_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000113645.1|1739154_1739511_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|1739634_1739817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145903.1|1739800_1740241_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000134113.1|1740240_1740537_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020660.1|1740533_1740872_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000267612.1|1740868_1742080_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_000504050.1|1742081_1742654_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_001137345.1|1742693_1743851_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|1744143_1744368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|1744775_1745186_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198852.1|1745182_1745434_-	hypothetical protein	NA	NA	NA	NA	NA
1745914:1745930	attL	ATTCCGGCAGCATCCAG	NA	NA	NA	NA
WP_000770148.1|1747933_1748233_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000794515.1|1748238_1748481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|1748470_1748662_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000920682.1|1748661_1748847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|1748839_1749037_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001304194.1|1749062_1749806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|1749863_1750052_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_044806027.1|1751893_1753015_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359438.1|1753160_1754390_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|1754639_1755776_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799400.1|1755759_1756623_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_024228725.1|1756986_1758348_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	5.2e-50
WP_044806029.1|1758408_1758684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|1759655_1763057_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|1763647_1765996_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|1766015_1766105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106878697.1|1766211_1766481_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.7e-43
WP_106910351.1|1767859_1768459_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.6e-110
WP_106884201.1|1768526_1772006_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.7	0.0e+00
WP_072148837.1|1772254_1772887_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.2	2.5e-103
WP_106878694.1|1772832_1773570_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	9.4e-147
WP_106884279.1|1773624_1774548_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.7	1.1e-176
WP_001154345.1|1774618_1774792_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|1774899_1775220_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_106878693.1|1775236_1775935_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000807940.1|1775934_1776276_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001453698.1|1779563_1779773_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030047.1|1779868_1780243_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_106883934.1|1780248_1780965_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_000133388.1|1781031_1781376_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|1781372_1781819_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|1781815_1782166_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000126019.1|1782175_1782502_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|1784702_1784924_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_001502569.1|1784968_1786906_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.1	0.0e+00
WP_106884202.1|1786969_1788631_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_000958416.1|1788627_1789191_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|1789478_1789844_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|1789885_1790071_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|1790200_1790341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|1790697_1790922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|1790986_1791193_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|1791420_1791567_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1791566_1792136_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_106910277.1|1792406_1792940_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	4.8e-100
WP_000731241.1|1792990_1793335_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|1793339_1793555_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_106884145.1|1793704_1795558_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000301785.1|1796916_1797630_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001369585.1|1797764_1797962_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.0e-27
WP_000211416.1|1798204_1798786_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000640148.1|1799059_1799614_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000228019.1|1799610_1799901_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000940348.1|1799900_1800500_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
WP_000687443.1|1800559_1800733_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	7.3e-18
WP_000967408.1|1800985_1801198_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|1801386_1801491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173913233.1|1801606_1802353_-	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	52.2	9.8e-59
WP_001014289.1|1803030_1803222_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	1.6e-26
WP_044805253.1|1803223_1803691_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_044805254.1|1803837_1804311_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.2	6.8e-66
WP_044805255.1|1804307_1804730_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_044805256.1|1804745_1805507_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.8	1.7e-111
WP_044805258.1|1805529_1806276_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	9.0e-113
WP_044805259.1|1806282_1807065_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	66.0	7.1e-44
WP_044805260.1|1807142_1807565_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	4.5e-69
WP_001033914.1|1807561_1807804_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|1807900_1808320_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|1808626_1808779_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000560219.1|1809199_1809421_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.5e-36
WP_000358365.1|1809420_1809591_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.9	2.0e-15
WP_044805262.1|1809665_1809941_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	4.4e-41
WP_096317506.1|1810041_1813191_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	74.2	0.0e+00
WP_010989194.1|1814318_1814513_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_024177035.1|1814505_1814694_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.7	3.9e-17
WP_005127484.1|1814800_1815082_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_001189085.1|1815047_1816124_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_000976492.1|1816516_1816858_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1816870_1817743_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1817746_1818121_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1818259_1818490_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|1818591_1819248_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1819271_1819934_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
1823415:1823431	attR	ATTCCGGCAGCATCCAG	NA	NA	NA	NA
>prophage 103
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1827990	1829466	5489451		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|1827990_1829466_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 104
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1839918	1844962	5489451		Listeria_phage(33.33%)	5	NA	NA
WP_001184045.1|1839918_1841241_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|1841256_1842189_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1842267_1843023_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|1843019_1843805_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1843951_1844962_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
>prophage 105
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1848288	1848810	5489451		Bacillus_virus(100.0%)	1	NA	NA
WP_001295503.1|1848288_1848810_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 106
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1852828	1950685	5489451	portal,terminase,head,tail,tRNA,holin,capsid,integrase,plate,transposase	Enterobacteria_phage(64.15%)	107	1892406:1892465	1928060:1928183
WP_000639271.1|1852828_1853647_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
WP_000252979.1|1853699_1854095_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|1854135_1854879_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|1854875_1855847_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001185741.1|1859952_1860699_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|1860712_1861279_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|1861494_1863228_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|1863404_1863893_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|1864012_1864405_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_106910278.1|1864404_1866483_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|1866475_1867624_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1867825_1868470_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1868480_1868870_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1868884_1869934_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1869936_1870797_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|1870815_1872420_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|1872465_1874127_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1874271_1874775_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_106910279.1|1874795_1876760_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|1876764_1877691_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|1877687_1878575_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1878701_1879280_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1879282_1879633_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_044805276.1|1880412_1880841_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1880847_1882272_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|1882246_1883047_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|1883213_1884200_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_106884149.1|1884214_1885729_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	9.6e-13
WP_000548675.1|1885798_1886788_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1887584_1888088_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1888166_1888418_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1888532_1888619_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|1888881_1889205_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|1889375_1889873_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1889910_1890150_-	YecH family protein	NA	NA	NA	NA	NA
WP_044805279.1|1890340_1891552_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|1891613_1892279_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1892406:1892465	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_024245123.1|1892635_1893637_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	3.2e-105
WP_106884150.1|1893642_1893990_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290355.1|1894019_1894670_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|1894685_1895090_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1895179_1895317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1895388_1895592_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|1895613_1895964_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159466.1|1895974_1896253_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	6.2e-35
WP_106884151.1|1896264_1896507_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	4.9e-36
WP_000021668.1|1896520_1896634_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985146.1|1896720_1896924_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	1.1e-25
WP_000153684.1|1896920_1897166_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000599413.1|1897307_1897673_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.1e-60
WP_044805281.1|1897679_1900502_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.6	0.0e+00
WP_000686557.1|1900578_1901538_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	8.4e-180
WP_106884152.1|1901542_1901857_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	2.7e-18
WP_000201254.1|1901876_1902308_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224220.1|1902309_1902573_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_095597302.1|1903084_1904125_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	6.9e-204
WP_000613804.1|1904124_1905876_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262681.1|1906030_1906867_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
WP_001055082.1|1906890_1907943_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	1.9e-188
WP_106884153.1|1907988_1908789_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	86.1	1.5e-121
WP_000063074.1|1908892_1909387_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_000864893.1|1909386_1909587_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	3.0e-31
WP_000104351.1|1909589_1909913_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	3.6e-50
WP_000072319.1|1909909_1910302_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	3.2e-69
WP_000780566.1|1910298_1910706_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
WP_021521823.1|1910844_1912725_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.1	4.2e-300
WP_095597304.1|1912748_1913216_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	3.0e-82
WP_000356335.1|1913208_1913844_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_077626052.1|1913855_1914422_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	2.8e-98
WP_106884155.1|1914773_1915670_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.5e-154
WP_000071727.1|1915662_1916271_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.4	7.6e-86
WP_137531705.1|1916267_1918055_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.2	2.0e-94
WP_000885636.1|1918281_1918860_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	90.1	2.7e-96
WP_000954200.1|1918903_1919476_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_044805293.1|1919632_1920121_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.4e-84
WP_001388248.1|1920133_1922941_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000333503.1|1922927_1923083_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|1923091_1923466_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|1923521_1924034_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005386.1|1924033_1925218_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_000132825.1|1925375_1926485_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	9.0e-194
WP_000488112.1|1926527_1926788_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|1926979_1927120_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001303543.1|1927308_1927590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160187.1|1928582_1929131_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
1928060:1928183	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_106910280.1|1929187_1931020_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000611335.1|1931016_1931673_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_000590347.1|1931968_1932145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106474.1|1932131_1932356_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001154271.1|1932422_1933145_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_001272994.1|1933374_1934127_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001158220.1|1934123_1934792_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001128215.1|1934806_1935793_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001295643.1|1935897_1936698_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001344677.1|1936785_1937337_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001087467.1|1937382_1938102_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_000079816.1|1938266_1939745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146093.1|1939999_1941412_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287769.1|1941426_1941837_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001015023.1|1941836_1942202_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245704.1|1942279_1943767_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001344676.1|1943800_1944214_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118907.1|1944400_1945606_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790498.1|1945602_1945836_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_044805302.1|1945942_1946614_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_106884156.1|1946653_1947862_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	4.1e-208
WP_001310555.1|1949668_1950685_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 107
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1966286	1978758	5489451		Bacillus_phage(28.57%)	12	NA	NA
