The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	173026	229955	5253712	transposase,terminase,tRNA,holin,protease,integrase	Escherichia_phage(44.64%)	66	186337:186353	226956:226972
WP_000003317.1|173026_174181_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_001090844.1|174465_175479_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000551818.1|175505_176624_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001107171.1|176734_178009_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032206354.1|178026_178647_+	YfgM family protein	NA	NA	NA	NA	NA
WP_001177043.1|178657_179836_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_000249410.1|179953_181426_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001297332.1|181494_181710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087547.1|181706_183077_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
WP_032206389.1|183238_184705_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	6.8e-88
WP_000138282.1|184773_186351_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
186337:186353	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000954572.1|186543_187794_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.5	3.6e-239
WP_023909811.1|187797_187992_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	5.7e-27
WP_052905337.1|187988_188639_-	adenine methylase	NA	G9L699	Escherichia_phage	97.7	2.1e-126
WP_001341620.1|188631_188883_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_000675390.1|189040_189289_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_106888198.1|189338_190220_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.0	8.3e-158
WP_097499607.1|190216_191038_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.4	1.4e-159
WP_088375643.1|191034_191241_-	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	84.0	3.3e-17
WP_001102257.1|191237_191537_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	100.0	3.4e-47
WP_023278010.1|191845_192430_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_001282459.1|192584_192815_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402895.1|192965_193166_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	100.0	2.1e-32
WP_106913915.1|193181_193991_+	primosomal protein	NA	Q286X4	Escherichia_phage	92.4	1.0e-117
WP_059278296.1|193987_194773_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	6.1e-152
WP_106888200.1|194890_195235_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	95.6	3.4e-59
WP_106888201.1|195296_195860_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	91.1	1.6e-50
WP_106888202.1|195856_196162_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	89.9	2.3e-43
WP_106888203.1|196148_196871_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	69.7	6.7e-81
WP_000403779.1|196848_197205_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_000063625.1|197253_197466_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_106888204.1|197501_197999_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	54.7	5.9e-36
WP_106888205.1|197958_198174_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	98.6	3.9e-37
WP_001142590.1|198175_198394_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|198395_198683_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_097411275.1|199576_199915_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	1.1e-57
WP_001124396.1|199932_200145_+	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_001090120.1|200141_200816_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_106888207.1|200812_202288_+|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	1.7e-296
WP_074554701.1|202378_202756_-	hypothetical protein	NA	Q716B1	Shigella_phage	78.9	1.1e-45
WP_000335899.1|203458_203665_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_016236151.1|203679_205359_+	hypothetical protein	NA	G9L6C2	Escherichia_phage	99.3	1.4e-302
WP_000133160.1|205355_205652_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_001460331.1|205654_206350_+|protease	protease	protease	G9L6C4	Escherichia_phage	99.6	1.8e-94
WP_106888208.1|206364_207351_+	hypothetical protein	NA	A0A0F6TJQ9	Escherichia_coli_O157_typing_phage	99.7	7.3e-187
WP_088375652.1|207402_207840_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.9	5.0e-71
WP_033813652.1|207850_208186_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	1.7e-55
WP_021538095.1|208561_209167_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	4.7e-112
WP_106888209.1|210593_210719_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.0	6.0e-06
WP_106888077.1|210684_211898_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106888211.1|212938_213403_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.1	9.3e-84
WP_106888212.1|213402_213948_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	76.8	2.1e-66
WP_106888213.1|213947_216461_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	97.7	0.0e+00
WP_088375657.1|216457_218260_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.7	0.0e+00
WP_088375658.1|218265_220740_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	98.8	0.0e+00
WP_088375659.1|220935_221232_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	98.0	3.1e-48
WP_088375660.1|221263_221521_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	95.3	1.2e-40
WP_106888214.1|223857_224871_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_001275998.1|225055_225460_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_016046623.1|225446_225755_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
WP_088375662.1|225744_226374_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	91.4	5.1e-109
WP_106888215.1|226370_226868_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	59.0	2.0e-39
WP_047087546.1|227064_227604_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	92.2	1.7e-41
226956:226972	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_047087545.1|227619_228132_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	98.2	1.2e-60
WP_106888098.1|228265_229539_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001344399.1|229781_229955_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 2
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	375023	467319	5253712	transposase,capsid,portal,bacteriocin,terminase,tRNA,lysis,holin,protease,tail,integrase	Escherichia_phage(48.05%)	102	374805:374829	435522:435546
374805:374829	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|375023_376193_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|376176_376359_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994801.1|376437_376806_-	DUF1627 domain-containing protein	NA	A0A0P0ZCA9	Stx2-converting_phage	100.0	8.8e-53
WP_106898674.1|376841_377000_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	98.1	1.1e-20
WP_000163445.1|377008_377641_-	adenine methylase	NA	Q08J66	Stx2-converting_phage	100.0	3.3e-124
WP_000669287.1|377867_378035_-	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000203836.1|378077_378701_-	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000951706.1|380168_380378_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000797281.1|380379_380568_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_001289935.1|380719_381493_-	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	100.0	1.0e-143
WP_000763383.1|381489_381711_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001447688.1|381809_382091_-	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000548528.1|382101_382293_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682304.1|382265_382448_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000186848.1|382444_383125_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100845.1|383121_383907_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995467.1|383912_384209_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|384283_384427_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|384395_384560_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_106913917.1|384632_385001_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000167585.1|385151_385622_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000198445.1|385680_386064_-	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000250473.1|386944_387652_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|387730_387958_+	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438533.1|388096_388393_+	hypothetical protein	NA	G9L678	Escherichia_phage	96.9	2.6e-47
WP_000062360.1|388555_389332_+	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	100.0	1.9e-137
WP_001444365.1|389442_392349_+	replication protein P	NA	A0A0P0ZC72	Stx2-converting_phage	100.0	0.0e+00
WP_001036036.1|392349_392619_+	hypothetical protein	NA	A0A0P0ZCF7	Stx2-converting_phage	100.0	4.9e-45
WP_000103679.1|392704_392920_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|392930_393167_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|393123_393570_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|393566_394094_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|394090_394273_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211423.1|394547_395282_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	5.5e-123
WP_001004009.1|395356_396079_+	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	100.0	1.3e-129
WP_001107963.1|396078_396684_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_032346932.1|396680_396875_+	protein ninH	NA	G9L694	Escherichia_phage	98.4	7.1e-30
WP_001204862.1|396867_397302_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	99.3	1.8e-81
WP_000649753.1|398085_399045_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|399056_399326_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|399812_401750_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000143458.1|401884_402064_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|402104_402377_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|402453_402669_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|402673_403207_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|403480_404050_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|404049_404199_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|404206_404671_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|404702_404996_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001086073.1|405404_406211_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143988.1|406191_407898_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787034.1|407897_410042_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	100.0	0.0e+00
WP_106913918.1|410199_411195_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	1.5e-171
WP_085972493.1|411165_412439_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000214474.1|412566_413781_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|413836_414226_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|414275_414737_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829202.1|414720_415284_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_000207922.1|415283_415934_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_001444877.1|415930_417868_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_001023433.1|417869_418139_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_001370566.1|418278_418458_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001146329.1|418761_420387_+	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_000162954.1|420383_421652_+	host specificity protein J	NA	A0A2L1IV54	Escherichia_phage	89.5	2.6e-213
WP_000455634.1|421666_421945_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|421950_422568_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|422658_423393_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|423625_423766_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|423822_424224_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|424317_424974_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|424976_425423_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540391.1|425432_425684_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012449.1|425694_426960_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	98.8	9.9e-205
WP_106913919.1|427028_435398_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	93.5	0.0e+00
WP_106482641.1|435620_436553_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	3.0e-166
435522:435546	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_000776768.1|436846_437602_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_047087732.1|437783_439052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021553753.1|439417_440758_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000030901.1|441129_441414_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_047087733.1|441594_442905_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_032205890.1|442904_445049_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_001195819.1|445251_445737_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000033328.1|446420_446984_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_032205889.1|449727_450480_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032205888.1|450495_451005_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000714140.1|451001_451490_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000844745.1|451486_452026_+	fimbrial protein	NA	NA	NA	NA	NA
WP_047087734.1|452027_452882_+	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730806.1|452954_453506_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001298774.1|453671_454604_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_047087735.1|454638_455724_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.1	1.6e-89
