The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	94509	199559	5168620	portal,lysis,terminase,protease,capsid,tail,plate,integrase,transposase,head	Salmonella_phage(63.46%)	109	122434:122449	148289:148304
WP_000399664.1|94509_95490_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_096986489.1|95749_97009_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114247.1|97160_97976_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_096986488.1|98121_100554_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001571157.1|100559_101459_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_077737785.1|101589_102252_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	33.0	1.3e-25
WP_024247905.1|102330_103077_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397358.1|103076_104312_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513801.1|104515_105481_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_096986487.1|105467_107339_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
WP_096986486.1|107358_108897_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936052.1|108914_109835_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|109837_110749_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_000950331.1|110925_113274_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086870.1|113281_114610_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001280945.1|114679_115009_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000539521.1|114998_115385_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000049367.1|115610_116936_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|117148_117532_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555050.1|117642_118758_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_096986484.1|118754_119381_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000195961.1|119627_120830_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450130.1|120876_121635_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_000892317.1|121692_122289_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
122434:122449	attL	AAATAAAACTTAAAGA	NA	NA	NA	NA
WP_001330495.1|122573_123806_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000605480.1|123846_124131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075861886.1|124215_125031_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217859.1|125030_126239_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|126322_126859_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106901651.1|126963_128016_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.5	7.0e-103
WP_106901652.1|128204_128396_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	60.0	1.4e-09
WP_053295956.1|128411_128981_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	3.8e-39
WP_001247707.1|129106_129328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|129360_129870_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956188.1|129877_130174_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	1.3e-22
WP_000934004.1|130259_130508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963854.1|130590_130932_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	2.3e-55
WP_001244216.1|130999_131233_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|131232_131460_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_106901653.1|131456_132314_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.9e-159
WP_106901654.1|132310_134725_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154431.1|134877_135066_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_147590295.1|135076_135310_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	1.4e-35
WP_001059831.1|135502_135838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901657.1|136303_137956_+	NTPase	NA	X2KLG0	Campylobacter_phage	23.2	2.3e-15
WP_106901658.1|137994_139023_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.3	6.5e-170
WP_001098431.1|139022_140789_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000216240.1|140931_141765_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	92.1	3.1e-122
WP_000742511.1|141781_142840_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059199.1|142843_143494_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	5.6e-111
WP_000673509.1|143589_144054_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.7	2.7e-75
WP_000868175.1|144053_144257_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_106901659.1|144260_144476_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
WP_106901660.1|144456_144972_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	1.6e-89
WP_000196204.1|144968_145397_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.9e-59
WP_106901661.1|145492_145924_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.2e-71
WP_106901662.1|145916_146375_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.1	4.6e-59
WP_000906671.1|146393_147251_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_000276794.1|147237_148494_-	AAA family ATPase	NA	NA	NA	NA	NA
148289:148304	attR	TCTTTAAGTTTTATTT	NA	NA	NA	NA
WP_106901797.1|148606_149185_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	2.1e-93
WP_106901663.1|149181_149541_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	4.7e-51
WP_001522714.1|149527_150436_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
WP_001522715.1|150428_151034_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	1.3e-109
WP_106901664.1|152409_152832_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	37.3	3.5e-21
WP_106901665.1|153016_154054_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_106901666.1|154848_156021_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.5e-202
WP_106901667.1|156030_156546_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.2	1.4e-88
WP_001281010.1|156600_156903_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.7e-38