WP_077787583.1|1966286_1967981_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1968151_1968334_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1968412_1969330_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|1969502_1970423_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1970411_1970882_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_044805307.1|1970862_1972281_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.4	1.0e-101
WP_000365565.1|1972347_1973043_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_077787584.1|1973082_1973448_-	permease	NA	NA	NA	NA	NA
WP_106884158.1|1974014_1975178_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	4.2e-109
WP_000218209.1|1975769_1976621_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_044805311.1|1976728_1978087_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	5.1e-05
WP_001362894.1|1978086_1978758_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
>prophage 108
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	1982297	1982828	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|1982297_1982828_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 109
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2008958	2009975	5489451	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001310555.1|2008958_2009975_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 110
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2028366	2030536	5489451		Yersinia_phage(33.33%)	4	NA	NA
WP_044805320.1|2028366_2029185_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	3.0e-45
WP_044805322.1|2029275_2029761_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	3.1e-13
WP_159028785.1|2029775_2030252_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000692323.1|2030314_2030536_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 111
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2034879	2036046	5489451		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001320295.1|2034879_2036046_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 112
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2043690	2044590	5489451		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2043690_2044590_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 113
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2051943	2069558	5489451		Enterobacteria_phage(27.27%)	16	NA	NA
WP_097508393.1|2051943_2053110_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	2.5e-109
WP_032223505.1|2053357_2054764_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	8.0e-38
WP_032223506.1|2054882_2055902_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.6	4.6e-83
WP_032208178.1|2055915_2056725_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157848876.1|2056721_2057765_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032223509.1|2057779_2058724_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_047091193.1|2058710_2059511_-	glycosyltransferase	NA	A0A2P1ELT8	Moumouvirus	26.9	3.4e-09
WP_106910285.1|2059503_2060826_-	O107/O117 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_032223512.1|2060818_2062036_-	O107/O117 family O-antigen flippase	NA	NA	NA	NA	NA
WP_032208168.1|2062035_2062578_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.5	4.6e-50
WP_032223514.1|2062582_2063461_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	5.1e-107
WP_032223515.1|2063518_2064418_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	9.7e-29
WP_106884167.1|2064417_2065503_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_000183060.1|2065874_2066768_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|2067010_2068006_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_032223520.1|2068163_2069558_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	8.3e-19
>prophage 114
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2075270	2082064	5489451		Bacillus_phage(25.0%)	6	NA	NA
WP_001358507.1|2075270_2076641_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.0	1.4e-31
WP_000079285.1|2076833_2078270_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699701.1|2078272_2079496_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479827.1|2079492_2079972_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043615.1|2079974_2080940_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	3.8e-87
WP_000048190.1|2080942_2082064_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 115
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2086307	2097206	5489451		uncultured_marine_virus(16.67%)	11	NA	NA
WP_000654516.1|2086307_2087147_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.3e-06
WP_106884168.1|2087275_2089438_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_001602873.1|2089440_2089884_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_044805338.1|2089889_2091029_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|2091337_2091487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044805339.1|2091687_2093271_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_044805340.1|2093345_2093684_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044805342.1|2093673_2093964_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	3.6e-09
WP_044805343.1|2094016_2095870_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2095891_2096473_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2096564_2097206_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 116
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2101870	2103223	5489451		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469759.1|2101870_2103223_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 117
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2107790	2157543	5489451	portal,terminase,head,tail,holin,capsid,integrase,protease,transposase	Enterobacteria_phage(38.78%)	61	2143490:2143505	2163261:2163276
WP_024233391.1|2107790_2109173_+	type III secretion system effector NleA	NA	Q6H9S2	Enterobacteria_phage	92.2	1.1e-220
WP_001310555.1|2110008_2111025_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001023380.1|2111909_2112179_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_000279020.1|2112180_2113494_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	1.5e-78
WP_001228241.1|2113558_2114158_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_106910287.1|2114225_2117705_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.7	0.0e+00
WP_000090891.1|2117765_2118398_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_106878745.1|2118334_2119078_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.0e-146
WP_106884172.1|2119083_2119782_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	4.4e-130
WP_000847413.1|2119781_2120111_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_096961651.1|2120107_2122669_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.7	0.0e+00
WP_000533431.1|2122649_2123063_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|2123089_2123521_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_106884173.1|2123534_2124287_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.4	9.0e-129
WP_000683071.1|2124294_2124690_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|2124686_2125262_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|2125276_2125630_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|2125622_2125997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|2126048_2127077_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|2127134_2127482_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_106884043.1|2127518_2129024_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	9.3e-101
WP_001430223.1|2129013_2130606_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|2130602_2130809_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_032205109.1|2130792_2132721_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.2e-262
WP_000235436.1|2132692_2133202_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_106884042.1|2133597_2133822_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_044805775.1|2133892_2134219_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|2134746_2134932_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|2135153_2135267_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|2135487_2136021_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|2136180_2136453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|2136708_2136924_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_106910288.1|2137362_2139213_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_101898425.1|2139980_2140694_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|2140828_2141026_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|2141312_2142131_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|2142282_2142654_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|2142643_2143015_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|2143027_2144077_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
2143490:2143505	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_001341388.1|2144078_2144357_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000902696.1|2144524_2144737_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|2144925_2145030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|2145145_2146015_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|2146025_2146289_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|2146540_2146753_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|2146803_2147160_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|2147137_2147599_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|2147595_2147892_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_106884040.1|2147888_2148311_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	2.6e-64
WP_106884039.1|2148351_2149410_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.1	4.6e-62
WP_106910289.1|2149481_2149907_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|2149903_2150119_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103686.1|2150168_2150885_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000379580.1|2151157_2151310_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000394557.1|2151321_2151696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2152228_2152417_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2152413_2152605_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_044806223.1|2152697_2155169_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000273151.1|2155236_2155479_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299701.1|2155456_2156476_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
WP_000375138.1|2156883_2157543_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2163261:2163276	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
>prophage 118
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2161776	2163831	5489451		Bacillus_phage(100.0%)	1	NA	NA
WP_106910290.1|2161776_2163831_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 119
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2176430	2178338	5489451		Tupanvirus(100.0%)	1	NA	NA
WP_044806219.1|2176430_2178338_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 120
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2194260	2205393	5489451	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_106884034.1|2194260_2195028_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	2.2e-29
WP_000193859.1|2195234_2197847_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_106884033.1|2198112_2199315_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|2199483_2200884_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|2201485_2202574_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_106884032.1|2202758_2203949_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109487.1|2204170_2204818_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2204844_2205393_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 121
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2220098	2224639	5489451		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|2220098_2221847_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_044806209.1|2221883_2224148_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|2224354_2224639_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 122
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2229725	2230814	5489451		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|2229725_2230814_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 123
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2234912	2238127	5489451		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|2234912_2237195_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|2237386_2238127_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 124
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2244436	2268155	5489451	protease,tRNA	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|2244436_2245054_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|2245064_2247509_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|2247747_2249040_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|2249130_2250474_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_024256851.1|2250484_2251096_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_106884030.1|2251250_2255279_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2255413_2255908_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2256451_2257417_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043619.1|2257539_2259306_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|2259306_2261028_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_044806204.1|2261069_2261774_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2262058_2262277_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_044806203.1|2262961_2265238_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	9.6e-166
WP_000520781.1|2265268_2265589_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2265911_2266136_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|2266208_2268155_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 125
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2277452	2279171	5489451		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_001645127.1|2277452_2279171_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 126
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2282758	2285496	5489451		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255144.1|2282758_2283589_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160723.1|2283585_2283909_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|2284034_2284550_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|2284767_2285496_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 127
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2288833	2297983	5489451		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149732.1|2288833_2289961_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|2290001_2290490_-	YbjO family protein	NA	NA	NA	NA	NA
WP_106884028.1|2290549_2291395_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|2291391_2292345_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|2292354_2293488_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126055.1|2293582_2294695_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|2295045_2295522_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|2295609_2296512_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|2296572_2297295_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|2297278_2297566_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|2297725_2297983_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 128
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2306549	2307752	5489451		Stx2-converting_phage(100.0%)	1	NA	NA
WP_106884278.1|2306549_2307752_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	6.3e-100
>prophage 129
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2319087	2320959	5489451		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|2319087_2320959_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 130
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2324174	2332512	5489451		Synechococcus_phage(33.33%)	6	NA	NA
WP_000424890.1|2324174_2324837_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_044806190.1|2324967_2325867_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_044806188.1|2325872_2328305_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114244.1|2328450_2329266_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_106884026.1|2329417_2330683_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|2330919_2332512_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 131
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2337509	2342741	5489451		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|2337509_2338025_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|2338077_2338143_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|2338377_2339265_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|2339570_2340074_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|2340477_2341224_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159066.1|2341362_2342022_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|2342018_2342741_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 132
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2346281	2361003	5489451		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|2346281_2346542_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_106884025.1|2346804_2349087_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_044806186.1|2349128_2349806_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	5.2e-19