WP_032205885.1|455727_456552_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000447361.1|456551_457361_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_001089241.1|457360_457909_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_032205884.1|457942_458221_+	YfcL family protein	NA	NA	NA	NA	NA
WP_000683799.1|458353_460360_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_047087736.1|460518_461739_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_032205882.1|462022_463201_+	MFS transporter	NA	NA	NA	NA	NA
WP_047087737.1|463197_464193_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000699121.1|464291_465428_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_001289165.1|465493_466507_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024226472.1|466506_467319_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	661741	698233	5253712	transposase,tail,lysis,tRNA	Enterobacteria_phage(47.37%)	39	NA	NA
WP_000968208.1|661741_662437_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_032206274.1|662433_662832_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_032206306.1|663070_664021_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|664408_664492_-	protein YohP	NA	NA	NA	NA	NA
WP_032206273.1|664715_666152_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079520.1|666204_666966_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001307896.1|667095_667674_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|667843_668431_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_047088140.1|668604_669537_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_047088138.1|669575_671291_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_032206270.1|671486_673784_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001130307.1|673994_674912_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_032206269.1|674918_676076_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_032206267.1|676068_676995_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	6.3e-23
WP_032206266.1|676999_677731_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|677711_677819_-	protein YohO	NA	NA	NA	NA	NA
WP_029208472.1|677878_678580_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_085972493.1|679138_680411_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_106888219.1|680448_681662_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	9.3e-168
WP_064756364.1|681699_682197_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	5.4e-90
WP_001254257.1|682193_682376_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_032208534.1|682372_682543_+	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	1.6e-25
WP_001028854.1|683143_683809_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|684020_684980_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|685315_685438_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|685452_686142_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_122998106.1|686325_687069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|687154_687313_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_153244796.1|687505_687649_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_106888220.1|687746_688902_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.3e-67
WP_032207041.1|689615_690077_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	9.2e-76
WP_032207043.1|690116_690587_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_000598641.1|690633_691353_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|691349_693035_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_032207044.1|693549_693798_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	82.9	3.4e-32
WP_001121225.1|694392_695043_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491544.1|695267_696143_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.9	9.7e-159
WP_047087983.1|696282_696552_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	95.5	1.6e-43
WP_106888186.1|697076_698233_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
>prophage 4
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	867458	925544	5253712	transposase,capsid,tail,terminase,lysis,holin,head,integrase	Enterobacteria_phage(32.43%)	44	858100:858159	916546:917855
858100:858159	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_000533619.1|867458_868484_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_000096346.1|868483_868687_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047088169.1|871529_871790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047088170.1|871856_872135_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	1.1e-10
WP_047088173.1|872136_873153_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.9	5.2e-87
WP_047088175.1|873194_873560_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.6	4.3e-36
WP_047088177.1|873568_873982_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	50.3	2.4e-38
WP_000917749.1|874205_874403_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_001490213.1|876053_876485_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	99.3	7.8e-69
WP_060552899.1|877055_878906_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000411811.1|879349_879556_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|879560_879905_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_047087679.1|879955_880489_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	1.6e-100
WP_106888225.1|880786_881281_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.8e-83
WP_000736096.1|881277_881502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032207766.1|883465_883831_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.3e-64
WP_106888226.1|884118_884682_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	78.7	4.0e-57
WP_047087924.1|886403_888341_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.4	0.0e+00
WP_001063096.1|888385_888607_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|891133_891460_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|891469_891820_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|891816_892263_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_106888227.1|892259_892565_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.0	1.1e-48
WP_097746533.1|892605_893762_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_106888228.1|893937_894654_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030063.1|894659_895034_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|895129_895339_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000807944.1|898645_898987_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_032208657.1|898986_899685_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.8e-131
WP_047088117.1|899690_900434_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.2e-144
WP_122993101.1|900379_901012_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	7.6e-105
WP_000649829.1|901202_901730_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106913923.1|901863_905343_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.6	0.0e+00
WP_001230496.1|905409_906009_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_158707840.1|906073_907648_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.5	1.4e-62
WP_115801847.1|907754_907844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938111.1|914579_915941_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_106918805.1|918328_918529_+	hypothetical protein	NA	NA	NA	NA	NA
916546:917855	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTTCCAGCAATCGTCGATTGTTATACCAGTCCCCCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCGCCTGTACTTCCTGTTGATGCCAGTAATCCGGCTTCCTTAAGCCGCTGTGTGTAGGCCAGCGATACATACTGAGAACCTTTATCACTGTGATGGACCGTGCCGGACGGTCGACGGGCCCATAACGCCTGCTCCAGTGCATCCAGCACGAATGTCGTCTCCATGGACGGTGAGACCCGCCACCCCACAATGTATCCGGCAAACACATCAATGATGAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCATAACCGCCATGAGACGTGCCACAGTGCATCTGGCCACTCTGATACCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTATACCTTGTGATTTTCATCGTATACGCGCTGTATCTCTTTCTTCAGCCAGTCATCGCGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAGTGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATAGCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGCTCCAGCTCTTTCAGACGCTGACGTTCAGCGGTGGTGAGCCCTCCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGAGCAATGGAACAAATTGCCGCCCATTGTGAGTCATATTCGCCCTGACTTTCCAGAACCATACGAACTGCCCGTTGACGGACTTCAGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAG	NA	NA	NA	NA
WP_001230532.1|918596_919196_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_159031400.1|919260_920835_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	96.7	5.2e-62
WP_071887496.1|920960_921692_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_106888232.1|922016_922670_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_072057402.1|923805_924264_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	4.0e-55
WP_085972493.1|924270_925544_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 5
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	974875	1013796	5253712	transposase,capsid,portal,tail,terminase,plate,holin,head,integrase	Enterobacteria_phage(85.37%)	47	973814:973873	1013903:1014026
973814:973873	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078920.1|974875_975016_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_106888220.1|975321_976477_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.3e-67
WP_050439343.1|976474_976735_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_047088266.1|976777_977887_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	9.0e-202
WP_032206883.1|978044_979229_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	1.1e-221
WP_000290443.1|979228_979741_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000665305.1|979795_980161_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_001391627.1|980196_980325_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_106888167.1|981756_982970_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.7e-167
WP_000979946.1|984444_984933_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954200.1|985089_985662_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_032206512.1|985705_986284_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.5	7.7e-96
WP_106888235.1|986283_988287_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.6	9.2e-96
WP_047087591.1|988884_989781_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	1.3e-153
WP_000127182.1|989784_990135_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	7.8e-59
WP_047087590.1|990131_990713_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.8e-100
WP_000356339.1|990709_991345_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001342220.1|991337_991805_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000780555.1|993845_994253_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_047087588.1|994249_994642_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.9e-69
WP_001342221.1|994638_994962_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|994964_995165_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|995164_995659_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632313.1|995760_996561_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.5	6.9e-127
WP_001262679.1|997683_998520_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	5.1e-149
WP_106888236.1|998674_999223_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.0	3.2e-91
WP_106888237.1|1000414_1001716_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	7.0e-230
WP_032206507.1|1001715_1002762_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	1.9e-201
WP_000236495.1|1002776_1003301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224220.1|1003887_1004151_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_032206504.1|1004152_1004572_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	42.6	4.2e-19
WP_000211293.1|1004591_1004906_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000686557.1|1004910_1005870_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	8.4e-180
WP_047087694.1|1005946_1008769_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.9	0.0e+00
WP_032206502.1|1008775_1009141_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.0	2.4e-58
WP_000153684.1|1009282_1009528_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000985145.1|1009524_1009728_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.3e-26
WP_000021668.1|1009814_1009928_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000514281.1|1009924_1010167_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_047087695.1|1010178_1010457_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	82.6	1.3e-35
WP_000739029.1|1010467_1010818_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|1010839_1011043_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|1011114_1011252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|1011341_1011746_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290355.1|1011761_1012412_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|1012441_1012789_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|1012794_1013796_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
1013903:1014026	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 6
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	1043201	1104030	5253712	capsid,portal,tail,terminase,tRNA,holin,head,integrase	Enterobacteria_phage(48.21%)	71	1038663:1038678	1108552:1108567
1038663:1038678	attL	CGCCGCATCCGACAAA	NA	NA	NA	NA