WP_000763311.1|156917_157037_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_106901668.1|157029_160107_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980413.1|160103_160589_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_001011797.1|160585_161686_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000972391.1|161776_161995_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|162230_163916_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|164185_164563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195231.1|164592_164850_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201575.1|165009_165297_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001571168.1|165280_166003_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|166063_166966_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|167053_167530_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_096986483.1|167880_168993_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001544415.1|169087_170221_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105436.1|170230_171184_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|171180_172026_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|172085_172574_+	YbjO family protein	NA	NA	NA	NA	NA
WP_096884056.1|172614_173742_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001354873.1|173770_174502_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464489.1|174727_175396_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|175395_176112_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756575.1|176118_176850_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|176867_177596_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_094030286.1|177813_178329_-	lipoprotein	NA	NA	NA	NA	NA
WP_097291174.1|178976_180746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001160731.1|180956_181280_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255171.1|181276_182107_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	4.3e-07
WP_001305933.1|182103_183117_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001578053.1|183215_184646_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024230236.1|184656_185658_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_075861890.1|185694_187413_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.9e-31
WP_000178672.1|187545_188514_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_022645440.1|188525_190178_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_022645441.1|190320_191220_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|191677_192373_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|192798_194457_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_137504573.1|194453_195410_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|195560_196676_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_096986480.1|196672_198619_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|198691_198916_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|199238_199559_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 2
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	734034	804958	5168620	transposase,head,plate,tail	Escherichia_phage(49.09%)	76	NA	NA
WP_000399664.1|734034_735015_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_096987262.1|735241_736135_-	PhzF family isomerase	NA	NA	NA	NA	NA
WP_072157219.1|736214_736892_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_001166367.1|736891_737587_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702551.1|737586_739131_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
WP_001361907.1|739127_742868_-	nitrate reductase Z subunit alpha	NA	NA	NA	NA	NA
WP_001207907.1|742962_744351_-	NarK family nitrate/nitrite MFS transporter	NA	NA	NA	NA	NA
WP_075861664.1|744660_745917_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_123001204.1|745979_747239_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000768393.1|747408_748509_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
WP_000198203.1|748766_749648_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_012311994.1|749879_752927_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_001240581.1|752939_753824_+	formate dehydrogenase N subunit beta	NA	NA	NA	NA	NA
WP_000045650.1|753816_754470_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_000781370.1|754520_754805_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642406.1|754950_755961_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000433462.1|756094_757792_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_000841554.1|757948_758086_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_000495766.1|758187_758403_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
WP_000152305.1|758747_759179_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_001285551.1|759234_760161_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	2.4e-14
WP_000193514.1|760153_761140_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
WP_000979619.1|761136_762033_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_000145126.1|762029_763052_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000191335.1|764649_765165_-	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	40.5	1.6e-23
WP_000985458.1|765365_765584_+	transcriptional regulator	NA	A0A0C4UQU0	Shigella_phage	66.7	5.4e-18
WP_047660752.1|765586_767587_+|transposase	transposase	transposase	C9DGL1	Escherichia_phage	94.8	0.0e+00
WP_047660754.1|767625_768564_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	97.4	1.9e-168
WP_000968312.1|768579_768807_+	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_021560932.1|769051_769321_+	hypothetical protein	NA	C9DGL5	Escherichia_phage	31.5	8.5e-05
WP_001101157.1|769341_769761_+	hypothetical protein	NA	C9DGL6	Escherichia_phage	99.3	9.9e-77
WP_000255655.1|769761_770061_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	99.0	2.8e-49
WP_001107930.1|770080_770605_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_021537262.1|770703_771234_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	93.8	2.1e-95
WP_047660757.1|771233_771758_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	93.4	8.3e-89
WP_001621843.1|771754_772423_+	hypothetical protein	NA	Q71T76	Escherichia_phage	64.6	2.6e-79
WP_001621849.1|772425_772767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024193941.1|772840_773392_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	98.9	2.6e-101
WP_000133856.1|773388_773778_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	99.2	7.8e-68
WP_000515809.1|773855_774086_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	98.7	6.3e-41
WP_001163386.1|774197_774620_+	positive regulator of late transcription	NA	A0A0C4UQZ9	Shigella_phage	100.0	2.9e-76
WP_052322939.1|774714_775230_+	lysozyme	NA	C9DGM9	Escherichia_phage	98.2	9.3e-93
WP_042631109.1|775213_775600_+	hypothetical protein	NA	A0A0C4UR28	Shigella_phage	100.0	2.6e-63
WP_001001318.1|775758_775953_+	hypothetical protein	NA	A0A0C4UQR7	Shigella_phage	100.0	6.2e-34