WP_000146343.1|2349879_2350146_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|2350410_2350671_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443534.1|2350810_2351896_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|2352036_2352999_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218655.1|2353026_2355177_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_001145128.1|2355296_2355779_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007102.1|2356011_2357376_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|2357604_2358276_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_044806185.1|2358278_2359274_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_044806184.1|2359266_2361003_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
>prophage 133
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2371600	2372509	5489451		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|2371600_2372509_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 134
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2378990	2386226	5489451	transposase	Klosneuvirus(33.33%)	9	NA	NA
WP_071829727.1|2378990_2380280_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.0e-18
WP_000767389.1|2380338_2380815_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|2381318_2381972_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|2381984_2382206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106884021.1|2382289_2382676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806244.1|2382876_2383452_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	75.8	5.5e-70
WP_000091308.1|2383497_2383863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106910293.1|2383862_2385050_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000345401.1|2385506_2386226_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	3.2e-22
>prophage 135
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2423973	2424765	5489451		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114037.1|2423973_2424765_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	3.7e-08
>prophage 136
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2428143	2431085	5489451		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|2428143_2429625_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_044806171.1|2429666_2431085_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	8.9e-61
>prophage 137
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2435167	2447888	5489451		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_106910295.1|2435167_2439361_-	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	1.2e-23
WP_044806165.1|2439603_2439810_-	YbfA family protein	NA	NA	NA	NA	NA
WP_044806164.1|2440122_2440212_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000730095.1|2440211_2441885_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087956.1|2441907_2443956_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	1.6e-26
WP_001297248.1|2443964_2444537_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_044806161.1|2444529_2447214_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186103.1|2447210_2447888_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 138
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2454543	2455308	5489451		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|2454543_2455308_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 139
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2459457	2463271	5489451	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|2459457_2461122_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|2461324_2463271_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 140
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2467897	2469562	5489451		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|2467897_2469562_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 141
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2473697	2474738	5489451		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|2473697_2474738_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 142
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2482634	2486167	5489451		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|2482634_2483360_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|2483477_2484413_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_044806151.1|2484496_2486167_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	1.8e-76
>prophage 143
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2491692	2496887	5489451	tRNA,transposase	Escherichia_phage(50.0%)	3	NA	NA
WP_001310555.1|2491692_2492709_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001044880.1|2493587_2494070_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_044806145.1|2494304_2496887_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 144
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2503896	2506336	5489451		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231415.1|2503896_2504985_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|2505124_2506336_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 145
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2511151	2511799	5489451		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|2511151_2511535_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|2511589_2511799_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 146
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2527224	2529339	5489451		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|2527224_2527653_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|2527773_2529339_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 147
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2532448	2534271	5489451		Mycobacterium_phage(50.0%)	2	NA	NA
WP_044806141.1|2532448_2533669_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	30.5	6.7e-57
WP_000502941.1|2533641_2534271_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 148
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2548811	2554854	5489451		Klosneuvirus(50.0%)	3	NA	NA
WP_001005919.1|2548811_2549627_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096713.1|2549623_2550757_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_106884009.1|2550972_2554854_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
>prophage 149
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2566283	2569427	5489451		Leptospira_phage(100.0%)	1	NA	NA
WP_000573943.1|2566283_2569427_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
>prophage 150
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2572697	2574819	5489451		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|2572697_2573381_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000253805.1|2573370_2574819_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
>prophage 151
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2583120	2637331	5489451	portal,terminase,head,tail,lysis,tRNA,capsid,protease,transposase	Enterobacteria_phage(64.86%)	56	NA	NA
WP_000420935.1|2583120_2584257_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383941.1|2584525_2586763_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_106884007.1|2586749_2589722_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_044806127.1|2589722_2590613_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|2590795_2591557_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201825.1|2592069_2593023_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_106884006.1|2593209_2594694_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|2595239_2595908_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_106884005.1|2595962_2596547_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	1.8e-100
WP_106884276.1|2596546_2599489_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	97.4	8.6e-58
WP_001230523.1|2599553_2600153_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_106910298.1|2600223_2603637_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
WP_000090891.1|2603697_2604330_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000194780.1|2604266_2605010_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_001152619.1|2605015_2605714_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847347.1|2605713_2606043_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|2606039_2608601_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|2608593_2609028_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|2609009_2609432_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|2609447_2610188_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|2610195_2610591_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|2610587_2611166_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|2611156_2611531_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|2611542_2611938_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|2611979_2613005_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_106884004.1|2613060_2613393_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	8.4e-55
WP_000123322.1|2613402_2614722_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_095597335.1|2614702_2616304_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.0	1.2e-303
WP_000198149.1|2616300_2616507_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_106884003.1|2616503_2618429_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453558.1|2618403_2618949_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001427981.1|2619337_2619532_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|2619891_2620185_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2620275_2620458_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135274.1|2620674_2621172_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|2621171_2621387_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737278.1|2621975_2623058_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_044806113.1|2623246_2623630_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	6.3e-54
WP_000971074.1|2623715_2623856_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|2623852_2624215_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|2624211_2624502_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|2624494_2624665_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_044806112.1|2624664_2625120_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_072097617.1|2625116_2625218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|2625341_2625743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|2625721_2626138_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000805428.1|2627445_2628078_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001255226.1|2628080_2628596_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001350487.1|2628606_2629647_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_044806111.1|2629625_2632235_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988363.1|2632265_2632958_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|2633177_2633720_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|2634200_2635067_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2635068_2635281_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143540.1|2635388_2635910_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912342.1|2635945_2637331_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
>prophage 152
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2656087	2657869	5489451		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_106883999.1|2656087_2657869_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	1.3e-37
>prophage 153
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2670177	2670864	5489451		Planktothrix_phage(100.0%)	1	NA	NA
WP_106883998.1|2670177_2670864_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.7e-33
>prophage 154
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2674000	2674678	5489451		Bacillus_virus(100.0%)	1	NA	NA
WP_001157532.1|2674000_2674678_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
>prophage 155
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2679217	2682177	5489451		uncultured_virus(50.0%)	2	NA	NA
WP_044806097.1|2679217_2681722_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_001342071.1|2681835_2682177_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
>prophage 156
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2690421	2698983	5489451		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801832.1|2690421_2691381_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_106910299.1|2691377_2692340_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|2692575_2693220_-	adenylate kinase	NA	NA	NA	NA	NA
WP_044806092.1|2693400_2695275_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|2695384_2695990_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|2695989_2696319_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|2696371_2698303_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|2698431_2698983_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 157
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2705992	2709142	5489451		Leptospira_phage(100.0%)	1	NA	NA
WP_001132475.1|2705992_2709142_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 158
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2717977	2721524	5489451		Bacillus_phage(100.0%)	2	NA	NA
WP_001256174.1|2717977_2719759_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001235581.1|2719751_2721524_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.0e-49
>prophage 159
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2724847	2725543	5489451		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|2724847_2725543_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 160
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2728671	2733718	5489451	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|2728671_2728944_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|2729152_2731507_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|2731694_2732969_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|2733094_2733718_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 161
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2757549	2766530	5489451	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|2757549_2758020_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_063109308.1|2758108_2759212_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|2759215_2759665_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|2759815_2760355_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|2760653_2761538_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|2761714_2762062_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|2762190_2763162_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|2763172_2765020_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|2765047_2765380_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|2765402_2766530_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 162
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2773482	2783454	5489451		Bacillus_phage(60.0%)	7	NA	NA
WP_000893609.1|2773482_2774778_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
WP_044806080.1|2774835_2775525_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	2.8e-36
WP_001221319.1|2775714_2776917_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698929.1|2776913_2780057_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001306939.1|2780182_2781367_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219321.1|2781509_2782418_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|2782542_2783454_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 163
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2787743	2788859	5489451		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|2787743_2788859_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 164
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2796267	2797425	5489451		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_053896259.1|2796267_2797425_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 165
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2804395	2805163	5489451		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939373.1|2804395_2805163_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 166
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2810459	2811569	5489451		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_106883993.1|2810459_2811569_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 167
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2814746	2816707	5489451		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|2814746_2815760_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|2815756_2816707_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 168
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2822117	2826397	5489451		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805913.1|2822117_2823200_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.2	1.8e-191
WP_044806071.1|2823322_2826397_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
>prophage 169
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2830237	2835934	5489451		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952485.1|2830237_2831137_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
WP_044806069.1|2831176_2832460_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|2832449_2833709_-	cytosine permease	NA	NA	NA	NA	NA
WP_044806068.1|2834047_2835934_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 170
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2844310	2848848	5489451		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_044806067.1|2844310_2845360_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
WP_000750340.1|2845446_2846403_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|2846399_2847371_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|2847363_2848848_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 171
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2860841	2928003	5489451	integrase,capsid,holin,transposase	Escherichia_phage(23.08%)	56	2902776:2902795	2916623:2916642
