The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	0	1052	5095223	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000255944.1|29_1052_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 2
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	5059	7466	5095223		Yersinia_phage(33.33%)	5	NA	NA
WP_106873655.1|5059_5878_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	1.4e-45
WP_001164966.1|5877_6123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855069.1|6216_6690_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	1.9e-12
WP_001547087.1|6705_7182_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|7244_7466_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 3
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	31851	32832	5095223		Stx2-converting_phage(100.0%)	1	NA	NA
WP_042021471.1|31851_32832_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	3.2e-102
>prophage 4
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	36202	37879	5095223		Escherichia_phage(100.0%)	2	NA	NA
WP_000790574.1|36202_36805_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	4.0e-55
WP_000044711.1|37282_37879_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 5
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	48144	49605	5095223		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|48144_49605_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 6
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	55367	55922	5095223		Clostridioides_phage(100.0%)	1	NA	NA
WP_024223618.1|55367_55922_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	1.7e-36
>prophage 7
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	61868	62789	5095223	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181196.1|61868_62789_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.2e-60
>prophage 8
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	70460	72125	5095223		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_042021489.1|70460_72125_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	3.1e-12
>prophage 9
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	82751	84031	5095223		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|82751_83489_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001298056.1|83491_84031_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	3.8e-28
>prophage 10
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	91852	94728	5095223		Streptococcus_phage(50.0%)	3	NA	NA
WP_042021499.1|91852_93442_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	1.8e-30
WP_001295748.1|93834_94440_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|94566_94728_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 11
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	100415	101738	5095223		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|100415_101738_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 12
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	108458	114268	5095223		Enterococcus_phage(33.33%)	5	NA	NA
WP_000093834.1|108458_109691_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000513549.1|109782_110115_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|110116_110401_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046754.1|110456_112124_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409429.1|112330_114268_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 13
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	117545	119659	5095223		Bacillus_phage(50.0%)	2	NA	NA
WP_001188687.1|117545_118235_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219580.1|118234_119659_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	2.5e-10
>prophage 14
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	128808	133821	5095223	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_099156434.1|128808_130157_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000906193.1|130312_131089_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_001532890.1|131158_132589_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000130187.1|132867_133821_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 15
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	136957	140407	5095223		Chrysochromulina_ericina_virus(33.33%)	3	NA	NA
WP_000516135.1|136957_138874_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|138962_140093_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|140197_140407_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
>prophage 16
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	144861	151481	5095223	tRNA	uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_000681386.1|144861_146028_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.8	3.0e-91
WP_000062878.1|146087_146993_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001274021.1|147088_147352_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001337277.1|147454_147673_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_042021512.1|147680_148622_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001286823.1|148664_151481_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.3	2.1e-77
>prophage 17
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	156289	157438	5095223		Halovirus(100.0%)	1	NA	NA
WP_001295757.1|156289_157438_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	9.8e-50
>prophage 18
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	160900	169313	5095223	transposase	Saccharomonospora_phage(33.33%)	8	NA	NA
WP_000526115.1|160900_161359_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	5.5e-12
WP_000333104.1|161648_162044_+	carnitine metabolism transcriptional regulator CaiF	NA	NA	NA	NA	NA
WP_106873659.1|162163_162754_-	carnitine operon protein CaiE	NA	NA	NA	NA	NA
WP_000004399.1|162759_163545_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_042022851.1|163653_165207_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	3.2e-35
WP_024705028.1|165279_166497_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|166625_167768_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_042022848.1|167798_169313_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	4.6e-07
>prophage 19
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	177207	179168	5095223		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|177207_177687_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000125566.1|177772_178006_+	antitoxin	NA	NA	NA	NA	NA
WP_001160966.1|178008_178323_+	CcdB family protein	NA	NA	NA	NA	NA
WP_000257182.1|178319_179168_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 20
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	186945	192368	5095223		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117001.1|186945_189852_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035632.1|190016_192368_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	1.1e-36
>prophage 21
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	198816	199515	5095223		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916297.1|198816_199515_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	1.1e-22
>prophage 22
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	210993	212718	5095223		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_106873660.1|210993_212718_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	4.1e-36
>prophage 23
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	238804	239848	5095223		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|238804_239848_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 24
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	244094	244646	5095223		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|244094_244646_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 25
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	257061	258486	5095223		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|257061_258486_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 26
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	270499	272774	5095223		uncultured_virus(50.0%)	3	NA	NA
WP_042022824.1|270499_271036_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651600.1|271076_271739_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150638.1|271847_272774_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 27
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	276036	276969	5095223	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_061335996.1|276036_276969_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	3.8e-60
>prophage 28
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	287131	293937	5095223	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|287131_288550_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937411.1|288588_289515_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|289551_290007_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396047.1|290184_290889_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_042022815.1|290903_291434_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_077781222.1|291507_293937_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	28.9	7.9e-41
>prophage 29
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	299087	299885	5095223		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|299087_299885_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 30
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	305796	306141	5095223		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|305796_306141_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 31
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	310070	311495	5095223	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753936.1|310070_311495_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 32
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	323078	323837	5095223		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|323078_323837_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 33
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	332665	336781	5095223		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569423.1|332665_333262_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294801.1|333298_336781_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	3.7e-209
>prophage 34
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	349739	350771	5095223		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593991.1|349739_350771_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 35
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	357284	365138	5095223		Indivirus(25.0%)	9	NA	NA
WP_042021393.1|357284_358088_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	7.8e-38
WP_000648563.1|358084_358999_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|359239_360040_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211717.1|360117_360888_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644691.1|360936_362295_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052743.1|362366_363122_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|363155_363878_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917867.1|363874_364342_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	8.0e-51
WP_001298181.1|364406_365138_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	5.8e-40
>prophage 36
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	374399	377162	5095223		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614310.1|374399_377162_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.3	3.6e-82
>prophage 37
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	387848	389831	5095223		Ralstonia_phage(100.0%)	1	NA	NA
WP_042020804.1|387848_389831_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	4.9e-25
>prophage 38
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	399411	403454	5095223		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|399411_399990_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001468560.1|400194_400962_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|400932_401673_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042020808.1|401828_402011_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_000729704.1|402234_402495_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_122998384.1|402680_403454_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 39
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	409224	410376	5095223		Mycobacterium_phage(100.0%)	1	NA	NA
WP_019841423.1|409224_410376_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
>prophage 40
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	415059	420836	5095223		Streptococcus_phage(50.0%)	4	NA	NA
WP_000749898.1|415059_416115_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	1.7e-117
WP_001285288.1|416403_417507_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|417518_418772_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_032227721.1|420284_420836_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.3	9.2e-30
>prophage 41
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	427449	437302	5095223	integrase	Enterobacteria_phage(50.0%)	5	NA	NA
WP_106873665.1|427449_429351_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.5	1.1e-42
WP_000974932.1|429424_430081_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	61.0	3.8e-59
WP_106873666.1|430155_431490_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000772639.1|431748_432087_+	DUF4102 domain-containing protein	NA	E5AGD0	Erwinia_phage	48.6	5.6e-22
WP_001034003.1|433171_437302_-	vacuolating autotransporter toxin Vat	NA	Q9LA54	Enterobacteria_phage	40.7	3.3e-281
>prophage 42
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	455583	456435	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|455583_456435_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 43
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	462477	465782	5095223		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001295799.1|462477_463347_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_001298546.1|463506_464100_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474088.1|464111_464348_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046327.1|464456_465782_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 44
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	475693	483263	5095223	holin,integrase	Escherichia_phage(33.33%)	5	474654:474667	489739:489752
474654:474667	attL	TTCACCAACGGCAA	NA	NA	NA	NA
WP_001295805.1|475693_476257_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_042020787.1|477343_479014_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	4.0e-60
WP_042020785.1|479027_480500_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001298544.1|480513_481101_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_042020782.1|481229_483263_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
489739:489752	attR	TTCACCAACGGCAA	NA	NA	NA	NA
>prophage 45
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	503163	505050	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010273.1|503163_505050_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	1.8e-53
>prophage 46
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	509915	514195	5095223		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_021513528.1|509915_512990_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.1	0.0e+00
WP_019842507.1|513112_514195_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.7	2.2e-192
>prophage 47
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	519606	521567	5095223		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_042020752.1|519606_520557_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.5	2.5e-35
WP_001013512.1|520553_521567_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	3.2e-44
>prophage 48
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	524647	525757	5095223		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842109.1|524647_525757_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	4.0e-32
>prophage 49
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	532497	533265	5095223		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939358.1|532497_533265_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	1.9e-25
>prophage 50
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	540173	541331	5095223		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830766.1|540173_541331_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 51
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	548745	549861	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_042022393.1|548745_549861_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	33.9	3.3e-18
>prophage 52
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	554147	564247	5095223		Bacillus_phage(60.0%)	7	NA	NA
WP_106873837.1|554147_555059_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.3	1.8e-102
WP_001219295.1|555183_556092_+	fructokinase	NA	NA	NA	NA	NA
WP_001331503.1|556362_557547_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_021523783.1|557672_560816_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221292.1|560812_562015_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|562204_562894_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_042022399.1|562951_564247_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.2	4.5e-27
>prophage 53
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	571198	580041	5095223	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_106873670.1|571198_572326_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	3.6e-89
WP_000007629.1|572348_572681_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934823.1|572708_574556_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|574566_575538_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|575667_576015_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295827.1|576052_576937_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001298536.1|577235_577775_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|577925_578375_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_042022405.1|578378_579482_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.3e-54
WP_001021161.1|579570_580041_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 54
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	601474	606521	5095223	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|601474_602098_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|602223_603498_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|603685_606040_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|606248_606521_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 55
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	609661	610357	5095223		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|609661_610357_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 56
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	613680	617227	5095223		Bacillus_phage(100.0%)	2	NA	NA
WP_021523792.1|613680_615453_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	2.3e-50
WP_001256196.1|615445_617227_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	5.2e-42
>prophage 57
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	626063	629213	5095223		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|626063_629213_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 58
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	636221	644679	5095223		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|636221_636773_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122015.1|636901_638833_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|638885_639215_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195024.1|639214_639820_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678189.1|639929_641804_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	1.0e-117
WP_001313630.1|641984_642629_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250115.1|642760_643723_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801822.1|643719_644679_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.6	2.9e-15
>prophage 59
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	653252	656156	5095223		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|653252_653594_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083983.1|653651_656156_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	1.3e-115
>prophage 60
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	662037	662715	5095223		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|662037_662715_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 61
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	665851	666538	5095223		Planktothrix_phage(100.0%)	1	NA	NA
WP_001445573.1|665851_666538_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 62
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	672972	674754	5095223		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_042022420.1|672972_674754_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	6.0e-38
>prophage 63
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	680944	682090	5095223		Streptococcus_phage(100.0%)	1	NA	NA
WP_042022425.1|680944_682090_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
>prophage 64
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	693924	698402	5095223	tRNA,tail	Moumouvirus(33.33%)	6	NA	NA
WP_042022427.1|693924_695310_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_042022430.1|695393_695867_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|695974_696187_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_106873674.1|696188_697055_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	2.2e-30
WP_000025786.1|697095_697293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259980.1|698096_698402_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	63.6	1.2e-42
>prophage 65
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	707194	709310	5095223		Hokovirus(50.0%)	2	NA	NA
WP_042022437.1|707194_708637_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.0e-11
WP_000770953.1|708626_709310_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 66
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	712455	715599	5095223		Leptospira_phage(100.0%)	1	NA	NA