WP_000364295.1|775952_776252_+	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_000606409.1|776248_776539_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000375394.1|776550_777126_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_047660766.1|777133_778789_+	Mu-like prophage FluMu protein gp28	NA	C9DGN5	Escherichia_phage	99.6	0.0e+00
WP_000532642.1|778788_780327_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.6	2.1e-297
WP_047660768.1|780307_781627_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	98.4	1.2e-248
WP_000050890.1|781623_782094_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	98.7	3.2e-84
WP_021537254.1|782290_783376_+	hypothetical protein	NA	C9DGP0	Escherichia_phage	99.7	1.2e-195
WP_047660771.1|783372_784290_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	97.7	2.4e-176
WP_021537253.1|784356_784767_+	hypothetical protein	NA	A0A0C4UQZ0	Shigella_phage	97.1	5.2e-62
WP_001104972.1|784763_785189_+	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	100.0	4.2e-75
WP_000888927.1|785188_785737_+	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	100.0	1.1e-104
WP_001409561.1|785723_785927_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	98.5	6.3e-29
WP_001280310.1|785923_787411_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
WP_000918404.1|787420_787777_+|tail	tail protein	tail	C9DGP8	Escherichia_phage	100.0	2.4e-63
WP_000344073.1|787786_788221_+	hypothetical protein	NA	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_047660774.1|788365_790438_+	tape measure protein	NA	C9DGQ1	Escherichia_phage	97.2	0.0e+00
WP_047660776.1|790442_791930_+	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	99.4	6.3e-243
WP_047660778.1|791922_793062_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	99.2	8.9e-213
WP_000442748.1|793049_793643_+|plate	phage baseplate assembly protein	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000130548.1|793639_794077_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000331811.1|794077_795160_+|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	100.0	1.1e-207
WP_000301698.1|795150_795693_+	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	100.0	1.3e-100
WP_047660781.1|795692_797048_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	52.0	2.3e-106
WP_032163028.1|797049_797577_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	82.3	4.3e-77
WP_047660783.1|797605_798139_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	66.7	1.4e-62
WP_000905064.1|799102_799684_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	99.5	1.6e-104
WP_001300256.1|799778_799967_+	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_032162872.1|799917_800634_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	98.7	2.2e-132
WP_032162871.1|800763_801105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001285824.1|801719_802301_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_123000016.1|802558_804958_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 3
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	878235	935777	5168620	portal,lysis,terminase,capsid,transposase,integrase,tail,head	Enterobacteria_phage(39.62%)	77	883325:883340	928829:928844
WP_096986583.1|878235_879696_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	1.7e-43
WP_000347479.1|879784_881068_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|881671_881785_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|881853_882087_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|882403_882994_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000355360.1|883221_883515_-	hypothetical protein	NA	NA	NA	NA	NA
883325:883340	attL	CACCACGGCATATTCA	NA	NA	NA	NA
WP_000654171.1|883527_883806_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	2.9e-24
WP_097291164.1|883802_885827_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	72.3	3.2e-181
WP_001230558.1|885891_886491_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	4.5e-107
WP_047664591.1|886557_890037_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_072032980.1|890097_890730_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	2.5e-95
WP_001361515.1|890666_891410_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152639.1|891415_892114_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847345.1|892113_892443_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_097291163.1|892439_895019_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.3	0.0e+00
WP_000459457.1|895011_895446_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_097291162.1|895427_895850_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	1.8e-70
WP_001349920.1|895865_896606_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|896613_897009_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|897005_897584_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000753007.1|897595_897949_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158868.1|897960_898356_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063218.1|898397_899423_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_047663921.1|899478_899811_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_021563108.1|899820_901140_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	3.1e-233
WP_001676384.1|901120_902722_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	3.8e-310
WP_000198149.1|902718_902925_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_096247525.1|902921_904847_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453576.1|904821_905367_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001368374.1|905755_905989_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|906046_906457_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|906608_906782_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_123001190.1|906953_907109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|907188_907254_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|907256_907445_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|907455_907668_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|908030_908528_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|908524_909058_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|909054_909366_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|909370_909586_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|910339_910555_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|910855_911068_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|911122_911212_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