WP_001025342.1|1043201_1044935_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001300190.1|1045150_1045717_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185741.1|1045730_1046477_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214312.1|1046864_1047965_+	cytochrome c	NA	NA	NA	NA	NA
WP_047087700.1|1047989_1050419_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564746.1|1050583_1051555_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1051551_1052295_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1052335_1052731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049768377.1|1052783_1053554_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000362001.1|1053535_1054849_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	97.0	2.8e-250
WP_000073102.1|1054904_1055141_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	98.7	8.4e-41
WP_001030139.1|1055149_1055296_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000492057.1|1055299_1055542_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	2.4e-35
WP_001091864.1|1055573_1055945_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	98.4	3.8e-64
WP_000566773.1|1056562_1056955_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.9	4.7e-36
WP_000002321.1|1057141_1057357_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
WP_000312938.1|1057356_1057716_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.1	1.4e-42
WP_000147365.1|1057915_1058116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106913924.1|1058121_1058814_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	69.2	1.9e-40
WP_000800135.1|1058958_1059648_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	8.0e-116
WP_001399865.1|1059781_1060054_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	89.6	2.1e-35
WP_000867909.1|1060124_1060418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001435006.1|1060537_1061245_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	97.4	1.3e-124
WP_106913925.1|1061353_1062016_+	hypothetical protein	NA	Q8W643	Enterobacteria_phage	82.7	2.8e-97
WP_000626792.1|1062012_1062207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621936.1|1062203_1062437_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	50.0	9.5e-13
WP_001247847.1|1062423_1063317_+	hypothetical protein	NA	C5IHL2	Burkholderia_virus	45.9	2.1e-60
WP_000181080.1|1063334_1064225_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.3	2.6e-82
WP_000184331.1|1064221_1065622_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.8	5.4e-252
WP_042353497.1|1065633_1065876_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	1.6e-34
WP_001215507.1|1065875_1066235_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.3	4.3e-36
WP_000640037.1|1066243_1066798_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	66.9	3.0e-65
WP_001382053.1|1067020_1067218_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.4	2.3e-28
WP_000185911.1|1067368_1068427_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	90.6	1.2e-190
WP_001359877.1|1068885_1069317_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_032362312.1|1069888_1071742_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000284518.1|1071891_1072107_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001041949.1|1072110_1072902_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_001092913.1|1073413_1073947_+	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	6.9e-99
WP_012816791.1|1074465_1074651_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001429103.1|1075192_1075699_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_024182572.1|1075670_1077599_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000259002.1|1077582_1077789_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|1077785_1079378_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_047617627.1|1079367_1080873_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.2	5.1e-99
WP_000256824.1|1080909_1081257_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	6.8e-23
WP_000522591.1|1081314_1082343_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|1082394_1082778_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|1082770_1083124_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974986.1|1083139_1083673_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.2e-58
WP_000683079.1|1083669_1084065_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235112.1|1084072_1084825_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	4.6e-133
WP_000479108.1|1084838_1085270_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533411.1|1085296_1085710_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_047087948.1|1085690_1088252_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	86.8	0.0e+00
WP_000847345.1|1088248_1088578_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152532.1|1088577_1089276_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000140735.1|1089280_1090024_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.4e-144
WP_071790928.1|1089960_1090593_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.1	5.7e-92
WP_032362296.1|1090653_1094133_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_032162956.1|1094199_1094799_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	3.7e-109
WP_032362297.1|1094863_1096177_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_001101700.1|1096178_1096448_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_072097366.1|1097209_1097845_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.3	1.1e-74
WP_001434995.1|1097972_1099031_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144084.1|1099109_1099760_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	40.7	1.1e-37
WP_001132098.1|1099943_1100534_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_099561169.1|1100520_1100643_-	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_001217551.1|1100779_1101028_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	93.9	3.8e-36
WP_000891620.1|1101381_1101948_-	hydrolase	NA	NA	NA	NA	NA
WP_032207789.1|1102257_1104030_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
1108552:1108567	attR	CGCCGCATCCGACAAA	NA	NA	NA	NA
>prophage 7
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	1375008	1403901	5253712	protease,transposase,holin,integrase	Escherichia_phage(47.37%)	31	1379113:1379129	1390617:1390633
WP_001260840.1|1375008_1375830_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1375929_1376013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1376105_1376441_-	acid shock protein	NA	NA	NA	NA	NA
WP_001400365.1|1376837_1378091_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019534.1|1378197_1379091_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1379113:1379129	attL	CCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|1379225_1380446_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1380570_1381266_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|1381218_1382511_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1382669_1383284_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_032207946.1|1383326_1384181_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_077744831.1|1384182_1384737_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	4.1e-62
WP_032207949.1|1384774_1385938_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.5	1.9e-226
WP_001452492.1|1387457_1387826_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	64.2	7.0e-34
WP_000917764.1|1388052_1388250_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_106913927.1|1388388_1389102_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106913928.1|1389911_1391849_+	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.2	0.0e+00
1390617:1390633	attR	CCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000143458.1|1391984_1392164_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106913929.1|1392204_1392477_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	6.3e-24
WP_001072901.1|1392553_1392769_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_106888077.1|1393132_1394345_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_096913359.1|1394311_1394521_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	69.0	1.6e-06
WP_122083109.1|1394527_1394635_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|1394679_1394892_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_047088205.1|1395059_1395338_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_047618481.1|1395339_1396389_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	4.5e-110
WP_001217436.1|1396401_1396773_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_032206343.1|1397287_1398106_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1398392_1398632_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_096913342.1|1399040_1399439_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106888076.1|1400205_1402059_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_106888077.1|1402687_1403901_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 8
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	1623253	1867927	5253712	transposase,capsid,portal,terminase,tRNA,holin,lysis,tail,protease,head,integrase	Escherichia_phage(44.7%)	248	1792542:1792564	1804133:1804155
WP_106888085.1|1623253_1624409_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_001365271.1|1625450_1626992_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_032206830.1|1627139_1628201_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_032206832.1|1628197_1629595_-	YcjX family protein	NA	NA	NA	NA	NA
WP_000075378.1|1629749_1630748_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206834.1|1630858_1631764_-	monomeric porin OmpG	NA	NA	NA	NA	NA
WP_032206836.1|1631808_1632891_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
WP_000775790.1|1632904_1633564_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_001299974.1|1635824_1636880_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000690242.1|1636889_1637678_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_047087595.1|1637695_1638748_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032206838.1|1638778_1639621_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_032206839.1|1639607_1640489_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000597447.1|1640509_1641802_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000810500.1|1641815_1643495_-	sugar phosphorylase	NA	NA	NA	NA	NA
WP_000473109.1|1643706_1644021_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_000907387.1|1644325_1644685_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_001274963.1|1644684_1644909_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_000511025.1|1644962_1645631_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_047087598.1|1645797_1646775_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_000069226.1|1646892_1648158_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
WP_032206842.1|1648195_1649476_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_047087596.1|1649477_1650956_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_047087597.1|1651105_1651663_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_001300506.1|1651689_1652454_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_001298814.1|1652665_1654084_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_120795382.1|1654232_1654397_+	protein YmjE	NA	NA	NA	NA	NA
WP_024225995.1|1654386_1655772_+	putrescine/proton symporter PuuP	NA	NA	NA	NA	NA
WP_001015110.1|1655905_1656151_+	YmjA family protein	NA	NA	NA	NA	NA
WP_001250213.1|1656463_1658107_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_000583277.1|1658103_1659069_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_106913932.1|1663189_1664346_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888078.1|1665813_1666969_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_032208661.1|1666980_1667526_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_032208663.1|1667569_1669615_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1669751_1670498_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_032208665.1|1670586_1671273_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047088181.1|1671450_1671654_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	1.0e-10
WP_047088180.1|1671689_1673150_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	1.1e-42
WP_041520817.1|1673238_1674522_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|1674581_1674896_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001121225.1|1675490_1676141_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491544.1|1676365_1677241_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.9	9.7e-159
WP_047087983.1|1677380_1677650_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	95.5	1.6e-43
WP_106888086.1|1677651_1678974_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.9	7.0e-76
WP_001230472.1|1679038_1679638_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	3.7e-109
WP_106913933.1|1679704_1683184_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.1	0.0e+00
WP_148936170.1|1683424_1684054_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	98.6	1.7e-109
WP_047087946.1|1683999_1684743_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.2	5.4e-150
WP_001365123.1|1684753_1685452_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_000847298.1|1685451_1685781_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|1688371_1688785_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|1688811_1689234_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|1689247_1690000_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_047088190.1|1690007_1690403_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	91.6	8.2e-65