WP_024247755.1|712455_715599_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	2.2e-59
>prophage 67
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	726630	732673	5095223		Tupanvirus(50.0%)	3	NA	NA
WP_042022446.1|726630_730512_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	3.8e-61
WP_000096767.1|730727_731861_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140634.1|731857_732673_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 68
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	746964	748787	5095223		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|746964_747594_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029771.1|747566_748787_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	2.7e-58
>prophage 69
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	751892	754006	5095223		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|751892_753458_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_001295855.1|753577_754006_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	4.3e-19
>prophage 70
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	768096	768743	5095223		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|768096_768306_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|768359_768743_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 71
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	772951	775391	5095223		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|772951_774163_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231421.1|774302_775391_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 72
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	782401	787524	5095223	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_015912473.1|782401_784984_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	3.1e-184
WP_106873675.1|785218_785701_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207538.1|785745_786681_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631388.1|786798_787524_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.1	7.6e-32
>prophage 73
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	795468	796548	5095223		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|795468_796548_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 74
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	800646	802311	5095223		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|800646_802311_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 75
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	806936	808883	5095223		Vibrio_phage(100.0%)	1	NA	NA
WP_001023115.1|806936_808883_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
>prophage 76
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	811937	812696	5095223		Moraxella_phage(100.0%)	1	NA	NA
WP_024704944.1|811937_812696_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	48.2	4.8e-45
>prophage 77
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	817189	819835	5095223	tRNA	Escherichia_phage(100.0%)	2	NA	NA
WP_000679501.1|817189_817951_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.4e-30
WP_001287134.1|818170_819835_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 78
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	823981	824746	5095223		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773306.1|823981_824746_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 79
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	831401	844670	5095223	transposase	Bacillus_phage(33.33%)	11	NA	NA
WP_000186082.1|831401_832079_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001441906.1|832075_834760_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001334152.1|834752_835325_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087998.1|835333_837382_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.5	3.5e-26
WP_042022474.1|837404_839078_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001365534.1|839077_839167_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424788.1|839479_839686_+	YbfA family protein	NA	NA	NA	NA	NA
WP_001075785.1|839786_840296_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000207172.1|840292_841711_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	8.1e-62
WP_106873677.1|841775_843123_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001032722.1|843188_844670_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	4.2e-45
>prophage 80
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	848048	848840	5095223		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114006.1|848048_848840_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.8	7.5e-09
>prophage 81
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	876456	879976	5095223		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|876456_877176_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951271.1|877172_878114_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	1.7e-23
WP_000784341.1|878227_878608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109185.1|878923_879976_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	48.1	1.7e-80
>prophage 82
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	884338	890913	5095223		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|884338_885355_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096841.1|885616_887089_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.2e-12
WP_001147437.1|887156_887945_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|888073_888223_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113014.1|888389_889163_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604037.1|889162_889852_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891664.1|889854_890913_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	7.4e-20
>prophage 83
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	901224	903755	5095223	transposase	Phage_Gifsy-1(50.0%)	2	NA	NA
WP_000817269.1|901224_902355_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
WP_001682716.1|902465_903755_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 84
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	910082	910991	5095223		Streptococcus_phage(100.0%)	1	NA	NA
WP_001304790.1|910082_910991_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 85
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	921589	934687	5095223	transposase	Bacillus_phage(33.33%)	11	NA	NA
WP_001764364.1|921589_923326_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001298684.1|923318_924314_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_042021969.1|924316_924988_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007122.1|925216_926578_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_099156434.1|926765_928113_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001218658.1|928549_930700_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000386565.1|930727_931690_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000253506.1|931830_932916_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|933144_933405_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_024704935.1|933669_933936_-	C4-type zinc finger protein YbiI	NA	K4F9U1	Cronobacter_phage	52.3	1.2e-16
WP_000990159.1|934009_934687_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	1.5e-18
>prophage 86
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	941250	946476	5095223		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|941250_941973_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|941969_942629_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843864.1|942767_943514_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|943917_944421_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001350186.1|944720_945608_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|945842_945908_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|945960_946476_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 87
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	951472	958356	5095223		Tupanvirus(33.33%)	5	NA	NA
WP_000961458.1|951472_953065_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_042020486.1|953264_954080_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_042020488.1|954225_956658_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_042020490.1|956663_957563_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001317741.1|957693_958356_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	5.7e-26
>prophage 88
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	961683	963555	5095223		Planktothrix_phage(100.0%)	1	NA	NA
WP_033807451.1|961683_963555_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 89
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	974887	976090	5095223		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|974887_976090_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 90
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	982224	1082009	5095223	capsid,integrase,tail,protease,tRNA,portal,lysis,terminase,head,plate	Salmonella_phage(54.84%)	98	982124:982150	1016387:1016413
982124:982150	attL	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290933.1|982224_983277_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001321204.1|983463_983655_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047324.1|983670_984240_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
WP_001247707.1|984365_984587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|984619_985129_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|985136_985337_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|985300_985642_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|985709_985943_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|985942_986170_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_106873680.1|986166_987021_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	89.8	1.1e-146
WP_001420002.1|987026_987848_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_106873681.1|987847_990220_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.8	0.0e+00
WP_001154431.1|990374_990563_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|990573_990807_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|990920_991598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001748167.1|991873_993616_+	AIPR family protein	NA	NA	NA	NA	NA
WP_106873682.1|993677_994703_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.4	6.9e-172
WP_001098431.1|994702_996469_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216224.1|996611_997445_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	2.4e-122
WP_000742504.1|997461_998520_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	4.2e-180
WP_000059191.1|998523_999174_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673526.1|999269_999734_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	4.2e-76
WP_000868175.1|999733_999937_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_049143197.1|1000135_1000648_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.9	1.1e-88
WP_106873683.1|1000649_1001027_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001513113.1|1001023_1001452_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	6.4e-47
WP_001039937.1|1001547_1001979_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.3e-71
WP_000829123.1|1001971_1002424_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.5	9.4e-57
WP_006656620.1|1002429_1002792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993777.1|1003055_1003634_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
WP_000177580.1|1003630_1003990_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000268285.1|1003976_1004885_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_001086836.1|1004877_1005483_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_106873684.1|1005479_1006862_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	75.9	1.1e-153
WP_033560401.1|1006861_1007305_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	1.1e-46
WP_000905033.1|1008466_1009033_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046133.1|1009175_1010348_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
WP_001207660.1|1010357_1010873_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1010927_1011230_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1011244_1011364_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_106873685.1|1011356_1014434_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.2	0.0e+00
WP_000980400.1|1014430_1014916_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011797.1|1014912_1016013_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_032182340.1|1016103_1016322_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	70.4	1.5e-20
WP_001024876.1|1016557_1018243_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
1016387:1016413	attR	ATAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000681104.1|1018512_1018890_+	membrane protein	NA	NA	NA	NA	NA
WP_001195231.1|1018919_1019177_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201575.1|1019336_1019624_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189165.1|1019607_1020330_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_042020500.1|1020390_1021293_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.9	8.8e-38
WP_000203025.1|1021380_1021857_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|1022206_1023319_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996010.1|1023412_1024546_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105415.1|1024555_1025500_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1025496_1026342_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1026401_1026890_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149694.1|1026930_1028058_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
WP_001295905.1|1028086_1028818_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1029043_1029712_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001692.1|1029711_1030428_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|1030434_1031166_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1031183_1031912_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001313703.1|1032129_1032645_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1032770_1033094_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255186.1|1033090_1033921_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001305933.1|1033917_1034931_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136545.1|1035029_1036460_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566375.1|1036470_1037472_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815366.1|1037508_1039227_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_106873686.1|1039359_1040328_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458803.1|1040339_1041992_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491135.1|1042135_1043035_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1043435_1044131_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599804.1|1044556_1046215_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001351020.1|1046211_1047168_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746478.1|1047318_1048434_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188124.1|1048430_1050377_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	8.5e-38
WP_000410785.1|1050449_1050674_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1050996_1051317_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1051347_1053624_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097886.1|1054697_1055681_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_042020506.1|1055677_1058911_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.9	1.3e-83
WP_042020509.1|1059240_1060548_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_000120902.1|1060544_1061468_+	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_042020511.1|1061478_1062480_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	39.9	1.6e-48
WP_000350182.1|1062490_1063045_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|1064086_1064305_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|1064589_1065294_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202198.1|1065335_1067057_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043638.1|1067057_1068824_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_024187964.1|1068946_1069912_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	6.5e-63
WP_000228473.1|1070455_1070950_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_106873687.1|1071084_1075191_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1075349_1075961_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1075971_1077315_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1077405_1078698_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850287.1|1078936_1081381_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	6.0e-222
WP_000213098.1|1081391_1082009_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 91
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1085094	1088309	5095223		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1085094_1085835_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1086026_1088309_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 92
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1092407	1093496	5095223		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057158.1|1092407_1093496_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
>prophage 93
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1098583	1103123	5095223		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1098583_1098868_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705728.1|1099073_1101338_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|1101374_1103123_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 94
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1117828	1128604	5095223	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1117828_1118377_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109453.1|1118403_1119051_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462696.1|1119100_1120291_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977927.1|1120475_1121564_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	53.7	9.1e-98
WP_000117881.1|1122144_1123545_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001298298.1|1123713_1124916_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_042020522.1|1125181_1127794_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001090483.1|1127836_1128604_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	8.3e-29
>prophage 95
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1137359	1139267	5095223		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|1137359_1139267_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 96
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1151867	1153922	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_001350178.1|1151867_1153922_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 97
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1158156	1158816	5095223	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1158156_1158816_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 98
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1169810	1182227	5095223		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1169810_1170023_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1170033_1170222_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001313723.1|1170196_1170427_+	protein YmcE	NA	NA	NA	NA	NA
WP_032261912.1|1170416_1170590_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818451.1|1170638_1171712_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001054737.1|1171794_1174527_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.4e-38
WP_001264953.1|1174609_1175638_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1175610_1176303_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230247.1|1176432_1177605_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_042020534.1|1177604_1180151_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.7e-70
WP_000210216.1|1180147_1180747_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024569.1|1181001_1181307_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420625.1|1181306_1182227_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 99
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1185257	1187251	5095223		Enterobacteria_phage(100.0%)	2	NA	NA
WP_001273658.1|1185257_1185431_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001028100.1|1186756_1187251_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	9.3e-50
>prophage 100
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1201572	1255858	5095223	transposase,integrase,protease	Escherichia_phage(20.0%)	45	1202673:1202688	1226630:1226645
WP_000258758.1|1201572_1202637_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
1202673:1202688	attL	TTTGTTTTATTTCATT	NA	NA	NA	NA
WP_000225121.1|1203456_1203912_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279878.1|1204357_1205560_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	1.7e-44
WP_106873692.1|1205747_1207565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014639577.1|1208678_1208975_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1209201_1209399_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_021573691.1|1212018_1212582_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_072019632.1|1214930_1215173_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_001335133.1|1215453_1216488_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	43.4	1.4e-71
WP_097445744.1|1217364_1218515_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	9.8e-50
WP_021531186.1|1218592_1218826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033545393.1|1218841_1219156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120662.1|1220088_1220298_+	microcin H47 immunity protein MchI	NA	NA	NA	NA	NA
WP_001375214.1|1220314_1220542_+	microcin H47	NA	NA	NA	NA	NA