WP_106884275.1|2860841_2864825_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	9.3e-124
WP_044806065.1|2865397_2867431_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|2867559_2868147_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089070.1|2868160_2869633_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_044806064.1|2869646_2871317_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.4e-60
WP_001209113.1|2871529_2872195_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|2872440_2873136_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023919.1|2873128_2874556_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|2874566_2875286_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|2875812_2876667_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046293.1|2876892_2878218_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474084.1|2878326_2878563_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|2878574_2879168_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|2879327_2880197_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_159028779.1|2880445_2881303_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044806063.1|2881423_2885677_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|2886791_2886893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|2887256_2887520_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|2887519_2887660_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|2887694_2887922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|2888743_2889286_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_106883990.1|2889359_2889947_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|2890004_2890673_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|2890698_2893224_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001323478.1|2893213_2894857_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|2894825_2895536_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|2895848_2896178_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|2896425_2897040_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|2897457_2898147_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643328.1|2898143_2899100_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667026.1|2899096_2901295_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_106883988.1|2901304_2902261_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111350.1|2902239_2902650_+	hypothetical protein	NA	NA	NA	NA	NA
2902776:2902795	attL	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_173913238.1|2902938_2904240_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_044806060.1|2904296_2905010_-	hypothetical protein	NA	A0A291LAA9	Escherichia_phage	61.9	2.2e-68
WP_001310555.1|2906233_2907250_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000452041.1|2908087_2908291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806058.1|2908376_2909405_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_001570993.1|2909423_2909786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806057.1|2909782_2909995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806056.1|2910325_2910664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806055.1|2910665_2911067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806054.1|2911199_2911478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806053.1|2911494_2912226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806052.1|2912373_2912556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065231.1|2914773_2915313_+	recombinase family protein	NA	Q2A092	Sodalis_phage	43.8	1.1e-27
WP_000788776.1|2915864_2916017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106883986.1|2918295_2918736_+	hypothetical protein	NA	NA	NA	NA	NA
2916623:2916642	attR	ATGGTGCCGATAATAGGAGT	NA	NA	NA	NA
WP_021515894.1|2918732_2918957_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106883985.1|2919073_2919928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032186134.1|2920924_2921551_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_106883984.1|2921848_2923441_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	6.1e-175
WP_000624718.1|2923471_2923822_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_106883983.1|2923818_2924244_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_087498070.1|2924486_2925329_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001509364.1|2925351_2928003_-	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	25.1	5.4e-43
>prophage 172
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2931336	2942241	5489451		Streptococcus_phage(25.0%)	11	NA	NA
WP_000642925.1|2931336_2931747_+	hypothetical protein	NA	G5DES5	Salmonella_phage	42.6	2.1e-26
WP_000480477.1|2931812_2932751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234373.1|2932840_2933659_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000214420.1|2933750_2934236_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001186786.1|2934251_2934728_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692308.1|2934796_2935018_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_000942525.1|2936301_2937372_+	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_001444700.1|2937350_2938010_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000893255.1|2938529_2939783_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|2939794_2940898_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|2941185_2942241_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 173
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2946918	2948058	5489451		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528862.1|2946918_2948058_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
>prophage 174
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2953136	2957055	5489451		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543897.1|2953136_2953910_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
WP_000729704.1|2954095_2954356_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|2954358_2954637_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|2954792_2955533_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|2955503_2956271_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|2956476_2957055_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 175
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2964412	2970868	5489451		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_106883979.1|2964412_2968651_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
WP_000103319.1|2968726_2970868_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
>prophage 176
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2981832	2984658	5489451		Cronobacter_phage(100.0%)	1	NA	NA
WP_106910301.1|2981832_2984658_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.9	1.0e-79
>prophage 177
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	2995134	3002987	5489451		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001297205.1|2995134_2995866_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|2995930_2996398_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326291.1|2996394_2997117_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|2997150_2997906_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2997977_2999336_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000155276.1|2999383_3000154_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3000231_3001032_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648609.1|3001272_3002187_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997040.1|3002183_3002987_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
>prophage 178
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3009635	3010667	5489451		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3009635_3010667_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 179
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3023625	3027741	5489451		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|3023625_3027108_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3027144_3027741_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 180
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3036569	3037328	5489451		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001341242.1|3036569_3037328_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.7	2.2e-26
>prophage 181
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3049922	3051347	5489451	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_044805094.1|3049922_3051347_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 182
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3055276	3055621	5489451		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3055276_3055621_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 183
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3061532	3062330	5489451		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3061532_3062330_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 184
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3067509	3074315	5489451	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001369168.1|3067509_3069939_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
WP_001294700.1|3070012_3070543_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|3070557_3071262_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|3071439_3071895_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|3071931_3072858_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174639.1|3072896_3074315_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 185
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3084222	3085125	5489451		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|3084222_3085125_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 186
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3088387	3094855	5489451		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|3088387_3089314_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|3089422_3090085_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|3090125_3090662_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_106910303.1|3090867_3093258_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_044805099.1|3093304_3094855_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 187
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3102504	3103929	5489451		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_044805126.1|3102504_3103929_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	7.1e-42
>prophage 188
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3112556	3113108	5489451		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|3112556_3113108_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 189
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3117353	3118397	5489451		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|3117353_3118397_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 190
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3144371	3146096	5489451		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|3144371_3146096_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 191
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3158798	3159497	5489451		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|3158798_3159497_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 192
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3165829	3171252	5489451		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035672.1|3165829_3168181_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	6.0e-38
WP_044805107.1|3168345_3171252_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 193
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3178996	3181749	5489451		Microcystis_phage(50.0%)	4	NA	NA
WP_000257163.1|3178996_3179845_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000796358.1|3179869_3180469_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_000998542.1|3181069_3181249_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|3181269_3181749_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 194
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3189644	3195305	5489451		Vibrio_phage(50.0%)	4	NA	NA
WP_044805110.1|3189644_3191159_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	4.6e-07
WP_000347117.1|3191189_3192332_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_106883973.1|3192460_3193678_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000351348.1|3193751_3195305_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
>prophage 195
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3200775	3201924	5489451		Halovirus(100.0%)	1	NA	NA
WP_044805113.1|3200775_3201924_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 196
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3206330	3209147	5489451	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|3206330_3209147_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 197
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3216188	3225257	5489451		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681360.1|3216188_3217355_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|3217883_3218093_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|3218196_3219327_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|3219415_3221332_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|3221708_3222113_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_044805119.1|3222138_3222852_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_044805120.1|3223000_3223567_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|3223601_3224189_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|3224303_3225257_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 198
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3230758	3319275	5489451	portal,tail,lysis,tRNA,holin,integrase,protease	Enterobacteria_phage(35.94%)	96	3241971:3241994	3322398:3322421
WP_001188659.1|3230758_3231448_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219604.1|3231447_3232872_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_000920344.1|3232929_3234282_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3234340_3235057_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|3235152_3235293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223181.1|3235692_3236379_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001386572.1|3236592_3236658_+	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001264697.1|3236738_3239201_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_000241660.1|3239202_3240135_+	homoserine kinase	NA	NA	NA	NA	NA
WP_000781063.1|3240135_3241422_+	threonine synthase	NA	NA	NA	NA	NA
WP_000738723.1|3241635_3241932_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
3241971:3241994	attL	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
WP_000068679.1|3242007_3242334_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|3242423_3244361_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|3244571_3246239_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|3246545_3247778_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|3247798_3249181_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_106910304.1|3249229_3250198_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_096880017.1|3250303_3250948_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105861.1|3250975_3251992_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000566153.1|3252023_3252173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224877.1|3252435_3253155_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|3253234_3254458_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_044805122.1|3254509_3255832_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	4.0e-79
WP_001295412.1|3255958_3256738_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143248.1|3256995_3258546_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_106883972.1|3258517_3259381_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_044805123.1|3259493_3260276_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|3260272_3261346_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|3261467_3261629_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|3261755_3262361_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|3262753_3264340_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217539.1|3264559_3264808_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001121225.1|3265400_3266051_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001101699.1|3266335_3266605_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	98.9	1.9e-44
WP_106910305.1|3266606_3267920_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	7.4e-78
WP_001230472.1|3267984_3268584_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	3.7e-109
WP_065763499.1|3268650_3272130_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	97.2	0.0e+00
WP_122996320.1|3272370_3273000_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	98.1	1.7e-104
WP_001444516.1|3272945_3273689_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_001426561.1|3273699_3274398_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000847298.1|3274397_3274727_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_097453818.1|3274723_3277369_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
WP_000532073.1|3277412_3277721_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3277747_3278170_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|3278183_3278936_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682708.1|3278943_3279342_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000974966.1|3279354_3279978_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3279980_3280262_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3280254_3280581_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001369631.1|3280668_3282648_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	100.0	0.0e+00