WP_000975099.1|1690399_1690978_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_047088187.1|1690989_1691343_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000158897.1|1691354_1691750_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1691791_1692817_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_047088185.1|1692872_1693205_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	9.3e-54
WP_033805059.1|1693214_1694534_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001415980.1|1694514_1696116_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000198153.1|1696112_1696319_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_047088184.1|1696315_1698241_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000867498.1|1698215_1698761_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001329960.1|1699147_1699333_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|1699465_1699606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082561.1|1699956_1700424_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	77.4	2.8e-56
WP_001092861.1|1700722_1701256_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	5.3e-99
WP_024231374.1|1701298_1701856_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	84.6	7.8e-53
WP_000284516.1|1701859_1702075_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_106888088.1|1702224_1704078_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000301787.1|1704883_1705597_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074433665.1|1705731_1705929_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	93.8	1.4e-25
WP_047087676.1|1706710_1707070_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.2	2.4e-39
WP_106888090.1|1707082_1708132_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_032147304.1|1708133_1708412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1708478_1708730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1708946_1709159_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_047087674.1|1709659_1710757_+	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.5	2.8e-211
WP_001204666.1|1710716_1711295_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_001002672.1|1711600_1711912_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_000004322.1|1711904_1712159_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_136757765.1|1712619_1713585_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.3	2.2e-58
WP_000705376.1|1713565_1714087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921592.1|1714070_1714298_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381213.1|1714378_1714786_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_000379563.1|1714953_1715106_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000394548.1|1715117_1715756_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1715756_1715966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1716529_1716718_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_047088226.1|1720278_1721073_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	95.5	3.5e-131
WP_000738505.1|1721481_1721775_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_106888092.1|1721806_1722271_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	83.8	3.4e-62
WP_000455406.1|1722278_1722428_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|1722427_1722997_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_106888093.1|1723271_1723805_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	99.4	5.1e-102
WP_001072901.1|1723809_1724025_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|1724102_1724348_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|1724388_1724568_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106888094.1|1724704_1726642_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	99.1	0.0e+00
WP_000738068.1|1727127_1727397_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|1727408_1728368_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|1728750_1728903_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204844.1|1729151_1729586_-	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_000144764.1|1729578_1729773_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001187434.1|1729769_1730333_-	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000402090.1|1730340_1730790_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	98.0	1.0e-79
WP_001193569.1|1730789_1731761_-	DNA primase	NA	A0A0H4IPK0	Shigella_phage	96.6	3.8e-188
WP_047087940.1|1731750_1733271_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	99.0	2.3e-304
WP_032207142.1|1733264_1733642_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	99.2	1.2e-60
WP_077744819.1|1733808_1734003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|1734173_1734377_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|1734472_1735186_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_032207143.1|1735280_1736750_+	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	100.0	2.7e-286
WP_032207145.1|1736746_1737700_+	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	99.7	3.5e-186
WP_106913935.1|1738202_1739099_+	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	71.6	1.5e-98
WP_000917252.1|1739169_1739382_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|1739393_1739675_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_047087942.1|1739695_1739977_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	98.9	5.5e-47
WP_000157000.1|1742153_1742357_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476217.1|1742349_1742589_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_001303141.1|1742585_1743533_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_001301469.1|1743534_1744041_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|1744000_1744216_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|1744217_1744436_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|1744437_1744725_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206752.1|1744728_1745352_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_001451754.1|1745613_1746183_+	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_001302866.1|1746225_1746531_-	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451755.1|1746619_1746817_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001260979.1|1746945_1747203_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	4.2e-38
WP_000211992.1|1747527_1748205_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_000809302.1|1748260_1748692_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_032206818.1|1748688_1749315_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	99.5	4.0e-122
WP_001291843.1|1749274_1749487_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_001441720.1|1749522_1749894_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	89.4	9.8e-52
WP_000497812.1|1750258_1750510_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001563185.1|1750563_1750806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206827.1|1750769_1751957_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	4.6e-119
WP_047087716.1|1752133_1753024_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001128858.1|1753023_1754016_+	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_000573407.1|1754017_1754824_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_074433631.1|1754891_1755245_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1755612_1756401_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_032206815.1|1756545_1757673_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|1757740_1759675_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000221855.1|1759752_1759857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087717.1|1759910_1761896_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_047087718.1|1762042_1762216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087719.1|1762305_1763055_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032206812.1|1763323_1763542_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001295580.1|1763667_1763994_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176278.1|1763993_1764731_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_032206811.1|1764923_1766093_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876286.1|1766099_1766408_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256538.1|1766556_1767321_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|1767490_1768081_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_047087720.1|1768144_1770820_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|1770983_1771079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297116.1|1771192_1771360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295577.1|1771362_1771491_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_032206809.1|1771821_1772796_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_032206808.1|1773005_1775603_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.0e-86
WP_001031530.1|1775982_1776234_+	YciN family protein	NA	NA	NA	NA	NA
WP_032206807.1|1776269_1777319_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	6.0e-22
WP_032206806.1|1777538_1778297_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	5.2e-07
WP_001278904.1|1778293_1778884_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1778923_1779796_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1779896_1780517_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_032206803.1|1780513_1781395_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1781532_1781577_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_032206802.1|1781668_1783231_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1783230_1784826_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_032206824.1|1784829_1786188_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	5.0e-37
WP_000209521.1|1786199_1787393_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443055.1|1787392_1788199_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1788579_1788759_+	general stress protein	NA	NA	NA	NA	NA
WP_047087721.1|1789390_1789897_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000692020.1|1790934_1791525_-	protein kinase	NA	NA	NA	NA	NA
1792542:1792564	attL	CCTGTTTAGGATTCTGTGTAAAT	NA	NA	NA	NA
WP_001023986.1|1792658_1792928_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_106888078.1|1793132_1794288_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_032208325.1|1794382_1794607_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	5.0e-19
WP_001302717.1|1794688_1795003_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_129014757.1|1795527_1795713_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	4.9e-20
WP_106888077.1|1795973_1797186_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106888096.1|1797152_1797368_+	excisionase	NA	A0A0N7BTS3	Escherichia_phage	80.6	3.6e-06
WP_047088277.1|1797345_1798476_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
WP_071532495.1|1798963_1799182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888078.1|1799682_1800839_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888098.1|1801021_1802295_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001303943.1|1802724_1803003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|1804170_1804740_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
1804133:1804155	attR	ATTTACACAGAATCCTAAACAGG	NA	NA	NA	NA
WP_000935464.1|1804805_1805444_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	76.9	5.4e-82
WP_106888099.1|1805631_1806793_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_047088109.1|1807697_1809020_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.1	1.2e-221
WP_001023396.1|1810250_1810520_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001007905.1|1813062_1813413_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|1813422_1813749_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_060552847.1|1813745_1814267_-|portal	portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	96.4	1.5e-74
WP_097746533.1|1814340_1815496_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000737224.1|1815893_1816532_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028540.1|1816888_1817632_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|1817661_1818201_+	septation protein A	NA	NA	NA	NA	NA
WP_032206794.1|1818305_1818704_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_047088212.1|1818743_1819463_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_106888102.1|1819917_1821131_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	7.1e-168
WP_047087680.1|1822014_1822566_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.0	1.4e-25
WP_052846688.1|1823128_1823806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967595.1|1824157_1824454_+	YciI family protein	NA	NA	NA	NA	NA
WP_001299682.1|1824753_1826007_+	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_001309467.1|1826061_1826235_-	YciY family protein	NA	NA	NA	NA	NA
WP_032208505.1|1826377_1827838_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_000366959.1|1827872_1828202_+	YciU family protein	NA	NA	NA	NA	NA
WP_000994905.1|1828254_1829259_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_032208507.1|1829255_1830269_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	9.0e-15