|911489_912242_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|912255_913305_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|913306_913585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|913651_913903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|914119_914275_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|914346_914634_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|914633_914873_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|914897_915203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|915405_915738_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|916174_917488_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|917665_917848_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001310834.1|919154_919511_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|919507_919930_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|919970_920936_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|920916_921438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|921421_921652_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|921735_922143_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|922309_922465_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|922624_922843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|922846_923011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|923410_923599_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|923595_923787_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048342.1|923879_926351_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|926438_926675_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_123001189.1|926709_927990_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	3.6e-154
WP_001360138.1|928009_928120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836084.1|928177_929197_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	7.4e-17
928829:928844	attR	CACCACGGCATATTCA	NA	NA	NA	NA
WP_001295394.1|929208_930423_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001304355.1|930628_930955_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
WP_000705197.1|931089_931431_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|931465_932026_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_032142801.1|932028_932739_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|932846_933152_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_061092693.1|933350_935777_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	5.0e-213
>prophage 4
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	947240	1031163	5168620	terminase,tail,tRNA,transposase,plate,integrase,protease,head	Burkholderia_virus(34.09%)	99	940340:940355	1034729:1034744
940340:940355	attL	ACGCTGGCGCAATGGC	NA	NA	NA	NA
WP_075862245.1|947240_948062_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|948100_948430_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|948416_948782_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|948888_949059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075862246.1|949193_950228_+	AI-2 transporter TqsA	NA	NA	NA	NA	NA
WP_000014036.1|950252_951641_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001298661.1|951651_953184_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000769322.1|953708_954653_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000412379.1|954838_956221_+	amino acid permease	NA	NA	NA	NA	NA
WP_001552898.1|956257_956980_+	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000524861.1|956976_957312_-	GlpM family protein	NA	NA	NA	NA	NA
WP_001298660.1|957440_958160_+	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_075862247.1|958163_959465_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	9.5e-17
WP_001295399.1|959540_960470_+	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_001099102.1|960466_961870_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000066639.1|962012_963659_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_096986585.1|963857_965033_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_096986586.1|965133_966642_+	YdgA family protein	NA	NA	NA	NA	NA
WP_001227015.1|966867_968133_-	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001075893.1|968171_969545_-	glucuronide transporter	NA	NA	NA	NA	NA
WP_075862250.1|969541_971353_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_000969092.1|971742_972333_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000483371.1|972553_973321_-	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000179513.1|973432_974461_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_096986587.1|974635_976228_+	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000459372.1|976237_977410_+	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000567514.1|977513_978515_+	adenosine deaminase	NA	NA	NA	NA	NA
WP_096986588.1|978550_979591_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001296096.1|979833_979959_+	division septum protein Blr	NA	NA	NA	NA	NA
WP_000217950.1|980231_980447_+	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_000214176.1|980532_980973_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000133193.1|981049_981631_+	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000991809.1|981630_982209_+	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_096986589.1|982201_984424_+	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_001357315.1|984424_985483_+	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000920799.1|985486_986107_+	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_001289646.1|986110_986806_+	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_001030339.1|986805_987441_+	endonuclease III	NA	NA	NA	NA	NA
WP_000100942.1|988051_989554_+	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_000765742.1|989659_990265_+	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_001302086.1|990308_991169_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_001295400.1|991230_992505_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001282325.1|992633_993290_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_000061974.1|993348_993678_-	C-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000835077.1|993775_994885_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_001165548.1|995078_995651_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_001298743.1|995722_996184_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	55.8	4.8e-40
WP_106901676.1|996194_996671_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.0	1.0e-45