WP_000974563.1|3282637_3284140_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
WP_000102415.1|3284139_3284352_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_054408096.1|3285844_3286129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033804800.1|3286386_3288276_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.7	5.5e-183
WP_001114742.1|3288272_3288467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054408072.1|3288926_3289337_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_054408074.1|3289333_3289579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054408076.1|3289866_3291684_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	3.7e-128
WP_054408079.1|3291680_3291980_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_054408081.1|3291986_3292307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072178019.1|3292299_3293412_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_033804801.1|3293556_3294135_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	64.2	2.4e-57
WP_000229066.1|3294194_3294419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033885334.1|3294411_3295650_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	3.9e-60
WP_000373407.1|3296814_3297291_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_021351726.1|3297703_3298171_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	96.1	1.8e-74
WP_000087709.1|3298468_3299002_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	2.5e-101
WP_001072901.1|3299006_3299222_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|3299299_3299545_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3299585_3299765_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_065763510.1|3299902_3301849_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.2	0.0e+00
WP_000115362.1|3302544_3302970_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	98.6	1.0e-73
WP_001047089.1|3303250_3304003_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	2.6e-136
WP_001426460.1|3304016_3305006_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.1e-193
WP_001072673.1|3305013_3305829_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.6	2.9e-149
WP_000767110.1|3305980_3306376_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210151.1|3306372_3306699_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	2.0e-53
WP_001426462.1|3306695_3307349_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	9.6e-127
WP_001444393.1|3307348_3307843_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	3.3e-87
WP_000054955.1|3307839_3308832_-	hypothetical protein	NA	U5P0A0	Shigella_phage	95.8	4.0e-92
WP_001250270.1|3308788_3309001_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000514174.1|3309176_3309761_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|3309788_3309986_-	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|3310081_3310735_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000135680.1|3311192_3311555_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|3311620_3312445_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000008211.1|3312572_3313109_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|3313099_3313450_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_106910306.1|3313446_3313932_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.2	1.4e-66
WP_069192556.1|3314624_3314981_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	9.7e-57
WP_000063625.1|3315029_3315242_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|3315277_3315649_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_001426278.1|3315645_3316008_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	95.8	1.6e-67
WP_001061360.1|3316007_3316223_+	helix-turn-helix domain-containing protein	NA	A5LH59	Enterobacteria_phage	98.4	1.1e-31
WP_000566662.1|3316453_3317680_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_001218280.1|3318051_3319275_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	97.8	1.5e-234
3322398:3322421	attR	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
>prophage 199
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3327462	3328742	5489451		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|3327462_3328002_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|3328004_3328742_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 200
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3335668	3337333	5489451		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106883969.1|3335668_3337333_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 201
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3357362	3358319	5489451	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181112.1|3357362_3358319_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.7e-60
>prophage 202
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3365820	3366375	5489451		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|3365820_3366375_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 203
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3372942	3374403	5489451		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208201.1|3372942_3374403_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
>prophage 204
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3384676	3386353	5489451		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|3384676_3385273_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790592.1|3385750_3386353_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	1.5e-54
>prophage 205
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3389714	3390695	5489451		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991446.1|3389714_3390695_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
>prophage 206
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3411538	3422891	5489451	tRNA,integrase	Enterobacteria_phage(20.0%)	8	3395513:3395527	3417633:3417647
3395513:3395527	attL	CCAGCTGGCTTTTGA	NA	NA	NA	NA
WP_001219053.1|3411538_3412249_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.3e-41
WP_001345322.1|3412729_3413749_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	3.5e-43
WP_001429000.1|3413878_3415516_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.9e-84
WP_001295681.1|3415498_3416581_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|3416580_3417681_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
3417633:3417647	attR	CCAGCTGGCTTTTGA	NA	NA	NA	NA
WP_000397144.1|3417947_3419459_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|3419592_3420036_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_044805814.1|3420035_3422891_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
>prophage 207
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3431155	3437253	5489451		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|3431155_3432091_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|3432103_3432565_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|3432637_3433024_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|3433230_3435927_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|3436067_3436121_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181332.1|3436305_3437253_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 208
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3440891	3443653	5489451		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|3440891_3443030_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|3443188_3443653_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 209
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3447962	3454450	5489451		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|3447962_3448961_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|3448993_3449989_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|3449975_3450998_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205813.1|3451011_3452514_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|3452653_3453610_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_044805825.1|3453919_3454450_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	1.2e-55
>prophage 210
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3476450	3478281	5489451	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000440544.1|3476450_3477659_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_072098057.1|3477666_3478281_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	4.7e-43
>prophage 211
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3491950	3493114	5489451		Ralstonia_phage(100.0%)	1	NA	NA
WP_044805835.1|3491950_3493114_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.8e-80
>prophage 212
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3497046	3510063	5489451	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_106910311.1|3497046_3499488_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_106910312.1|3499526_3499952_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3500156_3501455_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|3501558_3501756_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3501837_3502842_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3502844_3504104_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|3504189_3505470_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3505546_3505855_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|3505940_3506891_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_106883955.1|3506883_3508716_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.7e-60
WP_000990321.1|3508725_3510063_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 213
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3514099	3514645	5489451		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|3514099_3514645_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 214
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3522628	3523606	5489451		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|3522628_3523606_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 215
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3528526	3529060	5489451		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|3528526_3529060_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 216
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3533579	3535563	5489451		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|3533579_3535226_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3535269_3535563_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 217
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3543897	3550888	5489451	integrase,transposase	Stx2-converting_phage(50.0%)	4	3534543:3534557	3550776:3550790
3534543:3534557	attL	AGAGATTTTCTTGTC	NA	NA	NA	NA
WP_044805839.1|3543897_3545163_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	9.0e-81
WP_001341423.1|3546153_3546828_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_025380681.1|3546824_3547172_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	5.9e-43
WP_001310555.1|3549871_3550888_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
3550776:3550790	attR	GACAAGAAAATCTCT	NA	NA	NA	NA
>prophage 218
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3562673	3563836	5489451	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948265.1|3562673_3563836_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
>prophage 219
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3586408	3587947	5489451		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723931.1|3586408_3587947_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
>prophage 220
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3606777	3609989	5489451	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_106883945.1|3606777_3608235_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.2	1.2e-47
WP_001295074.1|3608471_3609989_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 221
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3631185	3632688	5489451		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|3631185_3632688_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 222
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3637528	3638317	5489451		Cedratvirus(100.0%)	1	NA	NA
WP_001193388.1|3637528_3638317_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 223
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3643921	3645471	5489451		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|3643921_3644680_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611428.1|3644790_3645471_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 224
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3649456	3651442	5489451		Tetraselmis_virus(100.0%)	1	NA	NA
WP_044805870.1|3649456_3651442_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.4	1.6e-148
>prophage 225
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3656687	3658835	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|3656687_3658835_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 226
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3668117	3670076	5489451		Staphylococcus_phage(100.0%)	1	NA	NA
WP_044805876.1|3668117_3670076_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	4.3e-90
>prophage 227
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3675661	3677011	5489451		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|3675661_3677011_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 228
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3680828	3684441	5489451		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|3680828_3681365_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|3681618_3684441_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 229
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3688648	3740604	5489451	terminase,head,tail,tRNA,holin,capsid,integrase	Stx2-converting_phage(36.21%)	62	3685160:3685174	3698777:3698791
3685160:3685174	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_001147328.1|3688648_3689728_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|3689780_3691196_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235522.1|3691278_3692262_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|3692427_3692670_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_106883939.1|3692803_3693841_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|3693929_3695027_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|3695088_3695337_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|3695497_3696139_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001118000.1|3696923_3697496_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_024243819.1|3697607_3697877_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	3.2e-44
WP_094282965.1|3697878_3699192_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
3698777:3698791	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
WP_106878638.1|3699256_3699856_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.5e-110
WP_106910314.1|3699923_3703319_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.9	0.0e+00
WP_159028790.1|3703564_3704197_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	5.8e-105
WP_032316709.1|3704142_3704886_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.7	8.0e-146
WP_101972849.1|3704896_3705595_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.7	8.1e-132
WP_000807954.1|3705594_3705936_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_106910315.1|3705928_3709171_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.7	0.0e+00
WP_001453698.1|3709222_3709432_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030047.1|3709527_3709902_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_106883934.1|3709907_3710624_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_000133388.1|3710690_3711035_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3711031_3711478_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_106884139.1|3711474_3711825_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	99.1	4.6e-59
WP_106884140.1|3711834_3712161_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	2.0e-53
WP_001063023.1|3714525_3714747_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_106884141.1|3714791_3716729_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	98.9	0.0e+00
WP_106884142.1|3716792_3718454_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000958416.1|3718450_3719014_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000074669.1|3719700_3719925_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|3720007_3720322_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|3720849_3721035_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|3721251_3721749_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|3721748_3721964_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_106883930.1|3722403_3724254_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001339373.1|3725071_3725224_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_001047110.1|3725533_3726286_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001428967.1|3726299_3727289_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
WP_001061413.1|3727296_3728094_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767105.1|3728113_3728503_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210148.1|3728499_3728826_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_001359044.1|3728822_3729476_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.8e-126
WP_106878645.1|3729475_3729970_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	97.5	6.2e-86
WP_021568982.1|3729966_3730785_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.4	4.3e-124
WP_000933942.1|3730781_3731018_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
WP_062863832.1|3731010_3731847_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.3	2.5e-151