WP_039004937.1|1220813_1222364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000120459.1|1222389_1222842_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_032146412.1|1223027_1224269_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_112040426.1|1224243_1226358_+	microcin export transporter peptidase/ATP-binding subunit MchF	NA	F2Y165	Organic_Lake_phycodnavirus	24.1	3.2e-14
WP_071779149.1|1226611_1226890_+	microcin McmA	NA	NA	NA	NA	NA
1226630:1226645	attR	AATGAAATAAAACAAA	NA	NA	NA	NA
WP_042020903.1|1227064_1227478_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_075370593.1|1227849_1228308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167426.1|1228765_1229278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042020906.1|1229519_1230092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097477659.1|1230356_1231570_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.8	8.9e-102
WP_011076307.1|1231627_1231912_-	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000046975.1|1232267_1232597_+	S/F1C fimbrial major subunit operon transcriptional regulator	NA	NA	NA	NA	NA
WP_042020907.1|1232969_1233512_+	fimbrial protein	NA	NA	NA	NA	NA
WP_077781159.1|1233597_1234122_+	S/F1C fimbrial minor subunit SfaD	NA	NA	NA	NA	NA
WP_001518508.1|1234162_1234858_+	S/F1C fimbrial biogenesis chaperone SfaE/FocC	NA	NA	NA	NA	NA
WP_106873693.1|1234927_1237558_+	S/F1C fimbrial biogenesis usher protein SfaF/FocD	NA	NA	NA	NA	NA
WP_001519162.1|1237570_1238098_+	S/F1C fimbrial adhesin minor pilin SfaG/FocF	NA	NA	NA	NA	NA
WP_000767894.1|1238119_1238623_+	F1C fimbria minor subunit FocG	NA	NA	NA	NA	NA
WP_159032326.1|1238684_1239584_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001533911.1|1239887_1240628_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_024245440.1|1240774_1241326_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042020658.1|1241651_1242689_-|transposase	IS630-like element ISEc40 family transposase	transposase	NA	NA	NA	NA
WP_021549302.1|1242918_1245096_+	siderophore salmochelin receptor IroN	NA	NA	NA	NA	NA
WP_021549303.1|1245140_1246097_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933675.1|1246181_1247411_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_106423894.1|1247514_1251300_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.7e-45
WP_001221122.1|1251313_1252429_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000805228.1|1252966_1253266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044697161.1|1253443_1253902_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	30.7	2.7e-11
WP_001317493.1|1254056_1254839_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255944.1|1254835_1255858_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 101
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1277620	1280690	5095223		Yersinia_phage(25.0%)	6	NA	NA
WP_044694629.1|1277620_1278442_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	6.1e-46
WP_001164966.1|1278441_1278687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016232931.1|1278780_1279251_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.3	5.6e-12
WP_001439314.1|1279266_1279743_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|1279805_1280027_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_000086759.1|1280045_1280690_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.7	2.7e-25
>prophage 102
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1286606	1287440	5095223		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1286606_1287440_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 103
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1291576	1292110	5095223		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1291576_1292110_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 104
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1301417	1302338	5095223		Morganella_phage(100.0%)	1	NA	NA
WP_001295958.1|1301417_1302338_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.9	3.9e-57
>prophage 105
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1307000	1307246	5095223		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1307000_1307246_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 106
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1323126	1324068	5095223		Brevibacillus_phage(100.0%)	1	NA	NA
WP_042022636.1|1323126_1324068_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 107
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1336424	1337606	5095223		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1336424_1337159_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1337369_1337606_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 108
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1340882	1342525	5095223		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257002.1|1340882_1341524_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267915.1|1341520_1342525_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 109
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1354848	1355106	5095223		Erwinia_phage(100.0%)	1	NA	NA
WP_000800132.1|1354848_1355106_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 110
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1362394	1366117	5095223		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|1362394_1363096_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251365.1|1363095_1364340_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291272.1|1364368_1365280_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952746.1|1365295_1366117_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 111
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1369550	1482430	5095223	capsid,integrase,protease,tail,tRNA,portal,lysis,terminase,head,holin	Escherichia_phage(37.72%)	145	1412889:1412907	1473135:1473153
WP_000074988.1|1369550_1370669_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.9e-82
WP_000003742.1|1370637_1370907_-	excisionase	NA	NA	NA	NA	NA
WP_106873698.1|1370968_1373371_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.2	7.5e-177
WP_000092782.1|1373463_1373652_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_044808604.1|1373648_1373837_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_077632757.1|1374681_1374897_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	5.3e-10
WP_000380319.1|1375052_1375205_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000166382.1|1375489_1376128_-	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	27.6	4.6e-17
WP_000747952.1|1376219_1376450_+	transcriptional regulator	NA	H9C161	Pectobacterium_phage	55.8	4.5e-07
WP_024213803.1|1376446_1376884_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	54.4	1.8e-28
WP_044808603.1|1376970_1377981_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	89.1	6.8e-172
WP_072130322.1|1377892_1378435_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_071974588.1|1378468_1379194_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.4	6.3e-79
WP_001473635.1|1379209_1379605_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	52.1	1.3e-30
WP_032223213.1|1379662_1380019_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	1.1e-57
WP_001224672.1|1380111_1380294_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_050867605.1|1380459_1380975_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	76.5	5.2e-35
WP_001398985.1|1381208_1381421_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_001341173.1|1381587_1381860_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_071974587.1|1381861_1382911_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	54.9	5.9e-110
WP_000904149.1|1382923_1383283_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	3.3e-36
WP_001367730.1|1383291_1383822_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.4	6.0e-71
WP_000917735.1|1384064_1384262_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_071974586.1|1384412_1385471_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	97.7	6.4e-205
WP_001365678.1|1385853_1386813_+	Shiga toxin Stx2a subunit A	NA	A0A0P0ZDQ7	Stx2-converting_phage	99.7	3.6e-175
WP_000738072.1|1386824_1387094_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_047081625.1|1387607_1389554_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	99.4	0.0e+00
WP_000142780.1|1389689_1389869_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|1389909_1390155_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1390232_1390448_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_047081887.1|1390451_1391009_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	2.1e-50
WP_001092902.1|1391045_1391579_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_148936794.1|1392097_1392283_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	7.8e-18
WP_000373398.1|1392757_1393234_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	98.7	1.8e-82
WP_106873699.1|1393230_1395354_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	98.9	0.0e+00
WP_000102415.1|1395350_1395563_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1395562_1397065_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1397009_1399034_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000414249.1|1399121_1399448_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	99.1	2.3e-49
WP_001281347.1|1399440_1399722_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_047081973.1|1399724_1400348_+|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.5	2.6e-105
WP_106873700.1|1400360_1400759_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	3.8e-70
WP_000235129.1|1400766_1401516_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	2.1e-130
WP_032330778.1|1401535_1401967_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	1.5e-40
WP_047081971.1|1401993_1402398_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	77.5	4.5e-42
WP_106873701.1|1402387_1404994_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	0.0e+00
WP_000847280.1|1404990_1405320_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_001365876.1|1405319_1406018_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_106873702.1|1406028_1406772_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	3.5e-149
WP_122993618.1|1406717_1407350_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_106873703.1|1407596_1411283_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.1	0.0e+00
WP_000078855.1|1411481_1411622_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_106873704.1|1411766_1413035_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.2	1.9e-54
1412889:1412907	attL	CCTGATGGCGCTGTGATTC	NA	NA	NA	NA
WP_001049903.1|1413103_1413775_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.8	3.0e-107
WP_022581964.1|1413939_1414269_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|1414433_1415297_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531578.1|1415280_1416417_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1416666_1417893_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1417941_1419063_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000734671.1|1419138_1420599_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1420598_1421270_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423737.1|1421439_1422810_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.6e-107
WP_001295971.1|1422813_1423455_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001298466.1|1423490_1424597_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1424650_1425112_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248664.1|1425121_1425775_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1425946_1427197_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1427310_1428453_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1428442_1428679_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1428818_1429058_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1429041_1429368_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1429367_1429589_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1429687_1429969_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1429979_1430171_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1430143_1430326_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_042022538.1|1430322_1431003_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_032204555.1|1430999_1431785_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_021515706.1|1431790_1432087_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	2.3e-48
WP_000233576.1|1432162_1432369_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000340376.1|1432846_1433710_-	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_024185289.1|1433776_1434469_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.7	2.5e-109
WP_000184665.1|1434579_1434807_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001566184.1|1434837_1435377_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_042022666.1|1435463_1436393_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	3.0e-110
WP_042022537.1|1436389_1437091_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	2.3e-126
WP_042022536.1|1437087_1437375_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	4.4e-44
WP_042022534.1|1437660_1437927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873705.1|1438501_1439110_+	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	41.7	9.8e-33
WP_042022529.1|1439272_1439473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077781219.1|1439804_1440386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072130790.1|1440498_1440600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042022523.1|1440596_1441052_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	1.3e-58
WP_000224914.1|1441051_1441222_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001568556.1|1441214_1441505_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	1.5e-47
WP_042022520.1|1441501_1441864_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	4.0e-58
WP_042022518.1|1441860_1442001_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	4.2e-08
WP_001552785.1|1442086_1442470_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737271.1|1442658_1443741_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1444329_1444545_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135283.1|1444544_1445042_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_001228695.1|1445258_1445441_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_042022516.1|1445531_1445825_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	1.0e-43
WP_000830178.1|1446307_1446634_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_157908416.1|1446840_1447023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873707.1|1447586_1448132_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.2	9.8e-93
WP_032316773.1|1448106_1450032_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1450028_1450235_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_042022509.1|1450231_1451833_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	2.9e-310
WP_001299443.1|1453139_1453472_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_106873839.1|1453533_1453803_+|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	4.0e-39
WP_042022664.1|1453935_1455171_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	45.2	3.8e-100
WP_000737991.1|1455172_1455400_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_106873708.1|1455469_1456006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042022502.1|1456356_1456659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042022501.1|1456867_1457233_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000999172.1|1457225_1457450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000790824.1|1457453_1457741_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_042022497.1|1457737_1459558_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.6	4.9e-128
WP_000125506.1|1459845_1460091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042021864.1|1460087_1460537_+	single-stranded DNA-binding protein	NA	Q0GXW0	Lactococcus_phage	27.8	9.8e-06
WP_042021862.1|1460754_1461795_+|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.1	2.6e-65
WP_042021860.1|1461804_1462146_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001178671.1|1462157_1462541_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_032348759.1|1462786_1463338_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	72.2	1.2e-69
WP_001366487.1|1463444_1464350_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_148934889.1|1464510_1465275_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	1.0e-140
WP_021524025.1|1465316_1465715_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	95.5	3.6e-60
WP_000752996.1|1465726_1466080_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_001541219.1|1466091_1466670_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000683145.1|1466666_1467062_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_021524027.1|1467069_1467810_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	1.5e-128
WP_000479193.1|1467825_1468248_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|1468229_1468664_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_042021854.1|1468656_1471218_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.9	0.0e+00
WP_000847331.1|1471214_1471544_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_021524029.1|1471543_1472242_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	4.7e-132
WP_021524030.1|1472247_1472991_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	5.2e-145
WP_000090891.1|1472927_1473560_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
1473135:1473153	attR	CCTGATGGCGCTGTGATTC	NA	NA	NA	NA
WP_106873709.1|1473620_1477103_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_042022772.1|1477161_1479222_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_042022770.1|1479218_1479497_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	1.3e-24
WP_000355360.1|1479509_1479803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873710.1|1479894_1480752_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_021524034.1|1480748_1481606_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_001576746.1|1481602_1482430_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	1.5e-07
>prophage 112
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1485995	1487766	5095223		Phage_21(50.0%)	4	NA	NA
WP_000539892.1|1485995_1486148_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_001445545.1|1486231_1486357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373104.1|1486409_1486814_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332313.1|1487034_1487766_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	51.0	1.6e-53
>prophage 113
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1501984	1503672	5095223		Morganella_phage(50.0%)	2	NA	NA
WP_000897377.1|1501984_1502404_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	1.2e-37
WP_042022758.1|1502403_1503672_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.0	4.0e-206
>prophage 114
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1519687	1520446	5095223		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_042022754.1|1519687_1520446_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	2.0e-14
>prophage 115
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1532895	1535647	5095223		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033350.1|1532895_1534575_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	6.0e-24
WP_001298109.1|1534699_1535647_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 116
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1538783	1542791	5095223		Pseudomonas_phage(50.0%)	5	NA	NA
WP_042022744.1|1538783_1539866_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456474.1|1539865_1540699_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200375.1|1540695_1541088_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257054.1|1541091_1541901_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811061.1|1541936_1542791_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	1.4e-45
>prophage 117
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1556183	1567512	5095223	transposase	Escherichia_phage(20.0%)	11	NA	NA
WP_000702647.1|1556183_1557722_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.7	4.8e-20
WP_000571684.1|1557718_1558429_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1558428_1559106_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_016232995.1|1559158_1560358_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	3.7e-140
WP_000555849.1|1561150_1561993_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|1562042_1562501_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1562613_1563519_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193451.1|1563610_1564624_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1564825_1565734_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1565877_1566291_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1566894_1567512_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 118
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1577078	1579093	5095223		Planktothrix_phage(50.0%)	2	NA	NA
WP_042022729.1|1577078_1578092_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	1.5e-14
WP_000994905.1|1578088_1579093_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 119
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1589056	1592014	5095223		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001541273.1|1589056_1590415_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763538.1|1590418_1592014_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 120
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1598979	1604271	5095223	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559258.1|1598979_1599738_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	9.7e-06
WP_000422062.1|1599957_1601007_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1601042_1601294_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|1601673_1604271_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 121
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1609182	1609773	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176294.1|1609182_1609773_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 122