WP_000979648.1|1830280_1831189_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000911112.1|1831203_1832124_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_032208522.1|1832209_1833841_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000616554.1|1834578_1835226_-	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_000301651.1|1835702_1838378_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000068079.1|1838679_1839297_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|1839901_1840315_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|1840457_1841366_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|1841567_1842581_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|1842672_1843578_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_047087681.1|1843690_1844149_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|1844198_1845041_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_106913936.1|1845647_1846325_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|1846324_1847035_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|1847031_1848570_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000032935.1|1848566_1852310_-	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000019827.1|1852825_1854217_-	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_000918073.1|1854555_1856352_+	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	NA	NA	NA	NA
WP_000070491.1|1856344_1856995_+	two-component system response regulator NarL	NA	NA	NA	NA	NA
WP_000086217.1|1856995_1858390_-	inverse autotransporter invasin YchO	NA	NA	NA	NA	NA
WP_001169669.1|1858574_1858928_+	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_001336325.1|1858971_1859667_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001146440.1|1859824_1860055_-	putative cation transport regulator ChaB	NA	NA	NA	NA	NA
WP_001295620.1|1860324_1861425_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000170965.1|1861829_1861937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170926.1|1862365_1862473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000811065.1|1862621_1863476_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|1863511_1864321_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|1864324_1864717_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|1864713_1865547_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_024226915.1|1865546_1866629_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000173200.1|1866670_1867927_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	1873127	1990979	5253712	transposase,portal,terminase,tRNA,holin,protease,tail,integrase	Enterobacteria_phage(33.33%)	123	1878278:1878296	1958382:1958400
WP_032208512.1|1873127_1873712_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_032208514.1|1873828_1874920_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_047087684.1|1875687_1878555_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
1878278:1878296	attL	GTGCCAGCATGATACTGGG	NA	NA	NA	NA
WP_047087685.1|1878654_1880574_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_047087686.1|1880801_1881872_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059411.1|1881882_1882515_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_047087687.1|1882525_1883944_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_047087688.1|1884263_1885961_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000615067.1|1886039_1886480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511313.1|1886657_1886912_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020161.1|1887112_1887847_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|1887848_1888460_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051582.1|1888559_1889474_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|1889568_1891305_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197825.1|1891691_1892762_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|1892771_1894070_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190854.1|1894399_1895932_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|1895983_1896703_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|1896923_1898465_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|1898610_1899141_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_032208520.1|1899186_1900455_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	3.3e-208
WP_000897378.1|1900454_1900874_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_106888101.1|1901101_1902088_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|1902362_1902824_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|1902900_1903560_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001297679.1|1903631_1903925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695223.1|1904162_1904564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056860.1|1904671_1905040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|1905559_1906255_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|1906278_1907091_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|1907094_1907361_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_097746533.1|1907502_1908659_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_085972493.1|1910693_1911966_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_032141808.1|1912305_1912416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|1912948_1913272_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_074433656.1|1913374_1913527_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.0	2.4e-20
WP_047087952.1|1914006_1914444_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|1914468_1915053_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201825.1|1915551_1916505_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_047088067.1|1916691_1918176_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032207501.1|1918359_1918665_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_136800952.1|1918721_1919390_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|1919887_1920070_+	general stress protein	NA	NA	NA	NA	NA
WP_001546534.1|1920148_1920649_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_047088062.1|1920685_1921192_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_032206875.1|1921210_1922101_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_071887470.1|1922220_1922640_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.0	1.7e-68
WP_106888170.1|1922720_1923934_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.6e-167
WP_000067727.1|1924057_1924273_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_106888103.1|1924347_1925043_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	7.3e-133
WP_001207141.1|1925093_1925528_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_032207131.1|1926280_1926553_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	9.7e-41
WP_032207130.1|1926837_1927287_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.3e-69
WP_047088220.1|1927482_1927851_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_001198861.1|1927923_1928088_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|1928056_1928200_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995409.1|1928275_1928572_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001438244.1|1928577_1929363_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_032207488.1|1929359_1930040_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	7.9e-132
WP_000682319.1|1930036_1930198_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_047088208.1|1930190_1930748_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	61.7	3.9e-60
WP_001386642.1|1930758_1931040_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|1931138_1931357_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_032207484.1|1931404_1931605_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.5	4.2e-33
WP_085972493.1|1931648_1932921_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000088653.1|1933119_1933356_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|1933345_1934488_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_032206978.1|1934589_1935840_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	2.5e-22
WP_032206979.1|1936011_1936665_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|1936674_1937136_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_032206981.1|1937189_1938296_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1938331_1938973_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_047087388.1|1938976_1940347_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	9.4e-108
WP_001265481.1|1940515_1941187_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|1941186_1942647_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|1942722_1943844_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|1943892_1945119_-	peptidase T	NA	NA	NA	NA	NA
WP_032206984.1|1945368_1946505_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799400.1|1946488_1947352_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_047088273.1|1949026_1950388_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023445.1|1950842_1951112_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_106913937.1|1951113_1952427_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	3.7e-77
WP_106888078.1|1953107_1954263_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888169.1|1954424_1957904_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.1	0.0e+00
WP_122993104.1|1958149_1958782_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	3.4e-105
1958382:1958400	attR	CCCAGTATCATGCTGGCAC	NA	NA	NA	NA
WP_106888107.1|1960210_1960783_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.3e-103
WP_106888108.1|1960788_1961487_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	5.2e-131
WP_000847298.1|1961486_1961816_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021351599.1|1961812_1964458_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.9	0.0e+00
WP_000532075.1|1964501_1964810_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_106913938.1|1964836_1965250_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	95.7	6.4e-68
WP_047087667.1|1965265_1966015_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	5.6e-131
WP_047087668.1|1966022_1966421_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	1.1e-69
WP_000974958.1|1966433_1967057_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281346.1|1967059_1967341_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_001097065.1|1967333_1967660_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_122993092.1|1967747_1969727_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.6	0.0e+00
WP_047087669.1|1969716_1971219_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.4	8.5e-288
WP_139840281.1|1971218_1971431_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	3.3e-28
WP_001077625.1|1971427_1973551_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|1973547_1974024_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_032207063.1|1974443_1974668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|1974753_1974939_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032207060.1|1975456_1975993_-	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	4.5e-98
WP_074433498.1|1976029_1977019_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.1	7.5e-107
WP_000284518.1|1977023_1977239_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290231.1|1977315_1977588_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|1977628_1977808_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106913939.1|1977944_1979891_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.8	0.0e+00
WP_047087938.1|1980773_1981595_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	57.9	1.8e-77
WP_032207210.1|1981591_1981966_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	1.3e-35
WP_032206341.1|1983028_1983301_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	51.5	5.5e-12
WP_032206337.1|1983422_1983767_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	98.2	1.4e-55
WP_000887477.1|1983886_1984099_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|1984287_1984392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118161.1|1985149_1985545_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_032206335.1|1985560_1986286_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.2	2.0e-77
WP_032206334.1|1986307_1987054_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	1.1e-113
WP_106913940.1|1987060_1988131_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693928.1|1988202_1988628_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|1988611_1988935_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|1989059_1989536_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001113310.1|1990511_1990979_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
>prophage 10
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	2140578	2194014	5253712	transposase,capsid,portal,head,terminase,holin,protease,tail,integrase	Enterobacteria_phage(36.17%)	63	2145252:2145311	2193089:2193153
WP_000003671.1|2140578_2141166_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|2141162_2141870_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2141888_2143682_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2143678_2144797_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
2145252:2145311	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_072278860.1|2145913_2146384_+	EspF protein	NA	NA	NA	NA	NA
WP_001023379.1|2146509_2146779_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_106913942.1|2146780_2148094_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_106913943.1|2148158_2148758_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	98.5	1.4e-108
WP_047087988.1|2148825_2152221_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