WP_000515862.1|3731843_3732395_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_000649477.1|3732438_3732639_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|3732729_3733404_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000917896.1|3733576_3733873_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135680.1|3734473_3734836_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081294.1|3734901_3735726_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000008211.1|3735853_3736390_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|3736380_3736731_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145671.1|3736727_3737201_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_106883928.1|3737347_3737815_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_001014294.1|3737816_3738008_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_106883927.1|3738010_3738763_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	94.0	1.9e-134
WP_001061339.1|3738762_3739335_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093918.1|3739371_3739653_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000654815.1|3739700_3739874_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|3740070_3740604_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 230
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3744800	3745409	5489451		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|3744800_3745409_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 231
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3754533	3755649	5489451		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|3754533_3755649_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 232
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3771655	3772447	5489451		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|3771655_3772447_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 233
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3784329	3788013	5489451		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|3784329_3788013_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 234
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3803384	3804974	5489451		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|3803384_3804974_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 235
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3810342	3812106	5489451		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|3810342_3810615_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940105.1|3810801_3811392_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|3811434_3812106_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 236
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3821322	3829651	5489451		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|3821322_3825546_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|3825622_3829651_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 237
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3833767	3836820	5489451		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|3833767_3834952_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|3835869_3836820_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 238
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3845324	3847169	5489451		Acinetobacter_phage(100.0%)	1	NA	NA
WP_044805079.1|3845324_3847169_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 239
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3864200	3871447	5489451		Serratia_phage(33.33%)	5	NA	NA
WP_044805077.1|3864200_3866498_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|3866548_3866869_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004446.1|3866883_3867963_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_106878648.1|3868271_3870773_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|3870784_3871447_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 240
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3889546	3897862	5489451	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_106910317.1|3889546_3891406_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
WP_000206271.1|3891402_3892794_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|3892891_3893500_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_106878649.1|3893728_3897862_+	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.3	1.6e-25
>prophage 241
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3921841	3932582	5489451		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|3921841_3922093_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_044805060.1|3922234_3922666_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|3922910_3924455_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|3924464_3925748_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|3925751_3926711_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|3926697_3927732_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|3927982_3929008_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_106883922.1|3929017_3930214_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000842823.1|3930488_3931346_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|3931649_3932582_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 242
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3944513	3949076	5489451		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|3944513_3944993_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|3945031_3945841_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3945938_3946106_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3946126_3946363_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|3946579_3947248_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050139.1|3947419_3948640_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|3948617_3949076_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 243
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3952416	3953676	5489451	integrase	Morganella_phage(100.0%)	1	3949358:3949370	3954595:3954607
3949358:3949370	attL	TCGATAGCCTGAT	NA	NA	NA	NA
WP_106883918.1|3952416_3953676_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	70.7	8.7e-177
WP_106883918.1|3952416_3953676_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	70.7	8.7e-177
3954595:3954607	attR	ATCAGGCTATCGA	NA	NA	NA	NA
>prophage 244
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3960709	3970507	5489451		Enterobacteria_phage(20.0%)	7	NA	NA
WP_001411729.1|3960709_3963124_+	phage/plasmid primase P4 family C-terminal domain protein	NA	Q7M2A8	Enterobacteria_phage	43.5	2.6e-108
WP_044805054.1|3963756_3964581_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_106910319.1|3964872_3965490_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001426185.1|3965486_3967169_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	4.3e-22
WP_001295237.1|3967426_3968050_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3968104_3968380_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|3968398_3970507_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 245
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3975628	3977020	5489451		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3975628_3977020_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 246
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3989136	3990471	5489451		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3989136_3990471_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 247
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	3997893	4002043	5489451		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_096917542.1|3997893_3999582_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|3999687_3999786_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|4000350_4000440_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4000858_4002043_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
>prophage 248
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4013408	4014362	5489451		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4013408_4013837_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4013948_4014362_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 249
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4018789	4019938	5489451		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4018789_4019938_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 250
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4024644	4032013	5489451		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4024644_4027059_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4027087_4028161_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4028160_4029261_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059106.1|4029265_4030669_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|4030965_4031046_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|4031275_4031416_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4031432_4031792_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4031755_4032013_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 251
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4042211	4043549	5489451		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|4042211_4043549_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 252
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4054538	4058379	5489451		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|4054538_4055312_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|4055402_4056293_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_044805038.1|4056292_4057252_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4057338_4058379_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 253
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4063910	4067272	5489451		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_106883914.1|4063910_4065740_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	7.3e-132
WP_000933736.1|4065901_4067272_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 254
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4079223	4080216	5489451		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|4079223_4080216_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 255
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4083384	4089237	5489451		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4083384_4085253_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|4085419_4085839_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387752.1|4085846_4087352_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|4087356_4088322_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4088346_4089237_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 256
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4102628	4104275	5489451		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012624.1|4102628_4104275_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 257
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4112748	4118160	5489451		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|4112748_4114770_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001299253.1|4114816_4116301_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047503.1|4116434_4117700_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_001280776.1|4117830_4118160_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 258
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4122202	4128346	5489451		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|4122202_4123333_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006625.1|4123329_4124592_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_044805242.1|4124591_4125659_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_044805241.1|4125677_4126559_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	3.9e-107
WP_001145196.1|4126536_4127211_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_044805240.1|4127215_4128346_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 259
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4144645	4147446	5489451		Salmonella_phage(100.0%)	2	NA	NA
WP_000678272.1|4144645_4145971_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.3e-07
WP_001300182.1|4145967_4147446_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
>prophage 260
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4150482	4154341	5489451		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4150482_4151379_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4151378_4152095_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383411.1|4152178_4154341_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
>prophage 261
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4161821	4163651	5489451		Catovirus(100.0%)	1	NA	NA
WP_044805249.1|4161821_4163651_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 262
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4176063	4179350	5489451		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|4176063_4177704_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|4177782_4178052_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4178055_4178571_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4178573_4179350_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 263
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4188140	4188755	5489451		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|4188140_4188755_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 264
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4202443	4205230	5489451		uncultured_virus(100.0%)	1	NA	NA
WP_044805227.1|4202443_4205230_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.3e-71
>prophage 265
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4209308	4211779	5489451		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001345123.1|4209308_4210718_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4210729_4211779_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 266
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4228146	4230926	5489451		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718893.1|4228146_4229043_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621656.1|4229210_4230107_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|4230140_4230926_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 267
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4239800	4242851	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_106910323.1|4239800_4242851_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	8.5e-08
>prophage 268
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4258674	4263535	5489451		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|4258674_4259295_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|4259554_4260538_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270270.1|4260686_4261361_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4261466_4262840_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4262836_4263535_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 269
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4275107	4279610	5489451		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|4275107_4275953_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4276377_4276623_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4276707_4277193_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4277285_4278212_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_044805214.1|4278278_4279610_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	2.9e-45
>prophage 270
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4285247	4289342	5489451		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106910325.1|4285247_4289342_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	7.8e-25
>prophage 271
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4315258	4316254	5489451		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|4315258_4316254_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 272
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4320478	4320691	5489451		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4320478_4320691_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 273
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4324344	4326678	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_106883898.1|4324344_4326678_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	3.7e-72
>prophage 274
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4342423	4344408	5489451		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196495.1|4342423_4343407_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000107031.1|4343403_4344408_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
>prophage 275
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4391389	4392037	5489451		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|4391389_4392037_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 276
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4396918	4399053	5489451		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|4396918_4397344_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|4397356_4398646_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|4398699_4399053_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 277
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4402167	4404210	5489451		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|4402167_4404210_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 278
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4417814	4420550	5489451		Staphylococcus_phage(100.0%)	1	NA	NA
WP_044805970.1|4417814_4420550_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 279