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1617584	1619519	5095223		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485012.1|1617584_1619519_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.8e-33
>prophage 123
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1628453	1630471	5095223		Salmonella_phage(50.0%)	2	NA	NA
WP_000135020.1|1628453_1629617_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.6e-28
WP_000573407.1|1629664_1630471_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 124
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1649813	1650896	5095223		Planktothrix_phage(100.0%)	1	NA	NA
WP_042022708.1|1649813_1650896_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.3e-22
>prophage 125
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1668120	1668636	5095223		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945020.1|1668120_1668636_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	8.3e-25
>prophage 126
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1673173	1682593	5095223	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_001441958.1|1673173_1674406_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|1674660_1675644_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_106873715.1|1676121_1677495_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	2.8e-51
WP_001157412.1|1677623_1678559_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_001295593.1|1680884_1681319_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837933.1|1681459_1682593_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 127
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1687552	1688542	5095223		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|1687552_1688542_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 128
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1700176	1704079	5095223		Klosneuvirus(100.0%)	1	NA	NA
WP_000139619.1|1700176_1704079_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 129
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1708019	1708968	5095223		Escherichia_phage(50.0%)	2	NA	NA
WP_042022701.1|1708019_1708550_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731859.1|1708794_1708968_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 130
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1720818	1722780	5095223		Phage_TP(100.0%)	1	NA	NA
WP_001350247.1|1720818_1722780_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
>prophage 131
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1726409	1727423	5095223		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000220417.1|1726409_1727423_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
>prophage 132
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1732919	1735022	5095223		Salmonella_phage(100.0%)	1	NA	NA
WP_001764486.1|1732919_1735022_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.8	1.9e-136
>prophage 133
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1739661	1742067	5095223		Ralstonia_phage(100.0%)	1	NA	NA
WP_106873718.1|1739661_1742067_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	3.5e-25
>prophage 134
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1749531	1751076	5095223		Escherichia_phage(100.0%)	1	NA	NA
WP_106873719.1|1749531_1751076_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	4.9e-20
>prophage 135
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1762500	1764259	5095223		Escherichia_phage(66.67%)	3	NA	NA
WP_000781370.1|1762500_1762785_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000605675.1|1762784_1763063_-	hypothetical protein	NA	A0A2L1IV28	Escherichia_phage	60.9	1.1e-26
WP_000642412.1|1763248_1764259_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.8e-24
>prophage 136
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1767665	1770065	5095223		Klosneuvirus(100.0%)	1	NA	NA
WP_077781163.1|1767665_1770065_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	21.5	2.1e-09
>prophage 137
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1795441	1796077	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_044069244.1|1795441_1796077_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	5.2e-29
>prophage 138
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1801019	1802438	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_000558456.1|1801019_1802438_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 139
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1809181	1809565	5095223		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091198.1|1809181_1809565_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 140
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1818819	1819710	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_000592831.1|1818819_1819710_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	39.0	9.6e-21
>prophage 141
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1824602	1829789	5095223		Salmonella_phage(50.0%)	7	NA	NA
WP_000214712.1|1824602_1824806_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_061335806.1|1824841_1826302_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_000347478.1|1826390_1827674_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1828277_1828391_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|1828459_1828693_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087134.1|1829011_1829602_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.8e-24
WP_071528129.1|1829699_1829789_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	82.8	1.1e-06
>prophage 142
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1833027	1928413	5095223	integrase,protease,tail,portal,lysis,terminase,capsid,head,holin,transposase	Enterobacteria_phage(36.67%)	115	1830548:1830563	1927237:1927252
1830548:1830563	attL	GCATGACATGCACCAT	NA	NA	NA	NA
WP_106873721.1|1833027_1836423_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.2	0.0e+00
WP_001445893.1|1836483_1837131_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
WP_106873722.1|1837028_1837772_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	1.0e-148
WP_001545203.1|1837776_1838475_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.0e-134
WP_000447253.1|1838484_1838814_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_042021419.1|1838813_1841870_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	98.0	0.0e+00
WP_001161009.1|1841841_1842171_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001298500.1|1842179_1842566_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_042021413.1|1842626_1843370_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	4.7e-130
WP_001079419.1|1843380_1843782_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_001283158.1|1844380_1844656_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	6.6e-45
WP_001097050.1|1844648_1844972_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_077780990.1|1845058_1847086_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_000985947.1|1847030_1848539_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001072975.1|1848538_1848751_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_106873723.1|1848747_1850847_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	98.9	0.0e+00
WP_077781173.1|1850855_1851395_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	3.3e-93
WP_001031431.1|1851947_1852154_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|1852454_1852865_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019140.1|1853016_1853190_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1853361_1853517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1853596_1853662_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1853664_1853853_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1853863_1854076_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1854435_1854933_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1854929_1855463_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1855459_1855771_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1855775_1855991_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066485.1|1856744_1856960_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000087756.1|1857260_1857473_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1857527_1857617_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000203370.1|1858242_1858428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873724.1|1859588_1860341_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	7.1e-134
WP_024223300.1|1860354_1861404_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.0e-113
WP_023147795.1|1861405_1861684_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000980999.1|1861750_1862002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|1862218_1862431_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_021568046.1|1862978_1863644_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001366387.1|1863697_1863931_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	67.9	2.9e-17
WP_001151183.1|1863927_1864350_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.3e-65
WP_042021323.1|1864390_1865356_-	phage O protein family	NA	U5P0A0	Shigella_phage	60.2	5.0e-55
WP_021568048.1|1865336_1865858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476994.1|1865841_1866069_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1866146_1866554_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_009640019.1|1866746_1866878_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	58.5	6.3e-06
WP_000344950.1|1866903_1867479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1867965_1868154_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|1868150_1868342_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_106873725.1|1868435_1870850_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	54.7	1.5e-47
WP_001317493.1|1870893_1871676_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255944.1|1871672_1872695_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_042022545.1|1874171_1874312_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_042022546.1|1874509_1877986_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	86.2	0.0e+00
WP_072019665.1|1878221_1878860_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	97.8	1.6e-94
WP_034173014.1|1878757_1879501_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	4.0e-145
WP_042022549.1|1879506_1880205_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	89.2	2.1e-119
WP_034172976.1|1880410_1881574_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	4.2e-141
WP_042022550.1|1881807_1882137_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	81.7	8.4e-47
WP_042022551.1|1882133_1884716_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_086522869.1|1884696_1885110_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	1.2e-42
WP_042022552.1|1885136_1885565_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.6	1.6e-42
WP_096037581.1|1885580_1886330_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	96.0	1.0e-132
WP_042022553.1|1886337_1886733_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	82.4	1.1e-58
WP_042022554.1|1886729_1887263_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.0e-57
WP_042022556.1|1887278_1887632_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_042022558.1|1887624_1888008_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_042022562.1|1888059_1889088_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	2.9e-114
WP_000256840.1|1889145_1889493_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_042022565.1|1889529_1891035_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	1.0e-99
WP_001374583.1|1891024_1892617_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_000258997.1|1892613_1892820_-|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_106873726.1|1892803_1894732_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.4	9.1e-258
WP_000235451.1|1894703_1895213_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_077781212.1|1896184_1896718_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_122997789.1|1896874_1897060_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	1.6e-18
WP_042022572.1|1897578_1898112_-	lysozyme	NA	A0A088CC28	Shigella_phage	93.2	2.9e-97
WP_106873727.1|1898116_1898332_-|holin	holin	holin	G9L6J5	Escherichia_phage	97.2	1.0e-32
WP_042022576.1|1898409_1898715_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_052434569.1|1898738_1898915_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	62.3	5.2e-11
WP_042022578.1|1899077_1901021_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	69.4	1.7e-264
WP_042022580.1|1903163_1904222_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.7	4.3e-193
WP_042022581.1|1904372_1904570_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	96.9	5.2e-28
WP_042022582.1|1904744_1905458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096037587.1|1905711_1906377_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	1.8e-59
WP_042022587.1|1906373_1906733_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	1.1e-36
WP_096037588.1|1906745_1907795_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.7e-109
WP_042022591.1|1907796_1908075_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	5.7e-12
WP_042022595.1|1908210_1908468_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_042022596.1|1908473_1908773_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	92.9	5.8e-47
WP_052434571.1|1908977_1909607_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	75.0	9.2e-18
WP_042022597.1|1909642_1909855_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	4.9e-32
WP_042022598.1|1909904_1910261_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_086522856.1|1910318_1910744_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	2.6e-64
WP_042022600.1|1910784_1911870_-	DNA-binding protein	NA	V5URT9	Shigella_phage	61.0	5.9e-113
WP_000344866.1|1911949_1912345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042022605.1|1912579_1913005_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032223163.1|1912988_1913312_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	8.0e-10
WP_042022608.1|1913437_1913914_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_034173016.1|1914233_1914386_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_052434572.1|1914385_1914757_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	49.0	4.0e-05
WP_000449168.1|1915472_1915661_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|1915657_1915846_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106873728.1|1915941_1918413_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_042022621.1|1918474_1918744_+	excisionase	NA	NA	NA	NA	NA
WP_042022623.1|1918712_1919831_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	45.0	2.4e-85
WP_042022540.1|1920647_1921322_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	77.7	1.6e-97
WP_042022542.1|1921318_1921543_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_072275333.1|1921835_1922618_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_000255944.1|1922614_1923637_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001296941.1|1923896_1924133_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_042021317.1|1924167_1925448_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1925467_1925578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836083.1|1925635_1926655_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
WP_001298659.1|1926666_1927881_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.5	2.8e-47
1927237:1927252	attR	ATGGTGCATGTCATGC	NA	NA	NA	NA
WP_001304355.1|1928086_1928413_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
>prophage 143
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1933296	1937861	5095223		Escherichia_phage(100.0%)	4	NA	NA
WP_016265898.1|1933296_1935720_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
WP_000213028.1|1935730_1936348_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526507.1|1936349_1937204_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_106873730.1|1937246_1937861_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	5.1e-29
>prophage 144
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1955625	1956927	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_000732521.1|1955625_1956927_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.6	1.1e-17
>prophage 145
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1966822	1968634	5095223		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945910.1|1966822_1968634_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 146
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1988423	1989698	5095223	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_042021291.1|1988423_1989698_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 147
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	1996609	1998108	5095223		Salmonella_phage(50.0%)	2	NA	NA
WP_001350654.1|1996609_1997131_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250643.1|1997211_1998108_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	2.1e-07
>prophage 148
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2002523	2011326	5095223		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101208.1|2002523_2003351_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2003478_2004060_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701049.1|2004205_2005375_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2005539_2005629_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190985.1|2005927_2006953_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	2.8e-32
WP_000269506.1|2006949_2007882_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182336.1|2007994_2009206_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_106873734.1|2009496_2010645_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	2.1e-84
WP_000493947.1|2010684_2011326_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 149
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2016831	2019101	5095223		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587573.1|2016831_2017644_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	6.5e-08
WP_001070012.1|2017647_2018433_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_106873841.1|2018429_2019101_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.0	2.9e-22
>prophage 150
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2027391	2032475	5095223		environmental_halophage(33.33%)	5	NA	NA
WP_000222526.1|2027391_2028612_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
WP_042021280.1|2028608_2029880_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948852.1|2029854_2030601_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	2.9e-10
WP_001304330.1|2030610_2032098_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_106873735.1|2032106_2032475_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	38.5	3.3e-15
>prophage 151
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2050893	2070487	5095223	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_148934885.1|2050893_2052594_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	4.0e-31
WP_000069409.1|2052650_2055029_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	5.5e-172
WP_000368046.1|2055362_2056196_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082216.1|2056352_2057399_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	2.5e-84
WP_001313872.1|2057530_2057722_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175644.1|2057725_2059162_-	YdiU family protein	NA	NA	NA	NA	NA
WP_042021272.1|2059224_2059938_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209785.1|2060184_2060649_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029464.1|2060726_2061476_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|2061475_2062027_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956498.1|2062088_2063069_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2063169_2063469_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_042021269.1|2063473_2065861_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018577.1|2065875_2066859_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2067142_2067187_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2067309_2067666_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2067718_2067916_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2068012_2068555_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144199.1|2068558_2070487_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
>prophage 152
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2079865	2082127	5095223		Tupanvirus(100.0%)	1	NA	NA
WP_000077890.1|2079865_2082127_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.4	2.3e-143
>prophage 153
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2088254	2089082	5095223		Bacillus_virus(100.0%)	1	NA	NA
WP_000175018.1|2088254_2089082_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	2.7e-73
>prophage 154
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2096558	2097779	5095223		Klosneuvirus(100.0%)	1	NA	NA
WP_000081990.1|2096558_2097779_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	2.7e-26
>prophage 155
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2104542	2105196	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_001296116.1|2104542_2105196_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	8.7e-11
>prophage 156
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2109586	2111542	5095223		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235807.1|2109586_2111542_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.1e-40
>prophage 157
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2116468	2120554	5095223		Tupanvirus(50.0%)	4	NA	NA
WP_021535906.1|2116468_2117110_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.0	2.9e-19
WP_000438809.1|2117202_2118561_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|2118678_2119437_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723717.1|2119573_2120554_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	3.0e-07
>prophage 158
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2129367	2130222	5095223		Indivirus(100.0%)	1	NA	NA
WP_001337804.1|2129367_2130222_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	8.7e-11