WP_000090891.1|2152281_2152914_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_047087989.1|2152850_2153594_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152619.1|2153599_2154298_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847347.1|2154297_2154627_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_047087991.1|2154623_2157185_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.0	0.0e+00
WP_000459457.1|2157177_2157612_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|2157593_2158016_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|2158031_2158772_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_032207007.1|2158779_2159175_-	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	91.6	1.3e-65
WP_000975037.1|2159171_2159747_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|2159761_2160115_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|2160107_2160482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|2160533_2161562_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|2161619_2161967_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001254039.1|2162003_2163509_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|2163498_2165091_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|2165087_2165294_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_032207005.1|2165277_2167206_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.1e-262
WP_000235436.1|2167177_2167687_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|2168089_2168314_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_012816791.1|2169237_2169423_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|2169644_2169758_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003111.1|2169978_2170512_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000138558.1|2170671_2170944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|2171199_2171406_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_106913944.1|2171851_2173702_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001344632.1|2174144_2174276_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_047088297.1|2174872_2175694_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|2175690_2176065_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_106888130.1|2176077_2177127_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	5.5e-108
WP_032207160.1|2177128_2177407_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_000284536.1|2177839_2178316_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_001219082.1|2178318_2178678_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000128514.1|2178922_2179135_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001278459.1|2179322_2179427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032206192.1|2179536_2180370_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	65.7	5.5e-26
WP_032206194.1|2180405_2180618_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	1.7e-32
WP_032206196.1|2180663_2181023_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_047087727.1|2181076_2181502_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	5.7e-64
WP_106888131.1|2181542_2182613_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	8.5e-64
WP_000693918.1|2182684_2183110_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048459.1|2183106_2183370_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021568728.1|2183477_2183978_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.8e-16
WP_000108762.1|2183995_2184187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021568727.1|2184186_2184477_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000367377.1|2184751_2184904_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000373334.1|2185002_2185449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2186161_2186350_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2186346_2186538_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_099357990.1|2189174_2189378_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106888078.1|2189439_2190595_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888078.1|2191199_2192356_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888132.1|2192371_2192947_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.8	5.1e-47
WP_000375138.1|2193354_2194014_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2193089:2193153	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 11
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	2235954	2390598	5253712	transposase,capsid,portal,terminase,tRNA,holin,plate,lysis,tail,protease,head,integrase	Escherichia_phage(33.33%)	164	2368261:2368277	2391276:2391292
WP_000117881.1|2235954_2237355_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|2237956_2239045_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|2239229_2240420_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032206222.1|2240641_2241289_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|2241315_2241864_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_032206223.1|2242044_2243892_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_047087209.1|2244152_2248613_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|2248612_2249317_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|2249297_2250620_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001297198.1|2250616_2251402_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899591.1|2251537_2252317_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|2252293_2253187_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011603.1|2253340_2254087_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|2254083_2254266_-	protein YcaR	NA	NA	NA	NA	NA
WP_032206226.1|2254317_2255550_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032206228.1|2255586_2256573_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|2256569_2258318_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_001432609.1|2259688_2260219_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	4.8e-36
WP_001310454.1|2260409_2260658_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289291.1|2260659_2262750_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.1	5.7e-165
WP_000129790.1|2262821_2263754_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|2263756_2263978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|2263990_2264245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2264246_2264528_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|2264524_2264797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|2264801_2265095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|2265106_2265637_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|2265734_2266277_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000564281.1|2266280_2266814_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000465562.1|2266813_2267329_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973021.1|2267332_2267884_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000595948.1|2267880_2268066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021231.1|2268104_2268437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086882.1|2268429_2268627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370523.1|2268616_2268913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214359.1|2268909_2269419_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	2.0e-26
WP_000852377.1|2269488_2269914_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|2269985_2270486_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|2270520_2270949_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122255.1|2270932_2271151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|2271161_2271389_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270158.1|2271369_2271681_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279083.1|2271673_2271964_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360582.1|2271966_2272548_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	56.8	5.5e-49
WP_001057670.1|2272547_2274212_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	2.4e-230
WP_000532587.1|2274211_2275801_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	8.5e-169
WP_000046906.1|2275784_2277116_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	2.7e-152
WP_000094812.1|2277237_2277711_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_000850817.1|2277887_2279012_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	1.3e-78
WP_001142982.1|2279011_2279959_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_044723557.1|2280002_2280428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104959.1|2280424_2280844_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	1.8e-33
WP_000627428.1|2280840_2281401_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	48.3	1.6e-42
WP_000848437.1|2281401_2281647_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606748.1|2281643_2283146_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.5	1.5e-138
WP_000015473.1|2283154_2283520_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|2283534_2284011_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|2284137_2286213_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146118.1|2286199_2287549_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000098808.1|2287532_2288657_+	hypothetical protein	NA	C9DGQ3	Escherichia_phage	48.5	7.7e-92
WP_000980532.1|2288646_2289261_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|2289253_2289691_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|2289690_2290773_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|2290763_2291324_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_062875392.1|2291323_2292235_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	42.2	1.5e-29
WP_062875395.1|2292269_2292791_-|tail	phage tail protein	tail	A0A0U2QV64	Escherichia_phage	52.0	1.7e-46
WP_074433614.1|2292870_2293074_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000904930.1|2293295_2293856_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|2293955_2295995_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|2296141_2296324_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114107.1|2296359_2296605_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_032164298.1|2297223_2297409_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000527074.1|2297377_2298430_+	DNA cytosine methyltransferase	NA	H9C177	Pectobacterium_phage	63.7	4.1e-119
WP_000167336.1|2299984_2300269_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|2300428_2302102_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|2302212_2302896_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|2303068_2303833_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445231.1|2304001_2305285_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057136.1|2305355_2306444_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000642849.1|2306642_2307335_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|2307464_2309225_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|2309630_2310488_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292815.1|2310542_2312825_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000468308.1|2313143_2313362_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_047087210.1|2313443_2314607_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	4.5e-204
WP_047087211.1|2314606_2315086_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.1e-83
WP_047087212.1|2315100_2317548_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.8	0.0e+00
WP_000785970.1|2317540_2317660_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2317692_2317968_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2318024_2318543_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_047087213.1|2318555_2319746_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
WP_000257039.1|2320004_2321348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032206234.1|2321629_2322157_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	96.0	5.2e-91
WP_032206237.1|2324479_2325010_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	1.9e-101
WP_032206238.1|2325002_2325911_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	7.5e-162
WP_032206239.1|2325915_2326263_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	98.3	5.5e-57
WP_001093707.1|2326259_2326895_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	4.1e-114
WP_047087216.1|2326978_2327764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206240.1|2327835_2328288_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	3.8e-74
WP_047087217.1|2328280_2328748_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	6.7e-82
WP_001300730.1|2328710_2328884_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_047087218.1|2328855_2329281_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.0	5.2e-65
WP_032206243.1|2329268_2329703_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	87.5	7.2e-54
WP_001530534.1|2329717_2330215_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_000123123.1|2330214_2330496_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_032206246.1|2330499_2330703_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	4.4e-30
WP_000988633.1|2330702_2331212_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_047087220.1|2331311_2332055_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_047087221.1|2332058_2333132_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	2.8e-200
WP_032206252.1|2333190_2334045_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.1	2.4e-130