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4423920	4429572	5489451		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_106883904.1|4423920_4428156_-	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.6e-25
WP_001190062.1|4428358_4428760_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_044804994.1|4428765_4429572_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 280
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4437465	4441597	5489451		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|4437465_4438131_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|4438351_4438597_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106580.1|4438698_4440897_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000964718.1|4440970_4441597_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 281
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4444603	4447422	5489451		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|4444603_4445272_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042001.1|4445264_4446323_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|4446567_4447422_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 282
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4453155	4454638	5489451		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|4453155_4453923_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|4453924_4454638_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 283
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4458178	4459989	5489451		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|4458178_4459249_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073591.1|4459245_4459989_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.9e-09
>prophage 284
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4479999	4482447	5489451		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4479999_4482447_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 285
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4491676	4492903	5489451		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105463.1|4491676_4492903_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 286
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4497282	4499676	5489451		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|4497282_4499676_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 287
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4505645	4506524	5489451		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|4505645_4506524_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 288
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4513087	4516854	5489451		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|4513087_4513807_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|4513803_4515156_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|4515231_4516854_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 289
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4533829	4534666	5489451		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|4533829_4534666_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 290
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4558887	4568428	5489451		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601850.1|4558887_4559451_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	3.5e-61
WP_000963792.1|4559536_4560757_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|4560823_4562914_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|4562964_4563597_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|4563898_4564303_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|4564357_4565227_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|4565280_4565499_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|4565492_4566515_-	hydrolase	NA	NA	NA	NA	NA
WP_044805017.1|4566514_4568428_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	34.0	1.9e-74
>prophage 291
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4573998	4579572	5489451		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|4573998_4574385_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|4574384_4574744_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|4574751_4575039_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|4575164_4575539_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|4575635_4576106_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|4576202_4578317_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|4578387_4579572_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 292
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4599449	4600921	5489451	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004477.1|4599449_4600397_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
WP_000114986.1|4600411_4600921_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 293
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4611423	4615603	5489451		Bacillus_virus(50.0%)	3	NA	NA
WP_044805598.1|4611423_4612182_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_106883888.1|4613328_4614510_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|4614577_4615603_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 294
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4622106	4622991	5489451		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|4622106_4622991_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 295
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4628328	4632841	5489451		Escherichia_phage(50.0%)	4	NA	NA
WP_000843960.1|4628328_4629159_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_106910329.1|4629500_4630355_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001341904.1|4630390_4631281_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132907.1|4631341_4632841_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
>prophage 296
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4642883	4643927	5489451		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4642883_4643927_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 297
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4660420	4662945	5489451	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|4660420_4661488_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|4661577_4662945_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 298
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4666911	4667409	5489451	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|4666911_4667409_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 299
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4671114	4672605	5489451		Burkholderia_virus(100.0%)	1	NA	NA
WP_044805607.1|4671114_4672605_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 300
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4683556	4697326	5489451		Hokovirus(14.29%)	16	NA	NA
WP_000809774.1|4683556_4685893_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|4686122_4686776_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|4686772_4687501_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|4687497_4688130_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|4688343_4688616_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|4688612_4689467_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|4689512_4690004_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|4690121_4690409_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_106910330.1|4690431_4691865_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|4691912_4692638_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|4692644_4693202_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|4693170_4693746_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|4693742_4694309_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|4694329_4695316_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922901.1|4695329_4696307_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|4696516_4697326_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 301
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4701394	4702871	5489451		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|4701394_4701673_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|4701899_4702871_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 302
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4709511	4712384	5489451	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|4709511_4711446_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_106883882.1|4711535_4712384_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.7	3.4e-23
>prophage 303
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4716466	4723105	5489451		Dickeya_phage(50.0%)	4	NA	NA
WP_000207685.1|4716466_4717810_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_039065206.1|4718440_4718893_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_044805612.1|4718920_4720408_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|4720432_4723105_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 304
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4728586	4730467	5489451		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_044805614.1|4728586_4730467_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	1.5e-52
>prophage 305
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4736295	4744088	5489451		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|4736295_4736598_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449041.1|4736648_4737092_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|4737071_4737590_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001298741.1|4737717_4738353_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147619.1|4738425_4739466_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|4739579_4740155_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|4740164_4740755_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|4740774_4741170_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249157.1|4741127_4743164_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809253.1|4743227_4744088_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 306
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4767082	4768228	5489451		Streptococcus_phage(100.0%)	1	NA	NA
WP_001297158.1|4767082_4768228_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 307
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4776215	4778510	5489451		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|4776215_4778510_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 308
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4804526	4805492	5489451		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|4804526_4805492_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 309
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4817913	4834098	5489451	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082879.1|4817913_4821006_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
WP_000212475.1|4821189_4822173_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|4822391_4822724_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|4822765_4824145_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094682.1|4824562_4826083_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018000.1|4826236_4826860_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_044805630.1|4827136_4827901_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|4828154_4828661_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|4828739_4830581_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918826.1|4830775_4832521_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|4832631_4832847_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|4833084_4834098_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 310
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4840480	4841719	5489451	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708470.1|4840480_4841719_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.7e-92
>prophage 311
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4846856	4848290	5489451		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|4846856_4848290_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 312
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4857805	4868767	5489451		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|4857805_4858459_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|4858719_4858890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|4858947_4859721_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001299419.1|4859863_4860652_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|4860689_4861850_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|4861855_4862527_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|4862674_4864156_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|4864360_4864990_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|4864990_4865413_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444756.1|4865437_4866265_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|4866264_4866846_+	esterase YqiA	NA	NA	NA	NA	NA
WP_044805641.1|4866874_4868767_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 313
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4872594	4883417	5489451		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|4872594_4872987_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183500.1|4873039_4873522_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_001281881.1|4874067_4876326_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|4876558_4877296_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|4877370_4878783_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|4878893_4881113_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|4881155_4881413_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|4881463_4882390_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|4882589_4883417_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 314
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4889380	4890265	5489451		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|4889380_4890265_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 315
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4912479	4913652	5489451		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|4912479_4913652_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 316
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4947139	4949315	5489451		Klebsiella_phage(33.33%)	4	NA	NA
WP_106884263.1|4947139_4947361_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_159028787.1|4947429_4947906_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000213700.1|4947920_4948406_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	2.4e-13
WP_106884262.1|4948496_4949315_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	4.7e-46
>prophage 317
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4963674	4964447	5489451		Stx2-converting_phage(50.0%)	2	NA	NA
WP_106884259.1|4963674_4964025_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	8.9e-39
WP_000422686.1|4964021_4964447_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
>prophage 318
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4977369	4978359	5489451		Salmonella_phage(100.0%)	1	NA	NA
WP_044805841.1|4977369_4978359_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
>prophage 319
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	4983583	4989727	5489451	integrase	Stx2-converting_phage(50.0%)	4	4965855:4965868	4996800:4996813
4965855:4965868	attL	ATCATCGCCTGATT	NA	NA	NA	NA
WP_000603950.1|4983583_4984132_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_025380681.1|4986452_4986800_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	5.9e-43
WP_001341423.1|4986796_4987471_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001218766.1|4988461_4989727_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	9.0e-81
4996800:4996813	attR	ATCATCGCCTGATT	NA	NA	NA	NA
>prophage 320
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5015557	5016712	5489451		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|5015557_5016712_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 321
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5037719	5038397	5489451		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|5037719_5038397_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 322
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5056403	5057636	5489451		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|5056403_5057636_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 323
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5066164	5071532	5489451		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_106878669.1|5066164_5069038_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.4	8.2e-263
WP_000951964.1|5069298_5070042_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001344773.1|5070098_5071532_-	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
>prophage 324
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5075456	5090848	5489451	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|5075456_5076353_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|5076377_5077088_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813220.1|5077093_5078827_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|5078917_5080015_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|5080025_5081543_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192826.1|5081585_5082134_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|5082188_5082260_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|5082256_5082382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|5082383_5083832_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_044804975.1|5084267_5086187_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|5086186_5086675_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_106884252.1|5086710_5088078_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	72.8	6.2e-160