>prophage 159
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2133540	2138117	5095223		Bacillus_phage(100.0%)	3	NA	NA
WP_000219684.1|2133540_2134824_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621390.1|2134970_2136446_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001298230.1|2136626_2138117_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 160
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2147085	2155191	5095223	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2147085_2148771_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2148975_2149557_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220975.1|2149596_2150292_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128839.1|2150349_2152260_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.0e-91
WP_001351125.1|2152391_2152736_+	RidA family protein	NA	NA	NA	NA	NA
WP_001304301.1|2153097_2153457_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2153576_2153756_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855012.1|2153829_2155191_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	1.5e-41
>prophage 161
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2159053	2160604	5095223		Moraxella_phage(100.0%)	1	NA	NA
WP_000394973.1|2159053_2160604_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 162
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2166244	2166454	5095223		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2166244_2166454_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 163
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2171786	2173835	5095223		Moraxella_phage(100.0%)	1	NA	NA
WP_001055794.1|2171786_2173835_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 164
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2181331	2185800	5095223		Escherichia_phage(33.33%)	7	NA	NA
WP_000812747.1|2181331_2181988_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	4.0e-56
WP_000984819.1|2182382_2182724_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879311.1|2182736_2183609_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2183612_2183987_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2184125_2184356_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011646.1|2184457_2185114_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944249.1|2185137_2185800_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 165
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2193856	2195332	5095223		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2193856_2195332_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 166
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2199330	2206393	5095223		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2199330_2200653_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|2200668_2201601_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2201679_2202435_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2202431_2203217_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2203361_2204372_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_032270442.1|2204380_2204992_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072123646.1|2205130_2205196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024946.1|2205267_2205870_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2205871_2206393_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 167
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2210286	2212337	5095223		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_001682959.1|2210286_2211105_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2211157_2211553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2211593_2212337_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 168
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2218953	2220687	5095223	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|2218953_2220687_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 169
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2225214	2229483	5095223		Tupanvirus(33.33%)	4	NA	NA
WP_000763860.1|2225214_2225604_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.7e-06
WP_061336067.1|2225618_2226668_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2226670_2227531_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001313042.1|2227821_2229483_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 170
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2239570	2241085	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187788.1|2239570_2241085_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	5.7e-13
>prophage 171
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2253078	2253831	5095223		Bacillus_virus(100.0%)	1	NA	NA
WP_001273000.1|2253078_2253831_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	2.9e-26
>prophage 172
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2265632	2267897	5095223		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_021513653.1|2265632_2266301_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	6.2e-81
WP_000737290.1|2266814_2267897_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.1	6.0e-166
>prophage 173
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2284226	2296596	5095223		Bacillus_phage(33.33%)	12	NA	NA
WP_077781205.1|2284226_2285921_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.1	1.9e-17
WP_000009302.1|2286091_2286274_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2286352_2287270_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|2287442_2288363_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|2288351_2288822_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|2288802_2290221_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001374850.1|2290287_2290983_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|2291022_2291388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042022220.1|2291953_2293012_+	membrane protein	NA	Q1MVN1	Enterobacteria_phage	49.1	1.5e-92
WP_001357750.1|2293607_2294459_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826709.1|2294566_2295925_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|2295924_2296596_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 174
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2300646	2301867	5095223	integrase	Ralstonia_phage(100.0%)	1	2293216:2293230	2306788:2306802
2293216:2293230	attL	CATTTCTTTATAAAT	NA	NA	NA	NA
WP_042022216.1|2300646_2301867_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.6	6.2e-79
WP_042022216.1|2300646_2301867_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.6	6.2e-79
2306788:2306802	attR	CATTTCTTTATAAAT	NA	NA	NA	NA
>prophage 175
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2308957	2309821	5095223		Enterococcus_phage(100.0%)	1	NA	NA
WP_000282336.1|2308957_2309821_+	toll/interleukin-1 receptor domain-containing protein	NA	A0A097BYB4	Enterococcus_phage	36.4	3.2e-21
>prophage 176
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2317932	2348962	5095223	integrase	Bacillus_phage(28.57%)	18	2315805:2315819	2330651:2330665
2315805:2315819	attL	TATTGGCTATCGTGT	NA	NA	NA	NA
WP_021524269.1|2317932_2318664_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	41.4	8.7e-44
WP_001233369.1|2318837_2319317_+	DUF4756 family protein	NA	NA	NA	NA	NA
WP_001287374.1|2319475_2319880_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_021520842.1|2319943_2320294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564593.1|2320402_2320645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091322.1|2320718_2321015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021524271.1|2321067_2321358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001607582.1|2321439_2321658_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	51.9	1.2e-09
WP_106873744.1|2321873_2322710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021576230.1|2323171_2323969_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_106873745.1|2324306_2325569_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	4.1e-73
WP_000703040.1|2325762_2327067_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286283.1|2327094_2328375_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_106873746.1|2328367_2330170_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	1.4e-21
WP_106873747.1|2330156_2331959_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	2.5e-31
2330651:2330665	attR	TATTGGCTATCGTGT	NA	NA	NA	NA
WP_000970688.1|2332125_2333085_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_042022200.1|2333275_2339383_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.5	1.4e-33
WP_042022198.1|2339470_2348962_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 177
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2372768	2373524	5095223		Escherichia_phage(100.0%)	1	NA	NA
WP_000281586.1|2372768_2373524_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	26.9	1.3e-18
>prophage 178
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2383287	2384097	5095223		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000047.1|2383287_2384097_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.0	7.7e-09
>prophage 179
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2401589	2402756	5095223		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|2401589_2402756_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 180
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2408953	2409853	5095223		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2408953_2409853_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 181
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2417297	2421254	5095223		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000704798.1|2417297_2418464_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.3e-114
WP_000043492.1|2418712_2420119_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_000697852.1|2420237_2421254_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.6	5.2e-87
>prophage 182
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2428475	2432159	5095223		Bacillus_phage(33.33%)	3	NA	NA
WP_000183032.1|2428475_2429369_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_000999475.1|2429611_2430607_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	2.5e-09
WP_106873748.1|2430746_2432159_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	1.4e-18
>prophage 183
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2438063	2444848	5095223		Bacillus_phage(25.0%)	6	NA	NA
WP_021549862.1|2438063_2439434_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.2	3.4e-33
WP_033549505.1|2439626_2441063_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.4	3.3e-47
WP_000699753.1|2441065_2442280_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_024189316.1|2442276_2442756_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|2442758_2443724_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_042022168.1|2443726_2444848_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.7	1.0e-131
>prophage 184
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2449165	2459347	5095223		Catovirus(40.0%)	8	NA	NA
WP_000654485.1|2449165_2450005_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_000137175.1|2450094_2452257_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_000482905.1|2452259_2452703_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978098.1|2452708_2453848_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001467956.1|2454506_2456090_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252309.1|2456157_2458011_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2458032_2458614_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2458705_2459347_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 185
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2464073	2465426	5095223		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469705.1|2464073_2465426_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 186
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2478533	2484637	5095223	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675178.1|2478533_2479937_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|2479933_2480656_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2480835_2481168_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476019.1|2481314_2482676_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
WP_001350699.1|2483004_2483322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033554838.1|2483737_2484637_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.4	7.5e-13
>prophage 187
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2493779	2497336	5095223		Serratia_phage(50.0%)	4	NA	NA
WP_042022143.1|2493779_2494784_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.0e-14
WP_042022140.1|2494780_2495746_+	sugar kinase	NA	NA	NA	NA	NA
WP_016233362.1|2495719_2496466_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106873749.1|2496517_2497336_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 188
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2507992	2510026	5095223	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350700.1|2507992_2510026_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.2	6.8e-54
>prophage 189
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2523258	2531570	5095223		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001332210.1|2523258_2525262_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|2525386_2525848_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2525888_2526359_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2526405_2527125_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2527121_2528807_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|2529028_2529760_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|2529819_2529927_+	protein YohO	NA	NA	NA	NA	NA
WP_000783151.1|2529907_2530639_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569375.1|2530643_2531570_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	3.7e-23
>prophage 190
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2551920	2553441	5095223		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255034.1|2551920_2553441_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 191
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2557135	2560921	5095223		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2557135_2557804_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425463.1|2558061_2558898_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489274.1|2558929_2560921_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 192
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2564989	2565847	5095223		Catovirus(100.0%)	1	NA	NA
WP_000873879.1|2564989_2565847_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 193
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2579234	2583535	5095223		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_106873753.1|2579234_2580701_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	1.7e-43
WP_000198798.1|2580818_2581805_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001296239.1|2581843_2582557_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|2582968_2583535_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 194
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2589289	2608044	5095223	integrase,protease	Vibrio_phage(42.86%)	21	2591282:2591295	2603560:2603573
WP_000194893.1|2589289_2590879_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	1.9e-19
WP_000202798.1|2590882_2591227_-	hypothetical protein	NA	NA	NA	NA	NA
2591282:2591295	attL	CATCATCAACAATC	NA	NA	NA	NA
WP_042022102.1|2591559_2592750_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	6.4e-20
WP_001234850.1|2592777_2593473_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578065.1|2593622_2595383_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	3.8e-101
WP_000494186.1|2595507_2595792_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|2595930_2596938_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_042022100.1|2597119_2597347_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256203.1|2597366_2599127_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000101906.1|2599496_2600738_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|2601234_2601441_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000182305.1|2601562_2601766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044808773.1|2601823_2602003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226783.1|2602195_2602396_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_047086597.1|2602385_2602838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204972.1|2602839_2603073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770164.1|2603078_2603378_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_028985834.1|2603374_2604784_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	59.5	6.9e-114
2603560:2603573	attR	GATTGTTGATGATG	NA	NA	NA	NA
WP_077632764.1|2604986_2605244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581018.1|2605233_2605506_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_064506802.1|2606154_2608044_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.7	8.5e-184
>prophage 195
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2616689	2617307	5095223		Bacillus_virus(100.0%)	1	NA	NA
WP_000888559.1|2616689_2617307_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 196
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2626075	2631877	5095223		Bacillus_phage(25.0%)	5	NA	NA
WP_000422211.1|2626075_2627719_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
WP_000884929.1|2627794_2628445_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	32.7	8.3e-06
WP_000786370.1|2628444_2629509_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
WP_000406075.1|2629582_2630638_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_001539019.1|2630749_2631877_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.9	3.2e-114
>prophage 197
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2636040	2640883	5095223		Hokovirus(50.0%)	2	NA	NA
WP_000876055.1|2636040_2638890_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
WP_001296244.1|2639056_2640883_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.5	2.9e-19
>prophage 198
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2655806	2669806	5095223		Pseudomonas_phage(33.33%)	9	NA	NA
WP_001281253.1|2655806_2658434_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
WP_000990768.1|2658580_2659303_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_106873842.1|2659442_2663201_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	28.6	3.6e-24
WP_001075170.1|2663882_2666168_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_159032321.1|2666189_2666417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000332036.1|2666438_2667569_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|2667568_2667823_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301031.1|2667876_2668527_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779093.1|2668729_2669806_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 199
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2675698	2680269	5095223	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_042022084.1|2675698_2676658_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	7.8e-69
WP_000150339.1|2676670_2676856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042022082.1|2676896_2677700_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001297939.1|2677717_2679007_-	MFS transporter	NA	NA	NA	NA	NA
WP_001580795.1|2679063_2680269_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	7.1e-27
>prophage 200
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2683872	2688876	5095223		Tupanvirus(50.0%)	4	NA	NA
WP_000879110.1|2683872_2684475_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	41.7	7.5e-09
WP_011076488.1|2684782_2685922_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	7.2e-29
WP_000461633.1|2685925_2686894_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	1.2e-35
WP_000860308.1|2686893_2688876_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 201
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2723840	2727068	5095223		Salmonella_phage(50.0%)	3	NA	NA
WP_000813854.1|2723840_2724440_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012895.1|2724498_2726331_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203415.1|2726417_2727068_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	3.6e-09
>prophage 202
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2737738	2738512	5095223		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_001293612.1|2737738_2738512_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 203
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2742723	2744241	5095223		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|2742723_2744241_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 204
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2751263	2752400	5095223		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699136.1|2751263_2752400_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
>prophage 205
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2760936	2762022	5095223		Pandoravirus(100.0%)	1	NA	NA
WP_042022052.1|2760936_2762022_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	5.3e-90
>prophage 206
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2778449	2791389	5095223	integrase	Escherichia_phage(83.33%)	6	2783964:2783977	2792434:2792447
WP_000368119.1|2778449_2779382_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.7e-167
WP_000100044.1|2779969_2780500_-	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	100.0	4.6e-87
WP_021544512.1|2780547_2788479_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	99.3	0.0e+00
2783964:2783977	attL	TATCAAAAATCAGG	NA	NA	NA	NA
WP_106873758.1|2788503_2789124_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	98.5	1.7e-117
WP_001181152.1|2789442_2790072_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	1.6e-118
WP_001224626.1|2790819_2791389_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
2792434:2792447	attR	CCTGATTTTTGATA	NA	NA	NA	NA
>prophage 207