WP_032277290.1|996677_997295_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.4	1.5e-65
WP_069917721.1|997294_997780_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.0	1.3e-40
WP_106901677.1|997808_998324_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.7	1.8e-40
WP_106901678.1|998351_999317_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	52.6	1.9e-62
WP_096149476.1|999319_999898_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.3	4.1e-65
WP_000859112.1|1000983_1001331_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_096149478.1|1001387_1001915_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	3.3e-21
WP_096149479.1|1001911_1003066_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	7.2e-85
WP_010989167.1|1003053_1003269_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000458383.1|1003265_1004150_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_106901679.1|1004149_1006615_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	1.3e-168
WP_001148841.1|1006707_1006845_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084227.1|1006789_1007125_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110115.1|1007222_1007504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|1007506_1008028_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_044788978.1|1008027_1009455_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.8	2.6e-217
WP_031606341.1|1009444_1009699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1009695_1010160_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_023892604.1|1010159_1010606_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	1.7e-34
WP_023892603.1|1010607_1010946_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_106901680.1|1010955_1011909_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.2	2.6e-64
WP_001273074.1|1011923_1013039_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_023892601.1|1013253_1013712_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.2	2.2e-29
WP_000117556.1|1013714_1014536_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_023892600.1|1014516_1016013_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.4	4.4e-167
WP_023892599.1|1016012_1017329_-|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	63.3	9.8e-147
WP_023892598.1|1017325_1017874_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	47.3	1.7e-36
WP_000227702.1|1017876_1018188_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	3.0e-30
WP_000175097.1|1018187_1018514_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_023892597.1|1018510_1019164_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.1	6.2e-09
WP_023892596.1|1019153_1019876_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.9	3.7e-63
WP_023892595.1|1019878_1020229_-	membrane protein	NA	A4JWP3	Burkholderia_virus	52.2	9.9e-22
WP_023892522.1|1020359_1020785_+	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_023892521.1|1020860_1021355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023892520.1|1021557_1022322_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	1.2e-99
WP_000052056.1|1022438_1022786_-	helix-turn-helix transcriptional regulator	NA	Q5ZQZ8	Pseudomonas_phage	48.3	1.1e-15
WP_000123377.1|1022878_1023067_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	69.4	6.7e-17
WP_000047758.1|1023119_1023428_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_031249600.1|1023438_1024350_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	51.8	1.1e-69
WP_069915396.1|1024353_1026135_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	1.1e-228
WP_000960670.1|1026145_1027312_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_000843446.1|1027314_1027584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140141.1|1027611_1028142_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	67.9	1.1e-59
WP_023892713.1|1028430_1028703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023892712.1|1028712_1029009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763553.1|1029023_1029239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132035.1|1029235_1029919_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.7	2.9e-25
WP_023892711.1|1029915_1030146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023892645.1|1030135_1030351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988472.1|1030340_1030793_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	1.6e-24
WP_001281696.1|1030764_1031163_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
1034729:1034744	attR	ACGCTGGCGCAATGGC	NA	NA	NA	NA
>prophage 5
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	1357494	1417312	5168620	portal,terminase,protease,capsid,holin,integrase,tail,head	Escherichia_phage(39.34%)	80	1415873:1415893	1426588:1426608
WP_106901682.1|1357494_1358079_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	2.4e-105
WP_106901683.1|1358078_1360403_-	short-chain dehydrogenase	NA	A0A0K2FIZ6	Escherichia_phage	97.8	2.3e-215
WP_001568881.1|1360467_1361067_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	2.5e-105
WP_106901684.1|1361134_1364530_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.6	0.0e+00
WP_069904023.1|1364590_1365238_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	1.7e-112
WP_032215104.1|1365135_1365879_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	4.0e-145
WP_054632287.1|1365883_1366582_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.4	2.4e-131
WP_001114906.1|1366581_1366923_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.5	4.6e-40
WP_097477333.1|1366915_1370143_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	97.6	0.0e+00
WP_069904041.1|1370583_1370862_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	82.6	1.8e-34
WP_077757326.1|1370885_1371272_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_062878028.1|1371271_1371976_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	95.7	1.5e-117
WP_001406801.1|1372036_1372381_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	98.2	3.6e-56
WP_000968644.1|1372377_1372827_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_069904028.1|1372823_1373162_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	89.3	3.7e-50
WP_024201160.1|1373170_1373488_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	1.1e-22
WP_096981142.1|1373532_1374759_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	90.9	1.1e-200
WP_001193625.1|1374770_1375421_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	100.0	6.0e-121