WP_047087222.1|2334218_2335991_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_047087223.1|2335990_2337025_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	3.5e-200
WP_106888135.1|2337507_2338811_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_106888136.1|2338829_2339729_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	79.7	5.5e-133
WP_047087442.1|2339802_2340009_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	88.1	7.1e-28
WP_047087441.1|2340008_2340452_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	93.2	6.8e-76
WP_032208021.1|2342734_2343010_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	97.8	2.5e-44
WP_001113264.1|2343006_2343231_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277958.1|2343230_2343533_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_032208023.1|2343532_2343757_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	8.8e-32
WP_032208026.1|2343820_2344321_-	hypothetical protein	NA	M1SV55	Escherichia_phage	98.8	3.8e-91
WP_032208029.1|2344587_2344794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208031.1|2344796_2345393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024240191.1|2345402_2345759_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	81.9	5.1e-50
WP_024182500.1|2345862_2346162_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	79.8	3.8e-38
WP_047087439.1|2346255_2347251_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.1	2.3e-188
WP_000067977.1|2347282_2348080_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190367.1|2348161_2348752_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_032208033.1|2348851_2349760_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000109295.1|2351400_2352549_-	MFS transporter	NA	NA	NA	NA	NA
WP_032208034.1|2352862_2353489_+	hydrolase	NA	NA	NA	NA	NA
WP_047087438.1|2353523_2354387_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|2354388_2355006_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|2355016_2357461_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|2357698_2358991_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067756.1|2359082_2360426_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_001295343.1|2360436_2361048_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_047087437.1|2361202_2365270_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2365404_2365899_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2366443_2367409_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_047087436.1|2367531_2369298_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	1.6e-22
2368261:2368277	attL	CGGCTGGCATTTTTATC	NA	NA	NA	NA
WP_001202188.1|2369298_2371020_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_032208045.1|2371061_2371766_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2372050_2372269_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_047087435.1|2373012_2375289_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	7.4e-166
WP_000520781.1|2375319_2375640_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_047087434.1|2376534_2376816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113648.1|2378473_2378830_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145908.1|2379118_2379559_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.8	7.8e-56
WP_000134111.1|2379558_2379855_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_016241300.1|2379851_2380190_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	2.5e-30
WP_122993077.1|2380186_2381362_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	1.1e-184
WP_001475696.1|2381399_2381957_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_001475695.1|2382012_2383170_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.6e-137
WP_001475693.1|2383466_2383691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166342.1|2383816_2384089_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_047087431.1|2384099_2384510_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001475690.1|2384506_2384752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032208060.1|2386852_2387152_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032208062.1|2387158_2387479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918783.1|2387471_2387798_-	host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	55.7	1.7e-07
WP_032208063.1|2388203_2388383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206970.1|2388731_2388941_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_032208065.1|2389359_2390598_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	1.8e-126
2391276:2391292	attR	CGGCTGGCATTTTTATC	NA	NA	NA	NA
>prophage 12
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	2506479	2517095	5253712	protease,tail,transposase,holin	Enterobacteria_phage(50.0%)	12	NA	NA
WP_032208109.1|2506479_2507178_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|2507408_2508290_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|2508458_2508620_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_001592261.1|2509115_2510135_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_085972493.1|2510365_2511638_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_060552816.1|2512644_2512800_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	1.1e-17
WP_106888078.1|2512827_2513984_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888139.1|2514394_2514610_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	6.5e-32
WP_033816266.1|2514752_2515151_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2515231_2515390_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2515475_2516219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|2516471_2517095_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
>prophage 13
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	2733869	2772911	5253712	protease,transposase,tail	Escherichia_phage(41.67%)	44	NA	NA
WP_060552810.1|2733869_2735006_+|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_047088070.1|2735447_2737514_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_047088069.1|2737500_2740473_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|2740473_2741364_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001599523.1|2741546_2742308_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201825.1|2742819_2743773_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_047088067.1|2743959_2745444_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032207501.1|2745627_2745933_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_136800952.1|2745989_2746658_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077744828.1|2746737_2747076_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.9	3.7e-05
WP_106888077.1|2747823_2749036_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106888146.1|2749002_2749197_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	73.0	3.8e-07
WP_106888147.1|2749460_2751311_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_047087898.1|2751804_2752233_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.4	1.4e-62
WP_047087897.1|2752599_2752752_-	DNA methylase	NA	A0A0N7C2V5	Escherichia_phage	96.0	1.5e-19
WP_032207072.1|2753077_2753998_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	86.5	1.5e-64
WP_032207073.1|2754113_2754944_-	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	80.4	6.7e-117
WP_032207075.1|2755086_2755449_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	98.3	8.6e-61
WP_000002243.1|2755445_2755736_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_047087894.1|2755735_2756458_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	98.8	5.6e-128
WP_000290552.1|2756532_2757210_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	98.7	1.5e-127
WP_029784131.1|2757484_2757646_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	98.1	3.4e-25
WP_000153280.1|2757662_2758190_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_024219806.1|2758186_2758627_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	9.1e-81
WP_047087893.1|2758700_2758991_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	97.9	1.8e-45
WP_001510925.1|2758987_2759689_-	replication P family protein	NA	Q6H9X6	Enterobacteria_phage	99.6	1.7e-129
WP_047087890.1|2759685_2760585_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.7	2.9e-174
WP_032208418.1|2761924_2762227_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	97.8	3.3e-42
WP_000067727.1|2762368_2762584_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2762659_2763355_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000885926.1|2763364_2763706_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_032208417.1|2763773_2764235_+	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	3.8e-77
WP_032207131.1|2765874_2766147_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	9.7e-41
WP_032207130.1|2766205_2766655_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.3e-69
WP_047088220.1|2766850_2767219_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_001198861.1|2767291_2767456_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2767424_2767568_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995409.1|2767643_2767940_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|2767945_2768731_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186792.1|2768727_2769408_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_071887448.1|2769398_2769515_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	84.4	1.0e-07
WP_106888149.1|2769517_2770731_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	4.6e-167
WP_106888078.1|2771039_2772196_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_157911293.1|2772743_2772911_+	hypothetical protein	NA	A0A088CD23	Shigella_phage	81.8	5.8e-20
>prophage 14
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	3530711	3606438	5253712	protease,transposase,tRNA	Vibrio_phage(13.33%)	57	NA	NA
WP_000811566.1|3530711_3530987_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|3531103_3532729_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943982.1|3532812_3533976_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|3533978_3534617_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|3534626_3535025_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000511955.1|3535752_3536451_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|3536469_3536871_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_032208299.1|3536995_3537727_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_047087583.1|3537907_3540349_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	8.4e-67
WP_001177639.1|3540387_3540813_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3541017_3542316_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089294.1|3542419_3542617_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3542698_3543703_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3543705_3544965_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|3545050_3546331_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3546407_3546716_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032208303.1|3546801_3547752_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122503.1|3547744_3549592_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990262.1|3549601_3550936_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|3550954_3551416_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_072097076.1|3551387_3552935_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|3552933_3554073_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|3554055_3554109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|3554971_3555517_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|3555611_3556664_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934912.1|3556760_3557729_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_032208306.1|3557750_3561074_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_032208307.1|3561224_3562727_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|3562945_3563923_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|3564247_3566056_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|3566048_3566783_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|3566793_3567189_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|3567199_3567559_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001238369.1|3568844_3569378_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3569374_3569692_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3569866_3570013_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|3570123_3570249_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3570300_3570867_-	elongation factor P	NA	NA	NA	NA	NA
WP_032208308.1|3570908_3571937_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_032208310.1|3572326_3573196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|3573398_3573752_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3573889_3575536_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3575579_3575873_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_032208312.1|3576149_3577406_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|3577421_3577898_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|3578234_3579671_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3579788_3581090_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|3581205_3581544_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_032208314.1|3581519_3583217_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_032208316.1|3583253_3583829_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_085947598.1|3584934_3586097_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_106888166.1|3586343_3587616_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	3.7e-175