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2799475	2807052	5095223		Bacillus_phage(50.0%)	4	NA	NA
WP_001305203.1|2799475_2803069_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001296273.1|2803124_2804270_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|2804343_2805288_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283506.1|2805357_2807052_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	8.0e-24
>prophage 208
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2810741	2811662	5095223		Morganella_phage(100.0%)	1	NA	NA
WP_000484022.1|2810741_2811662_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	2.2e-76
>prophage 209
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2815480	2816218	5095223		Clostridioides_phage(100.0%)	1	NA	NA
WP_001314031.1|2815480_2816218_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.3	6.1e-13
>prophage 210
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2841754	2863482	5095223		Streptococcus_phage(25.0%)	22	NA	NA
WP_000443690.1|2841754_2843770_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.3e-150
WP_001317975.1|2843840_2844839_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|2845068_2845830_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2846014_2846986_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2847369_2847627_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|2847671_2849399_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|2849439_2849949_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096640.1|2849991_2850843_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719965.1|2850947_2851316_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000105467.1|2851318_2852230_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	1.6e-58
WP_000021034.1|2852364_2853462_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|2853451_2854327_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458408.1|2854326_2855160_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290263.1|2855159_2856176_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517443.1|2856333_2857125_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
WP_001175632.1|2857404_2858301_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_001040463.1|2858304_2859729_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001305214.1|2859906_2860806_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.1	3.5e-26
WP_042022012.1|2860901_2861477_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|2861537_2861987_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2861973_2862399_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102910.1|2862612_2863482_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 211
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2881995	2882946	5095223		Cyanophage(100.0%)	1	NA	NA
WP_042022005.1|2881995_2882946_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 212
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2900213	2900927	5095223		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2900213_2900927_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 213
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2908374	2912376	5095223		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198327.1|2908374_2909664_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_001295473.1|2909749_2910376_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|2910700_2911738_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028626.1|2911737_2912376_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 214
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2918811	2925112	5095223		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|2918811_2918985_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669398.1|2919298_2919814_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000755178.1|2919829_2920369_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
WP_000138282.1|2920461_2922039_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|2922107_2923574_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000937901.1|2923735_2925112_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.7	1.8e-42
>prophage 215
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2945591	2946023	5095223		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|2945591_2946023_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 216
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2955913	2962251	5095223		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133524.1|2955913_2957197_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523612.1|2957255_2957456_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|2957467_2957803_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196627.1|2957804_2959655_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|2959671_2960187_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2960282_2960606_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2960622_2961009_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2961036_2962251_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 217
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2969251	2970599	5095223	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_106873762.1|2969251_2970599_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	4.6e-75
>prophage 218
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2973804	2975316	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000495597.1|2973804_2975316_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 219
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2981074	2992382	5095223		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|2981074_2982328_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883117.1|2982655_2983846_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2983890_2984229_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298400.1|2984289_2985624_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215878.1|2985613_2986327_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_042020567.1|2986491_2987919_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_042020565.1|2988494_2992382_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	3.8e-130
>prophage 220
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	2996501	2996762	5095223		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196297.1|2996501_2996762_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
>prophage 221
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3000221	3003958	5095223		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3000221_3000902_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3001168_3002143_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3002158_3003958_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 222
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3009729	3015812	5095223	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|3009729_3011064_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298616.1|3011096_3011978_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|3012080_3012668_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3012723_3013107_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|3013411_3014101_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997379.1|3014148_3015186_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_042020562.1|3015392_3015812_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.0	1.1e-14
>prophage 223
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3021105	3026569	5095223	transposase	Escherichia_phage(66.67%)	3	NA	NA
WP_000841087.1|3021105_3022404_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
WP_001317493.1|3024767_3025550_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255944.1|3025546_3026569_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 224
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3032847	3035421	5095223		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3032847_3035421_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 225
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3041325	3042396	5095223		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|3041325_3042396_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 226
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3056033	3056516	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|3056033_3056516_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 227
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3061525	3065576	5095223		Klosneuvirus(50.0%)	4	NA	NA
WP_001314065.1|3061525_3062806_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
WP_001305253.1|3063042_3064443_+	GABA permease	NA	NA	NA	NA	NA
WP_000156825.1|3064463_3065126_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3065126_3065576_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 228
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3071380	3076678	5095223		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223230.1|3071380_3071626_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080951.1|3071622_3072033_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.1e-18
WP_000246581.1|3072005_3074150_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	2.9e-196
WP_000777919.1|3074159_3075119_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	2.6e-133
WP_000985505.1|3075475_3076678_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	3.8e-28
>prophage 229
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3089336	3094723	5095223	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3089336_3089522_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047170.1|3089756_3092387_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|3092515_3093016_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3093084_3094146_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3094225_3094723_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 230
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3100191	3101157	5095223		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287423.1|3100191_3101157_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.3e-36
>prophage 231
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3108728	3109742	5095223		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001363010.1|3108728_3109742_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.8	5.1e-26
>prophage 232
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3127997	3135137	5095223		Escherichia_phage(83.33%)	6	NA	NA
WP_042021021.1|3127997_3130559_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	7.8e-31
WP_001141289.1|3130664_3131321_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	2.8e-49
WP_001298167.1|3131371_3132139_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847998.1|3132334_3133243_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	5.1e-118
WP_000590417.1|3133239_3134502_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|3134498_3135137_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 233
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3139510	3143226	5095223		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|3139510_3140503_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_042021011.1|3140565_3141705_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	5.0e-06
WP_000254708.1|3141844_3142471_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3142464_3143226_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 234
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3146337	3148370	5095223		Tupanvirus(50.0%)	2	NA	NA
WP_001173653.1|3146337_3146943_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090357.1|3146942_3148370_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	1.3e-30
>prophage 235
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3158419	3159768	5095223	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_106873762.1|3158419_3159768_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	4.6e-75
>prophage 236
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3164450	3165236	5095223		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_042020666.1|3164450_3165236_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	5.0e-21
>prophage 237
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3168809	3169481	5095223		Vibrio_phage(100.0%)	1	NA	NA
WP_001199974.1|3168809_3169481_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	3.0e-14
>prophage 238
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3173284	3176308	5095223		Streptococcus_phage(50.0%)	2	NA	NA
WP_000036723.1|3173284_3174583_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3174670_3176308_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 239
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3179704	3183819	5095223		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046816.1|3179704_3181006_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	1.1e-38
WP_000186431.1|3181062_3183819_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	1.9e-54
>prophage 240
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3191351	3192200	5095223		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|3191351_3192200_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 241
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3197058	3197814	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_001296330.1|3197058_3197814_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 242
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3209391	3211897	5095223	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_001338000.1|3209391_3210597_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	2.7e-74
WP_000184272.1|3210596_3211040_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|3211090_3211897_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
>prophage 243
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3220729	3225897	5095223		Cronobacter_phage(50.0%)	2	NA	NA
WP_097477612.1|3220729_3223375_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	3.2e-96
WP_042020681.1|3223386_3225897_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	28.0	5.1e-19
>prophage 244
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3241642	3258257	5095223		Paramecium_bursaria_Chlorella_virus(14.29%)	10	NA	NA
WP_016233518.1|3241642_3242590_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.6	1.2e-16
WP_106873771.1|3242661_3243258_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
WP_000382413.1|3243260_3244436_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810553.1|3244435_3246016_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	4.5e-05
WP_001314100.1|3246047_3246872_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|3247129_3248383_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_001765039.1|3248614_3249946_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775938.1|3250007_3251834_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.0e-24
WP_042020691.1|3251833_3255376_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
WP_001138109.1|3255368_3258257_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	6.9e-68
>prophage 245
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3263734	3270507	5095223		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3263734_3264529_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3264535_3265411_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|3265561_3267808_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3267820_3268351_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082183.1|3269035_3269725_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3269793_3270507_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 246
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3280138	3282633	5095223		Aichi_virus(50.0%)	2	NA	NA
WP_000256426.1|3280138_3281557_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000602503.1|3281871_3282633_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	1.8e-20
>prophage 247
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3286918	3287674	5095223		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|3286918_3287674_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 248
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3311953	3327345	5095223	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|3311953_3313354_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001296347.1|3313371_3314688_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012167.1|3314723_3316091_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	9.5e-161
WP_000838415.1|3316126_3316615_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001363023.1|3316614_3318534_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001363024.1|3318969_3320418_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.0	4.3e-26
WP_001050745.1|3320419_3320545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3320541_3320613_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192798.1|3320667_3321216_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|3321258_3322776_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3322785_3323884_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_042020700.1|3323974_3325708_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	4.9e-61
WP_000715230.1|3325713_3326424_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3326448_3327345_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 249
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3331160	3335633	5095223		Pandoravirus(50.0%)	2	NA	NA
WP_001350137.1|3331160_3332594_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	1.5e-31
WP_000195034.1|3332759_3335633_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	3.7e-263
>prophage 250
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3343769	3345002	5095223		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3343769_3345002_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 251
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3358550	3359228	5095223		Bacillus_virus(100.0%)	1	NA	NA
WP_000956881.1|3358550_3359228_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.2	4.9e-09
>prophage 252
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3364280	3365189	5095223		Yersinia_phage(100.0%)	1	NA	NA
WP_000646942.1|3364280_3365189_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	55.7	4.4e-53
>prophage 253
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3373343	3374498	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3373343_3374498_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 254
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3397188	3398451	5095223	integrase	Pseudomonas_phage(100.0%)	1	3386966:3386980	3415603:3415617
3386966:3386980	attL	AAGCCGTCAGTTTTA	NA	NA	NA	NA
WP_001218890.1|3397188_3398451_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.3	6.9e-81
WP_001218890.1|3397188_3398451_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.3	6.9e-81
3415603:3415617	attR	AAGCCGTCAGTTTTA	NA	NA	NA	NA
>prophage 255
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3403386	3403776	5095223	transposase	Stx2-converting_phage(100.0%)	1	NA	NA
WP_001282135.1|3403386_3403776_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	86.8	3.1e-56
>prophage 256
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3416623	3418771	5095223		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000835431.1|3416623_3418771_-	type I secretion system permease/ATPase	NA	F2Y2R6	Organic_Lake_phycodnavirus	26.9	3.2e-22
>prophage 257
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3430016	3430790	5095223		Bacillus_virus(100.0%)	1	NA	NA
WP_000677458.1|3430016_3430790_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	5.1e-18
>prophage 258
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3443339	3445141	5095223	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_000255944.1|3443339_3444362_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001317493.1|3444358_3445141_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
>prophage 259
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3451509	3463158	5095223		Moraxella_phage(100.0%)	2	NA	NA
WP_106873775.1|3451509_3461373_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.9	9.7e-29
WP_097476312.1|3461385_3463158_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.8	2.1e-22
>prophage 260
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3479534	3483352	5095223	transposase	Enterobacteria_phage(100.0%)	5	NA	NA
WP_000416157.1|3479534_3480566_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916811.1|3480836_3481280_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705928.1|3481295_3481583_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_097476309.1|3481595_3482852_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000436071.1|3483067_3483352_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	1.9e-23
>prophage 261
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3504329	3506464	5095223		Yersinia_phage(33.33%)	4	NA	NA
WP_106873778.1|3504329_3505148_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	4.4e-44
WP_000849582.1|3505202_3505688_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001186726.1|3505703_3506180_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|3506242_3506464_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 262
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3510143	3511127	5095223		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001335608.1|3510143_3511127_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	4.0e-36
>prophage 263
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3518584	3523287	5095223		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000657788.1|3518584_3519214_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	39.9	1.6e-17
WP_001534463.1|3519210_3521493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024189.1|3521577_3522597_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.4	7.0e-84
WP_000590241.1|3522618_3523287_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	2.7e-07
>prophage 264