WP_069904029.1|1375398_1376640_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.4	7.9e-231
WP_069904030.1|1376639_1376822_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	81.7	4.8e-20
WP_000127864.1|1378086_1379748_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.8	1.0e-278
WP_001353110.1|1379731_1380088_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	6.1e-51
WP_001145897.1|1380376_1380817_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_001288063.1|1380816_1381116_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	61.1	6.1e-28
WP_122990468.1|1381108_1382281_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.9	4.1e-205
WP_001181673.1|1382324_1382885_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	83.9	1.7e-87
WP_032166736.1|1382934_1384080_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.2	6.8e-144
WP_001145404.1|1384354_1384603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164226.1|1384593_1385136_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	34.0	6.3e-07
WP_106901685.1|1385172_1385598_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_097474947.1|1385594_1385846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097480874.1|1386047_1387463_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	58.2	6.9e-114
WP_106901686.1|1387459_1387759_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_106901687.1|1387964_1388198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024235460.1|1388190_1388430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063100535.1|1388987_1389293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021530546.1|1390072_1390651_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	63.6	9.2e-57
WP_021530547.1|1390708_1390987_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000614825.1|1391050_1391272_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_106901688.1|1391249_1392473_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	46.6	5.1e-97
WP_001140906.1|1392478_1393672_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.7	2.5e-197
WP_069904031.1|1393671_1394154_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	3.3e-84
WP_106901689.1|1394382_1394898_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.8	3.7e-33
WP_106901690.1|1395033_1395384_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	93.9	4.9e-61
WP_106901691.1|1395391_1395592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901692.1|1395588_1395828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075329350.1|1395913_1396099_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	1.9e-19
WP_032215161.1|1396315_1396849_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	2.5e-101
WP_032215159.1|1396904_1397219_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	1.0e-49
WP_001383275.1|1397211_1397439_-|holin	holin	holin	M1FN85	Enterobacteria_phage	93.0	6.8e-32
WP_000756806.1|1397795_1398065_-	Shiga toxin Stx1d subunit B	NA	Q94LZ9	Enterobacteria_phage	94.4	2.8e-40
WP_000699959.1|1398074_1399022_-	Shiga toxin Stx1d subunit A	NA	Q777W4	Enterobacteria_phage	94.0	1.6e-162
WP_106901693.1|1399805_1400624_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090268.1|1400774_1401146_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	3.0e-53
WP_032215155.1|1401135_1401507_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	9.8e-36
WP_106901694.1|1401519_1402569_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.0e-106
WP_072025759.1|1402570_1402843_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	4.7e-11
WP_001260977.1|1402978_1403236_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|1403241_1403541_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_106901695.1|1403745_1404261_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	75.5	2.1e-36
WP_001224685.1|1404426_1404609_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	95.0	2.6e-26
WP_147590301.1|1404702_1405101_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.5e-55
WP_106901696.1|1405060_1405597_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	90.3	9.2e-51
WP_106901697.1|1405589_1405889_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	96.0	4.8e-49
WP_047088415.1|1405885_1406281_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	54.6	3.7e-33
WP_159032884.1|1406310_1406853_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	94.8	7.8e-82
WP_147590303.1|1406764_1407805_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	91.9	6.9e-103
WP_106901699.1|1407876_1408302_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|1408285_1408567_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|1408666_1409086_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000379575.1|1409349_1409505_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171946.1|1409664_1409883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|1409886_1410051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901700.1|1410450_1410639_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_106901701.1|1410635_1410827_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106901702.1|1410920_1413392_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	61.2	1.5e-58
WP_000096346.1|1413450_1413654_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|1413653_1414679_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001302302.1|1414914_1415712_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1415873:1415893	attL	CCAGTCAGAGGAGCCAAATTC	NA	NA	NA	NA
WP_096987167.1|1416049_1417312_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.4e-73
WP_096987167.1|1416049_1417312_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.4e-73
1426588:1426608	attR	CCAGTCAGAGGAGCCAAATTC	NA	NA	NA	NA
>prophage 6
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	1500816	1507120	5168620		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001610415.1|1500816_1501359_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.6e-47
WP_096986540.1|1501363_1502242_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_001023616.1|1502300_1503200_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_032084602.1|1503199_1504285_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|1504657_1505551_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_096986541.1|1505725_1507120_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	8.3e-19
>prophage 7
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	1598833	1608275	5168620		Enterobacteria_phage(85.71%)	10	NA	NA