WP_001121622.1|3588467_3590117_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000953023.1|3590724_3591714_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
WP_047087560.1|3591762_3592437_+	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_047087561.1|3594311_3603983_+	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_106888167.1|3605225_3606438_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.7e-167
>prophage 15
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	3684619	3733233	5253712	transposase,capsid,head,terminase,tRNA,lysis,holin,tail,integrase	Stx2-converting_phage(39.53%)	54	3719264:3719278	3726776:3726790
WP_000918363.1|3684619_3686035_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|3686117_3687101_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|3687266_3687509_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_072176623.1|3687642_3688680_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332258.1|3688768_3689866_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_047087753.1|3689927_3690176_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	97.6	1.7e-36
WP_001143783.1|3690336_3690978_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	1.3e-107
WP_072140863.1|3691059_3691689_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118085.1|3691756_3692338_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001023445.1|3692448_3692718_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_106913951.1|3692719_3694024_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	86.9	5.7e-70
WP_106888169.1|3694753_3698233_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.1	0.0e+00
WP_122993104.1|3698478_3699111_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	3.4e-105
WP_047088113.1|3699056_3699800_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.5	6.8e-145
WP_047088114.1|3699810_3700509_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	1.4e-131
WP_000807944.1|3700508_3700850_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_060552897.1|3700842_3704085_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.6	0.0e+00
WP_122993099.1|3704132_3704342_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_106913952.1|3704437_3704812_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275477.1|3704817_3705534_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	1.9e-128
WP_000133391.1|3705600_3705945_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|3705941_3706388_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3706384_3706735_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3706744_3707071_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_032274028.1|3709111_3709333_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	9.9e-36
WP_047087555.1|3709377_3711318_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	96.6	0.0e+00
WP_000562896.1|3713651_3714575_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_001229493.1|3714737_3715226_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_001018603.1|3715353_3715515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435078.1|3715517_3715712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103951510.1|3715842_3716082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806546.1|3716369_3718187_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.4	1.7e-128
WP_001261503.1|3718183_3718483_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000543812.1|3718489_3718810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106913953.1|3718802_3719198_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001156588.1|3719151_3719334_+	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
3719264:3719278	attL	ATTTCAGTTCATGGG	NA	NA	NA	NA
WP_100036487.1|3719793_3719925_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	66.7	9.7e-07
WP_044697522.1|3719983_3720190_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_100036486.1|3720202_3721438_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	34.8	6.3e-63
WP_024224188.1|3722730_3723096_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	97.5	5.4e-63
WP_000095741.1|3723137_3723338_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_001283921.1|3723630_3723888_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|3723884_3724382_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|3724584_3725022_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135289.1|3725018_3725516_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000411802.1|3725515_3725722_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_060552899.1|3726014_3727865_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
3726776:3726790	attR	CCCATGAACTGAAAT	NA	NA	NA	NA
WP_001490213.1|3728435_3728867_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	99.3	7.8e-69
WP_047619196.1|3729056_3729266_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.7e-19
WP_106888170.1|3729369_3730582_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.6e-167
WP_001014286.1|3731483_3731672_+	hypothetical protein	NA	G9L660	Escherichia_phage	92.1	2.2e-23
WP_047087994.1|3731674_3732343_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.6	5.5e-61
WP_001061348.1|3732342_3732915_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	1.2e-109
WP_001093921.1|3732951_3733233_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
>prophage 16
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	4172531	4178203	5253712		Enterobacteria_phage(100.0%)	7	NA	NA
WP_047087656.1|4172531_4174865_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_032207431.1|4174879_4175200_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_047087655.1|4175335_4175791_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.4e-63
WP_060552904.1|4175783_4176071_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	94.7	2.1e-46
WP_047087654.1|4176063_4176654_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	88.8	3.5e-59
WP_001149160.1|4176650_4176917_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032207427.1|4177468_4178203_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	5.2e-129
>prophage 17
NZ_CP027459	Escherichia coli strain 90-3040 chromosome, complete genome	5253712	4868553	4938284	5253712	protease,transposase	Acinetobacter_phage(28.57%)	53	NA	NA
WP_106888186.1|4868553_4869710_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_047087345.1|4869771_4869993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013149.1|4870192_4871020_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_001058807.1|4871124_4872288_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000817717.1|4872481_4873381_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032205977.1|4874220_4875408_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_000527844.1|4875659_4876394_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_001240712.1|4876400_4876826_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_032205976.1|4877097_4877982_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	1.1e-64
WP_000439331.1|4878172_4878667_+	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_047087342.1|4878706_4879747_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_047087340.1|4879903_4880791_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_001059136.1|4880909_4881197_+	DUF2623 domain-containing protein	NA	NA	NA	NA	NA
WP_000145410.1|4881385_4882504_+	hydrogenase 2 small subunit	NA	NA	NA	NA	NA
WP_001081870.1|4882506_4883493_+	hydrogenase 2 operon protein HybA	NA	NA	NA	NA	NA
WP_000017703.1|4883482_4884661_+	Ni/Fe-hydrogenase cytochrome b subunit	NA	NA	NA	NA	NA
WP_047087338.1|4884657_4886361_+	hydrogenase 2 large subunit	NA	NA	NA	NA	NA
WP_032205973.1|4886360_4886855_+	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_000134014.1|4886847_4887336_+	hydrogenase-2 assembly chaperone	NA	NA	NA	NA	NA
WP_032205972.1|4887328_4887670_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_000334896.1|4887682_4887931_+	hydrogenase maturation factor HybG	NA	NA	NA	NA	NA
WP_032205971.1|4888053_4888920_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_001297309.1|4889124_4890984_+	bifunctional glutathionylspermidine amidase/synthase	NA	NA	NA	NA	NA
WP_077790941.1|4892822_4893344_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001076231.1|4893605_4894319_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_000339512.1|4894350_4895109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000896880.1|4895154_4896504_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_024243873.1|4896503_4897328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298770.1|4897339_4897900_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000779665.1|4897930_4899001_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_032205969.1|4898997_4900077_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000248097.1|4901282_4901531_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_032205968.1|4901562_4902477_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_072033243.1|4902473_4904204_-	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_032205967.1|4904565_4905708_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001297764.1|4905714_4906479_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
WP_000026117.1|4906728_4908228_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_000943059.1|4908227_4909280_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_001194666.1|4909290_4910514_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_032205965.1|4910518_4910923_+	protein GlcG	NA	NA	NA	NA	NA
WP_032205964.1|4910944_4913116_+	malate synthase G	NA	NA	NA	NA	NA
WP_032205963.1|4915638_4920204_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_032205962.1|4920351_4921161_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001324279.1|4921226_4921637_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_032205961.1|4921654_4922614_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_047087336.1|4924703_4926191_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_047087335.1|4926190_4927414_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|4927430_4927886_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_106913965.1|4928113_4929327_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.1e-167
WP_000854916.1|4929638_4930016_-	toxin	NA	NA	NA	NA	NA
WP_097746533.1|4930174_4931331_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_032207120.1|4931877_4935969_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_106888188.1|4937010_4938284_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.9e-175
>prophage 1
NZ_CP027460	Escherichia coli strain 90-3040 plasmid unnamed, complete sequence	74247	0	10175	74247		Escherichia_phage(50.0%)	9	NA	NA
WP_001132895.1|143_395_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032208250.1|568_754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091308.1|2095_2461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|2974_5185_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_047088106.1|5228_5618_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445934.1|6578_6974_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_032208244.1|6973_7933_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_077790945.1|8205_9108_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086163.1|9491_10175_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
>prophage 2
NZ_CP027460	Escherichia coli strain 90-3040 plasmid unnamed, complete sequence	74247	20018	21174	74247	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_106888247.1|20018_21174_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.6e-68
>prophage 3
NZ_CP027460	Escherichia coli strain 90-3040 plasmid unnamed, complete sequence	74247	24271	27651	74247		Xanthomonas_phage(33.33%)	5	NA	NA
WP_000205763.1|24271_25018_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	7.6e-11
WP_047088282.1|25076_25937_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	1.8e-11
WP_047088283.1|26039_26600_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|26732_26945_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047088284.1|27189_27651_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.8	6.7e-18
>prophage 4
NZ_CP027460	Escherichia coli strain 90-3040 plasmid unnamed, complete sequence	74247	33695	39892	74247	protease,transposase	Acinetobacter_phage(25.0%)	4	NA	NA
WP_106888248.1|33695_34851_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_077744811.1|34757_35264_+	chromosome partitioning protein ParB	NA	Q1MVJ4	Enterobacteria_phage	52.9	3.3e-26
WP_077790994.1|35402_35585_-	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	53.6	2.4e-11
WP_106888249.1|35992_39892_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.3	4.2e-238
>prophage 5
NZ_CP027460	Escherichia coli strain 90-3040 plasmid unnamed, complete sequence	74247	64328	73050	74247	integrase,transposase	Bacillus_phage(25.0%)	6	48422:48434	72637:72649
48422:48434	attL	CACGGTACCGGCA	NA	NA	NA	NA
WP_074433587.1|64328_66449_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.2e-45
WP_032207106.1|66452_67892_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_072057408.1|67958_68417_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106913930.1|69379_70653_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	4.4e-176
WP_032208234.1|71089_71830_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361618.1|72072_73050_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.0e-100
72637:72649	attR	CACGGTACCGGCA	NA	NA	NA	NA