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3555956	3557129	5095223		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524942.1|3555956_3557129_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 265
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3579353	3580238	5095223		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3579353_3580238_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 266
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3586081	3593400	5095223		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013163.1|3586081_3586909_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	2.1e-62
WP_000691613.1|3587108_3588035_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848521.1|3588085_3588343_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095192.1|3588384_3590604_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000438650.1|3590855_3591605_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_106873785.1|3591927_3593400_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.3	3.8e-46
>prophage 267
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3600857	3605897	5095223		Bacillus_virus(50.0%)	4	NA	NA
WP_001281890.1|3600857_3603116_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	5.4e-84
WP_001468194.1|3603253_3604861_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000183493.1|3604969_3605452_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|3605504_3605897_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 268
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3613739	3626185	5095223		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
WP_000986428.1|3613739_3614723_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	1.4e-09
WP_000940874.1|3614719_3615529_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.7e-14
WP_001240663.1|3615902_3618044_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195274.1|3618107_3620000_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.2	2.6e-92
WP_000105733.1|3620028_3620610_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444751.1|3620609_3621437_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3621461_3621884_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3621884_3622514_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_042021575.1|3622718_3624200_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_042021578.1|3624347_3625019_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	6.3e-33
WP_000442860.1|3625024_3626185_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
>prophage 269
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3637420	3638074	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076989.1|3637420_3638074_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	8.3e-46
>prophage 270
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3641987	3643421	5095223		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869177.1|3641987_3643421_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 271
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3648558	3651280	5095223	tRNA,transposase	Sinorhizobium_phage(50.0%)	2	NA	NA
WP_106873786.1|3648558_3649797_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	1.0e-92
WP_106873762.1|3649932_3651280_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.8	4.6e-75
>prophage 272
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3657641	3673789	5095223	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264356.1|3657641_3658655_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	1.3e-109
WP_001144069.1|3658892_3659108_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_042021138.1|3659218_3660964_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.6	2.9e-77
WP_000437380.1|3661158_3663000_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3663077_3663584_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001553453.1|3663837_3664602_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018005.1|3664889_3665513_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001764920.1|3665619_3667140_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_029783750.1|3667446_3668937_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000450588.1|3668978_3669311_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212450.1|3669529_3670513_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_042021134.1|3670696_3673789_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	3.8e-157
>prophage 273
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3686119	3687085	5095223		Escherichia_phage(100.0%)	1	NA	NA
WP_042021127.1|3686119_3687085_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 274
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3706965	3709260	5095223		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861709.1|3706965_3709260_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
>prophage 275
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3715415	3716561	5095223		Streptococcus_phage(100.0%)	1	NA	NA
WP_001298324.1|3715415_3716561_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	2.8e-49
>prophage 276
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3733245	3741041	5095223		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809265.1|3733245_3734109_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_000249130.1|3734173_3736210_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246833.1|3736167_3736563_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|3736582_3737173_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|3737182_3737758_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147637.1|3737870_3738911_-	permease	NA	NA	NA	NA	NA
WP_000084526.1|3738983_3739619_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_001350722.1|3739746_3740265_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	1.7e-09
WP_000449450.1|3740244_3740688_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189322.1|3740738_3741041_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 277
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3746743	3748633	5095223		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3746743_3748633_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 278
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3754114	3760753	5095223		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133040.1|3754114_3756787_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	3.3e-24
WP_001031057.1|3756811_3758299_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3758326_3758779_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|3759409_3760753_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 279
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3764833	3767706	5095223	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|3764833_3765682_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|3765771_3767706_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 280
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3774335	3775813	5095223		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|3774335_3775307_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445407.1|3775534_3775813_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 281
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3779881	3794675	5095223		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|3779881_3780691_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_042021103.1|3780900_3781878_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3781891_3782878_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030015.1|3782898_3783465_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	4.2e-54
WP_000030537.1|3783461_3784037_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_106873790.1|3784005_3784563_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3784569_3785295_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|3785342_3786776_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3786798_3787086_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183674.1|3787203_3787695_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3787740_3788595_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3788591_3788864_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620407.1|3789076_3789709_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_106873791.1|3789705_3790434_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000719791.1|3790430_3791084_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_001533645.1|3791313_3793650_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001296449.1|3793745_3794675_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 282
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3801423	3808691	5095223	protease	Salmonella_phage(33.33%)	8	NA	NA
WP_000445149.1|3801423_3802551_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000605256.1|3802610_3803075_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209059.1|3803071_3803947_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3803943_3804633_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108474.1|3804680_3806171_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
WP_000224714.1|3806279_3807173_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000074795.1|3807294_3808086_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000366127.1|3808193_3808691_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 283
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3812658	3814026	5095223	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001298588.1|3812658_3814026_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.0	1.7e-21
>prophage 284
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3831677	3832721	5095223		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3831677_3832721_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 285
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3842008	3846521	5095223		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000132912.1|3842008_3843508_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
WP_001298583.1|3843568_3844459_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275539.1|3844494_3845349_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843962.1|3845690_3846521_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 286
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3851858	3852743	5095223		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_061335839.1|3851858_3852743_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	2.1e-23
>prophage 287
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3859247	3863401	5095223		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738584.1|3859247_3860273_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	4.0e-71
WP_042021089.1|3860340_3861522_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012312000.1|3861531_3862635_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078344.1|3862642_3863401_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 288
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3873728	3875200	5095223	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|3873728_3874238_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004421.1|3874252_3875200_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 289
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3896424	3898377	5095223		Vibrio_phage(100.0%)	1	NA	NA
WP_001525807.1|3896424_3898377_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	1.2e-31
>prophage 290
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3904879	3917715	5095223	transposase	Escherichia_phage(28.57%)	14	NA	NA
WP_001317493.1|3904879_3905662_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255944.1|3905658_3906681_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001298207.1|3907088_3907550_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_061336009.1|3907549_3908227_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000675504.1|3908255_3908732_-	bacterioferritin	NA	NA	NA	NA	NA
WP_000289085.1|3908803_3908998_-	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_042020649.1|3909166_3911851_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	35.7	1.5e-40
WP_000031783.1|3912142_3913327_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|3913397_3915512_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|3915608_3916079_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3916175_3916550_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903381.1|3916675_3916963_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820734.1|3916969_3917329_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	30.2	3.1e-10
WP_001209702.1|3917328_3917715_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	4.3e-18
>prophage 291
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3923285	3932825	5095223		Tupanvirus(25.0%)	9	NA	NA
WP_033554895.1|3923285_3925199_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	9.5e-74
WP_042020623.1|3925198_3926221_+	hydrolase	NA	NA	NA	NA	NA
WP_000907086.1|3926214_3926433_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	4.0e-05
WP_001274684.1|3926486_3927356_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|3927410_3927815_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|3928116_3928749_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001304921.1|3928799_3930890_+	membrane protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
WP_016233602.1|3930952_3932176_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601853.1|3932261_3932825_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.1e-62
>prophage 292
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3951736	3952573	5095223		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|3951736_3952573_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 293
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3962205	3963553	5095223	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_099156434.1|3962205_3963553_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 294
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3970914	3974682	5095223		Bacillus_phage(66.67%)	3	NA	NA
WP_001309803.1|3970914_3972537_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253708.1|3972613_3973966_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3973962_3974682_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 295
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3987907	3990301	5095223		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081882.1|3987907_3990301_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 296
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	3994692	3995919	5095223		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105470.1|3994692_3995919_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	2.0e-133
>prophage 297
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4011333	4013781	5095223		Dickeya_phage(100.0%)	1	NA	NA
WP_000993444.1|4011333_4013781_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 298
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4033651	4035462	5095223		Enterococcus_phage(50.0%)	2	NA	NA
WP_106873795.1|4033651_4034395_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.7	3.4e-11
WP_000907824.1|4034391_4035462_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 299
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4039003	4040486	5095223		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|4039003_4039717_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|4039718_4040486_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 300
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4046208	4049027	5095223		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4046208_4047063_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4047307_4048366_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4048358_4049027_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 301
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4052033	4057767	5095223	transposase	Dickeya_phage(40.0%)	5	NA	NA
WP_000964718.1|4052033_4052660_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106604.1|4052733_4054932_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	3.8e-119
WP_106873677.1|4055028_4056376_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000130621.1|4056635_4056881_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100463.1|4057101_4057767_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	7.4e-58
>prophage 302
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4065660	4066467	5095223		Bacillus_virus(100.0%)	1	NA	NA
WP_000173679.1|4065660_4066467_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
>prophage 303
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4073906	4076642	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149127.1|4073906_4076642_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 304
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4086328	4091737	5095223		Indivirus(50.0%)	5	NA	NA
WP_021521097.1|4086328_4088371_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	4.0e-46
WP_000954225.1|4088573_4089416_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_000160795.1|4089487_4090840_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_001295215.1|4090893_4090977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065794.1|4091311_4091737_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	1.4e-49
>prophage 305
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4102408	4103878	5095223		Pithovirus(50.0%)	2	NA	NA
WP_001366697.1|4102408_4103179_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	6.6e-18
WP_000123131.1|4103230_4103878_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 306
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4149817	4151802	5095223		Bacillus_virus(50.0%)	2	NA	NA
WP_000103570.1|4149817_4150822_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.5e-17
WP_001196477.1|4150818_4151802_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 307
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4167379	4169713	5095223		Escherichia_phage(100.0%)	1	NA	NA
WP_000013972.1|4167379_4169713_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	1.8e-71
>prophage 308
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4173367	4173580	5095223		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|4173367_4173580_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 309
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4177801	4178797	5095223		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182637.1|4177801_4178797_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.1	2.0e-11
>prophage 310
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4184115	4185657	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146503.1|4184115_4185657_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 311
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4205231	4209843	5095223		Clostridioides_phage(50.0%)	3	NA	NA
WP_000985735.1|4205231_4206527_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	31.3	2.2e-21
WP_000741500.1|4206656_4207808_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000582433.1|4207998_4209843_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 312
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4232528	4243256	5095223		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|4232528_4232780_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4232920_4233352_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|4233596_4235141_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214150.1|4235150_4236434_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483831.1|4236437_4237397_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982068.1|4237383_4238418_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	2.9e-08
WP_000646018.1|4238656_4239682_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213845.1|4239691_4240888_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.3	4.9e-36
WP_001765161.1|4241162_4242035_-	protein YibB	NA	NA	NA	NA	NA
WP_000587750.1|4242323_4243256_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 313
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4255186	4259749	5095223		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171854.1|4255186_4255666_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114533.1|4255704_4256514_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|4256611_4256779_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4256799_4257036_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|4257252_4257921_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_042021629.1|4258092_4259313_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.4	1.1e-43
WP_001298007.1|4259293_4259749_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 314
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4263767	4268788	5095223		Vibrio_phage(33.33%)	4	NA	NA
WP_042021632.1|4263767_4265450_-	NAD-dependent DNA ligase LigB	NA	A0A1Q2U2Q6	Vibrio_phage	23.2	2.5e-22
WP_001295237.1|4265707_4266331_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4266385_4266661_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280473.1|4266679_4268788_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 315
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4273089	4274481	5095223		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4273089_4274481_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 316
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4287742	4288780	5095223		Wolbachia_phage(100.0%)	1	NA	NA
WP_106873805.1|4287742_4288780_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.9	2.5e-73
>prophage 317
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4294231	4295566	5095223		Moraxella_phage(100.0%)	1	NA	NA
WP_001442062.1|4294231_4295566_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 318
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4302870	4314748	5095223		Micromonas_sp._RCC1109_virus(16.67%)	12	NA	NA
WP_000168476.1|4302870_4304559_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001312198.1|4304664_4304763_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001304999.1|4305163_4306348_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	5.2e-14