WP_044804977.1|5088113_5089430_-	guanine deaminase	NA	NA	NA	NA	NA
WP_106884251.1|5089447_5090848_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 325
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5115127	5115883	5489451		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|5115127_5115883_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 326
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5138713	5141208	5489451		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603508.1|5138713_5139475_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_000256438.1|5139789_5141208_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 327
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5150838	5157611	5489451		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|5150838_5151552_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_106910336.1|5151620_5152310_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|5152994_5153525_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|5153537_5155784_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|5155934_5156810_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|5156816_5157611_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 328
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5163088	5183967	5489451	tRNA	Klosneuvirus(12.5%)	13	NA	NA
WP_044805679.1|5163088_5165977_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	2.4e-68
WP_106884244.1|5165969_5169512_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	20.6	3.4e-08
WP_000775978.1|5169511_5171338_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	2.0e-25
WP_000237947.1|5171399_5172731_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|5172962_5174216_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_106884243.1|5174475_5175300_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000810575.1|5175331_5176912_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_000350900.1|5176911_5178120_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_001066231.1|5178088_5178685_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_000678646.1|5180287_5181385_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|5181461_5182268_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184265.1|5182318_5182762_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_044805683.1|5182761_5183967_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	1.5e-72
>prophage 329
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5195493	5196249	5489451		Bacillus_phage(100.0%)	1	NA	NA
WP_014640592.1|5195493_5196249_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	6.5e-10
>prophage 330
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5201107	5201956	5489451		Vibrio_phage(100.0%)	1	NA	NA
WP_000100393.1|5201107_5201956_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 331
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5209490	5213605	5489451		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|5209490_5212247_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_044805689.1|5212303_5213605_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	3.9e-39
>prophage 332
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5217637	5222557	5489451		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|5217637_5219275_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|5219362_5220661_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268451.1|5220720_5221593_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288227.1|5221606_5221747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|5221885_5222557_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 333
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5226375	5227161	5489451		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|5226375_5227161_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 334
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5251013	5253046	5489451		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|5251013_5252441_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|5252440_5253046_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 335
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5256158	5259826	5489451		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|5256158_5256920_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|5256913_5257540_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272581.1|5257679_5258771_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|5258833_5259826_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 336
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5265040	5272180	5489451		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|5265040_5265679_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_106884238.1|5265675_5266938_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_000847985.1|5266934_5267843_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|5268038_5268806_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141347.1|5268856_5269513_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_106884237.1|5269618_5272180_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 337
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5291647	5292661	5489451		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001341827.1|5291647_5292661_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	3.9e-26
>prophage 338
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5300234	5301200	5489451		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|5300234_5301200_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 339
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5306666	5312226	5489451	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|5306666_5307164_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_044805706.1|5307243_5308305_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	8.9e-114
WP_000140519.1|5308547_5309048_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|5309175_5311806_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|5312040_5312226_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 340
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5325044	5330337	5489451		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|5325044_5326247_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_044805708.1|5326601_5327561_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.2	2.9e-132
WP_000246508.1|5327570_5329715_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
WP_001565743.1|5329687_5330095_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.7	4.5e-18
WP_001223227.1|5330091_5330337_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 341
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5334272	5338397	5489451		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|5334272_5334722_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|5334722_5335385_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_106884236.1|5335405_5336806_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|5337116_5338397_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 342
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5343653	5438204	5489451	terminase,portal,tail,tRNA,holin,integrase,protease	Enterobacteria_phage(56.96%)	111	5349043:5349072	5394270:5394299
WP_044805717.1|5343653_5345372_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	95.8	2.7e-306
WP_106884235.1|5345373_5347125_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.5	0.0e+00
WP_000448925.1|5347196_5347613_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_044805718.1|5347651_5348881_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.8	5.8e-234
5349043:5349072	attL	AAAGTGGTGGAGCTGGCGGGAGTTGAACCC	NA	NA	NA	NA
WP_000504130.1|5349206_5350379_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	75.1	3.6e-177
WP_071827872.1|5350333_5350549_-	excisionase	NA	I6PBM8	Cronobacter_phage	73.5	5.0e-24
WP_032193274.1|5350567_5350702_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.1e-21
WP_000457726.1|5350705_5350948_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	95.0	1.4e-35
WP_000610372.1|5351035_5351401_-	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	84.8	4.5e-57
WP_000207903.1|5351397_5351754_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289947.1|5352267_5352867_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
WP_001214453.1|5352863_5353031_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_044806723.1|5353041_5353335_-	DUF2856 family protein	NA	Q9MCT7	Escherichia_phage	97.9	1.6e-49
WP_044806722.1|5353358_5353742_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	97.6	1.2e-65
WP_044806721.1|5353741_5354347_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	1.2e-107
WP_169080929.1|5354357_5354528_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	96.4	2.5e-23
WP_001243355.1|5354603_5354756_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|5354740_5354872_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_021500848.1|5354896_5355865_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
WP_001066169.1|5356118_5356700_+	super-infection exclusion protein B	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000256574.1|5356716_5356989_-	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_000990548.1|5357501_5358053_-	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_001280993.1|5358059_5358341_-	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_001299796.1|5358463_5359111_-	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001033078.1|5359219_5359438_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_000035953.1|5359555_5359852_+	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_000185456.1|5359884_5360823_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788906.1|5360819_5361521_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145935.1|5361517_5361808_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|5361878_5362157_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|5362289_5362505_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|5362515_5362752_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_021500846.1|5362708_5363155_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	99.3	7.1e-81
WP_000153288.1|5363151_5363679_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	100.0	7.3e-101
WP_001254218.1|5363675_5363858_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_106910338.1|5363854_5364025_+	protein ninF	NA	Q716C4	Shigella_phage	94.6	5.1e-24
WP_106910339.1|5364017_5364629_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	98.5	6.7e-98
WP_000144764.1|5364625_5364820_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|5364812_5365247_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_045891743.1|5365753_5366701_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	9.2e-171
WP_000752026.1|5366710_5366980_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_106910340.1|5367490_5369437_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.2	0.0e+00
WP_000143458.1|5369574_5369754_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|5369794_5370040_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|5370117_5370333_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_087677405.1|5370337_5370871_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	99.4	3.0e-102
WP_001056806.1|5371141_5371711_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5371710_5371857_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|5372084_5372270_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|5372745_5373222_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_106910341.1|5373218_5375342_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|5375338_5375551_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974563.1|5375550_5377053_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
WP_001369631.1|5377042_5379022_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	100.0	0.0e+00
WP_001097065.1|5379109_5379436_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|5379428_5379710_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|5379712_5380336_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682708.1|5380348_5380747_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000235090.1|5380754_5381507_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|5381520_5381943_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|5381969_5382278_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_106910342.1|5382321_5384967_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000847298.1|5384963_5385293_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001426561.1|5385292_5385991_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.4e-131
WP_000194799.1|5386001_5386745_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	5.0e-148
WP_158708606.1|5386690_5387323_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	3.0e-101
WP_106910344.1|5387568_5391045_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.0	0.0e+00
WP_001408020.1|5391113_5391737_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_106910345.1|5391801_5393115_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	3.3e-78
WP_001023406.1|5393116_5393386_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_001217540.1|5393753_5394002_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_044804850.1|5394850_5395333_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	1.2e-28
5394270:5394299	attR	AAAGTGGTGGAGCTGGCGGGAGTTGAACCC	NA	NA	NA	NA
WP_000600190.1|5395464_5395941_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|5395930_5396221_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|5396282_5396624_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|5396772_5398434_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|5398519_5399398_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|5399520_5400114_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|5400168_5401455_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|5401475_5402267_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_044804852.1|5402433_5403795_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_106884234.1|5404043_5404292_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|5404310_5404859_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|5404889_5405657_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|5405698_5406046_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|5406122_5406605_-	OmpA family protein	NA	NA	NA	NA	NA
WP_106884233.1|5406620_5407844_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|5407836_5408355_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|5408504_5408870_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|5409079_5410150_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|5410160_5411282_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|5411324_5412485_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|5412583_5412631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|5412734_5413076_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|5413347_5414085_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|5414219_5415200_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|5415196_5415928_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|5416057_5418631_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|5424483_5425782_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|5425778_5426102_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|5426147_5427503_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|5427616_5430277_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_044805187.1|5430308_5431007_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|5431075_5431495_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|5431701_5432739_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|5432786_5433476_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|5433780_5434164_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|5434219_5434807_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|5434909_5435791_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|5436000_5437335_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|5437466_5438204_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 343
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5443106	5446849	5489451		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|5443106_5444906_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|5444921_5445896_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|5446168_5446849_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 344
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5450307	5450568	5489451		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|5450307_5450568_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 345
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5454687	5465995	5489451		Bacillus_phage(50.0%)	7	NA	NA
WP_000970119.1|5454687_5458575_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	9.1e-132
WP_001297612.1|5459150_5460578_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_106884231.1|5460742_5461456_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|5461445_5462780_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|5462840_5463179_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|5463223_5464414_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_106910346.1|5464741_5465995_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 346
NZ_CP027766	Escherichia coli strain 2013C-3342 chromosome, complete genome	5489451	5471752	5473264	5489451		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493455.1|5471752_5473264_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	9.6e-13