WP_106873807.1|4306355_4306853_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4306849_4307212_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4307201_4307549_-	YidH family protein	NA	NA	NA	NA	NA
WP_042021655.1|4307608_4309102_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	1.1e-29
WP_001087166.1|4309098_4310814_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	7.3e-41
WP_001305000.1|4310980_4311847_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001279773.1|4311936_4313598_-	putative transporter	NA	NA	NA	NA	NA
WP_001243431.1|4313794_4314223_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4314334_4314748_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 319
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4319177	4320326	5095223		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|4319177_4320326_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 320
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4325031	4332400	5095223		Bacillus_virus(33.33%)	8	NA	NA
WP_106873808.1|4325031_4327446_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	4.8e-115
WP_000060112.1|4327474_4328548_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4328547_4329648_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4329652_4331056_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|4331352_4331433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|4331662_4331803_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4331819_4332179_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4332142_4332400_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 321
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4342598	4343936	5095223		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|4342598_4343936_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 322
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4354307	4361823	5095223		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4354307_4355081_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251986.1|4355171_4356062_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4356061_4357021_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4357107_4358148_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334086.1|4358461_4360291_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	5.6e-132
WP_042021670.1|4360452_4361823_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	5.3e-34
>prophage 323
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4373775	4374768	5095223		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|4373775_4374768_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 324
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4377936	4383789	5095223		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4377936_4379805_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001350412.1|4379971_4380391_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387762.1|4380398_4381904_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|4381908_4382874_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001297966.1|4382898_4383789_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.8	9.7e-05
>prophage 325
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4397179	4398826	5095223		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_042020843.1|4397179_4398826_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	5.7e-67
>prophage 326
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4406420	4411834	5095223		Bacillus_phage(33.33%)	4	NA	NA
WP_001238855.1|4406420_4408442_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	3.8e-113
WP_001314257.1|4408488_4409973_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_106873811.1|4410108_4411374_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_001280776.1|4411504_4411834_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 327
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4415876	4422020	5095223		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|4415876_4417007_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006610.1|4417003_4418266_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226625.1|4418265_4419333_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_000676064.1|4419351_4420233_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	2.1e-105
WP_001145189.1|4420210_4420885_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612049.1|4420889_4422020_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 328
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4430027	4431683	5095223		Tetraselmis_virus(100.0%)	1	NA	NA
WP_042020834.1|4430027_4431683_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	3.0e-44
>prophage 329
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4441999	4445858	5095223		Bacillus_phage(100.0%)	3	NA	NA
WP_000130678.1|4441999_4442896_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	5.0e-25
WP_001213584.1|4442895_4443612_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|4443695_4445858_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 330
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4453227	4455057	5095223		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|4453227_4455057_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 331
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4465517	4467026	5095223		Vibrio_phage(100.0%)	1	NA	NA
WP_000037973.1|4465517_4467026_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	6.2e-12
>prophage 332
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4483467	4486754	5095223		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187545.1|4483467_4485108_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|4485186_4485456_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459600.1|4485459_4485975_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109949.1|4485977_4486754_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 333
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4495625	4496240	5095223		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295262.1|4495625_4496240_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 334
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4509923	4512710	5095223		uncultured_virus(100.0%)	1	NA	NA
WP_042021938.1|4509923_4512710_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 335
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4516831	4519302	5095223		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001315107.1|4516831_4518241_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190574.1|4518252_4519302_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 336
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4533025	4535805	5095223		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718885.1|4533025_4533922_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621625.1|4534089_4534986_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|4535019_4535805_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 337
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4544531	4547582	5095223		Escherichia_phage(100.0%)	1	NA	NA
WP_077627280.1|4544531_4547582_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 338
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4558860	4563786	5095223		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_042021931.1|4558860_4559481_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	3.2e-63
WP_106873814.1|4559740_4560724_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_106873815.1|4560872_4561547_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4561717_4563091_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033719.1|4563087_4563786_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 339
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4573875	4581335	5095223	transposase	Bacillus_phage(33.33%)	7	NA	NA
WP_099156434.1|4573875_4575224_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_106873817.1|4575301_4576810_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4576832_4577678_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4578102_4578348_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4578432_4578918_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_042020403.1|4579010_4579937_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_042020405.1|4580003_4581335_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	2.2e-45
>prophage 340
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4594545	4599139	5095223		Pandoravirus(100.0%)	3	NA	NA
WP_042020409.1|4594545_4596096_-	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	35.4	3.4e-05
WP_000105537.1|4596328_4597453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694071.1|4597585_4599139_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.7e-09
>prophage 341
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4605952	4613199	5095223		Synechococcus_phage(33.33%)	5	NA	NA
WP_106873819.1|4605952_4606615_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	1.2e-28
WP_001553800.1|4606626_4609128_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004469.1|4609436_4610516_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|4610530_4610851_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184862.1|4610901_4613199_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 342
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4625343	4626558	5095223		Oenococcus_phage(100.0%)	1	NA	NA
WP_000691039.1|4625343_4626558_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.1	7.7e-45
>prophage 343
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4631998	4637775	5095223	tRNA	Burkholderia_virus(50.0%)	5	NA	NA
WP_000125464.1|4631998_4633315_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	35.4	1.6e-59
WP_122083113.1|4633418_4634069_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_000806411.1|4634068_4634428_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_000187001.1|4634467_4635568_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_042020426.1|4635936_4637775_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.2	3.5e-09
>prophage 344
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4646116	4649169	5095223		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|4646116_4647067_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|4647984_4649169_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 345
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4653164	4661493	5095223		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|4653164_4657193_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|4657269_4661493_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 346
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4669789	4671553	5095223		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|4669789_4670461_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|4670503_4671094_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|4671280_4671553_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 347
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4676915	4678505	5095223		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001606605.1|4676915_4678505_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.0e-68
>prophage 348
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4692202	4695886	5095223		Dickeya_phage(100.0%)	1	NA	NA
WP_000096035.1|4692202_4695886_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	88.5	2.9e-26
>prophage 349
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4720227	4721343	5095223		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4720227_4721343_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 350
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4728694	4729303	5095223		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4728694_4729303_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 351
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4734340	4736888	5095223		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|4734340_4735756_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147347.1|4735808_4736888_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 352
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4744218	4750205	5095223	transposase	Escherichia_phage(66.67%)	5	NA	NA
WP_085949836.1|4744218_4745431_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_159032325.1|4745890_4746133_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_042020743.1|4747305_4747875_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000255944.1|4748403_4749426_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001317493.1|4749422_4750205_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
>prophage 353
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4763356	4765491	5095223		Yersinia_phage(33.33%)	4	NA	NA
WP_106873778.1|4763356_4764175_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	4.4e-44
WP_000849582.1|4764229_4764715_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001186726.1|4764730_4765207_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692329.1|4765269_4765491_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 354
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4774121	4777333	5095223	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856826.1|4774121_4775579_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	3.1e-48
WP_000003805.1|4775815_4777333_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
>prophage 355
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4796897	4798400	5095223		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296659.1|4796897_4798400_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	1.4e-56
>prophage 356
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4803240	4804029	5095223		Pithovirus(100.0%)	1	NA	NA
WP_001193414.1|4803240_4804029_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	1.1e-12
>prophage 357
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4809633	4811183	5095223		Bacillus_virus(50.0%)	2	NA	NA
WP_001075531.1|4809633_4810392_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.3	1.6e-16
WP_000611410.1|4810502_4811183_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 358
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4817298	4823667	5095223		Staphylococcus_phage(50.0%)	5	NA	NA
WP_033807290.1|4817298_4818831_+	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	6.3e-20
WP_000507104.1|4818809_4819790_+	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_001314355.1|4819800_4820496_+	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001765292.1|4820479_4821409_+	allose kinase	NA	NA	NA	NA	NA
WP_001765293.1|4821681_4823667_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.6	1.4e-149
>prophage 359
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4828912	4831060	5095223		Escherichia_phage(100.0%)	1	NA	NA
WP_077781155.1|4828912_4831060_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	3.1e-33
>prophage 360
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4834977	4836505	5095223		Planktothrix_phage(100.0%)	2	NA	NA
WP_000132446.1|4834977_4835814_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	8.8e-16
WP_000156927.1|4835800_4836505_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	2.6e-21
>prophage 361
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4846554	4848513	5095223		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078223.1|4846554_4848513_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
>prophage 362
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4854730	4856080	5095223		Moraxella_phage(100.0%)	1	NA	NA
WP_106873825.1|4854730_4856080_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 363
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4859896	4863510	5095223		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|4859896_4860433_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357763.1|4860687_4863510_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.2	0.0e+00
>prophage 364
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4873453	4874848	5095223		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_106873826.1|4873453_4874848_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	6.1e-38
>prophage 365
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4879746	4881870	5095223		Bacillus_phage(100.0%)	1	NA	NA
WP_106873827.1|4879746_4881870_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.7	1.4e-46
>prophage 366
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4908653	4909919	5095223	integrase	Pseudomonas_phage(100.0%)	1	4902852:4902864	4910038:4910050
4902852:4902864	attL	TGCCGCCAAATCA	NA	NA	NA	NA
WP_001535556.1|4908653_4909919_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	1.4e-78
WP_001535556.1|4908653_4909919_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	1.4e-78
4910038:4910050	attR	TGATTTGGCGGCA	NA	NA	NA	NA
>prophage 367
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4918253	4920237	5095223		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|4918253_4918547_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4918590_4920237_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 368
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4924441	4924975	5095223		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|4924441_4924975_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 369
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4929895	4930873	5095223		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4929895_4930873_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 370
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4938301	4938847	5095223		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|4938301_4938847_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 371
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4942762	4955794	5095223	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_001683482.1|4942762_4944100_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_042022350.1|4944109_4945957_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.6	1.2e-60
WP_106873830.1|4945949_4946900_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4946985_4947294_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460357.1|4947370_4948651_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312479.1|4948736_4949996_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4949998_4951003_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4951084_4951282_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4951385_4952684_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4952888_4953314_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076340.1|4953352_4955794_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
>prophage 372
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	4959637	4960801	5095223		Ralstonia_phage(100.0%)	1	NA	NA
WP_042022344.1|4959637_4960801_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.8e-80
>prophage 373
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	5004708	5011196	5095223		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|5004708_5005239_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265920.1|5005548_5006505_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205809.1|5006644_5008147_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001442088.1|5008160_5009183_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106873831.1|5009169_5010165_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|5010197_5011196_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 374
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	5015385	5018146	5095223		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106233.1|5015385_5015850_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187806.1|5016007_5018146_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	2.6e-266
>prophage 375
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	5021784	5027881	5095223		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181333.1|5021784_5022732_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|5022916_5022970_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_042022321.1|5023110_5025807_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.2	1.0e-44
WP_000047539.1|5026012_5026399_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|5026471_5026933_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|5026945_5027881_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 376
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	5038226	5050266	5095223	tRNA,integrase	Klosneuvirus(20.0%)	8	5034424:5034438	5053938:5053952
5034424:5034438	attL	CAAACCGCTTTGTGC	NA	NA	NA	NA
WP_106873832.1|5038226_5041082_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_000786399.1|5041081_5041525_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|5041782_5043294_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|5043560_5044661_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|5044660_5045743_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_021541537.1|5045903_5047406_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	1.4e-83
WP_042022312.1|5047535_5048555_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
WP_042022309.1|5049021_5050266_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.2	1.1e-83
5053938:5053952	attR	CAAACCGCTTTGTGC	NA	NA	NA	NA
>prophage 377
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	5057495	5059946	5095223		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_042022306.1|5057495_5059946_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	25.5	5.9e-20
>prophage 378
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	5074268	5075993	5095223		Bacillus_virus(50.0%)	2	NA	NA
WP_106873834.1|5074268_5075036_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.3	1.4e-12
WP_042022291.1|5075036_5075993_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
>prophage 379
NZ_CP027461	Escherichia coli strain 95-3322 chromosome, complete genome	5095223	5086416	5087141	5095223	transposase	Stx2-converting_phage(100.0%)	2	NA	NA
WP_000612591.1|5086416_5086764_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_096958686.1|5086760_5087141_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	4.6e-65