WP_096986561.1|1598833_1599970_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	1.3e-163
WP_096986562.1|1599966_1601967_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|1602091_1602553_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1602593_1603064_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001308766.1|1603110_1603830_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1603826_1605512_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_052896128.1|1605733_1606465_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1606524_1606632_+	protein YohO	NA	NA	NA	NA	NA
WP_032171571.1|1606612_1607344_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_089583080.1|1607348_1608275_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 8
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	1819751	1876827	5168620	portal,terminase,capsid,tail,tRNA,holin,plate,integrase,transposase,head	Enterobacteria_phage(74.0%)	70	1834921:1834940	1870884:1870903
WP_000156125.1|1819751_1820654_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	3.1e-67
WP_001293612.1|1820850_1821624_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|1821631_1822348_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965518.1|1822344_1823031_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_000737621.1|1823120_1823903_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748259.1|1824123_1824906_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825700.1|1825171_1825741_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334221.1|1825835_1827353_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
WP_000262113.1|1827389_1827878_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000146992.1|1828113_1828776_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_096987140.1|1828765_1830034_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000118404.1|1830103_1831018_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364327.1|1831173_1831833_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283590.1|1831915_1832728_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|1832727_1833741_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001534306.1|1833806_1834964_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	4.6e-23
1834921:1834940	attL	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_087892011.1|1835122_1836127_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	2.0e-99
WP_001390705.1|1836223_1836544_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|1836657_1836945_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_106901707.1|1836951_1837158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813359.1|1837410_1837752_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	3.9e-55
WP_042094569.1|1837762_1838050_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	1.7e-32
WP_000357024.1|1838061_1838304_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.5e-37
WP_122985461.1|1838300_1838438_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	1.9e-08
WP_000985159.1|1838499_1838703_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153674.1|1838699_1838945_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_054623006.1|1838941_1839241_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	91.9	2.5e-42
WP_106901708.1|1839252_1839870_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_000564231.1|1839866_1840256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106901709.1|1840252_1843093_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.4	0.0e+00
WP_000686510.1|1843169_1844129_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	2.1e-178
WP_000211267.1|1844133_1844445_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000087812.1|1845565_1846612_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_032358198.1|1846611_1848363_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262657.1|1848517_1849354_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
WP_106901710.1|1849377_1850430_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	1.2e-192
WP_000632332.1|1850475_1851276_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
WP_000063103.1|1851377_1851872_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|1851871_1852072_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1852074_1852398_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1852394_1852787_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_106901711.1|1852783_1853311_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	5.4e-64
WP_097745547.1|1853329_1853797_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.7	5.0e-85
WP_106901712.1|1853789_1854425_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	98.1	1.3e-112
WP_106901713.1|1854421_1855003_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	3.6e-101
WP_000213447.1|1854999_1855350_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_050877860.1|1855353_1856250_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	3.9e-155
WP_000071724.1|1856242_1856851_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_106901714.1|1858438_1858897_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.3	3.0e-42
WP_042974162.1|1858903_1859515_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	79.5	1.1e-84
WP_072035471.1|1859514_1859973_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.1	9.0e-39
WP_089568628.1|1859983_1860421_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	62.0	9.8e-43
WP_072262638.1|1860461_1860890_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	69.3	1.8e-49
WP_047663210.1|1860900_1861407_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	66.7	6.0e-52
WP_001165544.1|1861478_1862078_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	2.6e-86
WP_000979945.1|1862104_1862593_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_106901715.1|1862605_1865413_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000333503.1|1865399_1865555_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|1865563_1865938_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|1865993_1866506_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_042028454.1|1866505_1867690_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	9.0e-224
WP_000132840.1|1867847_1868957_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	8.2e-195
WP_000488104.1|1868999_1869260_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|1869451_1869592_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001353016.1|1869841_1870039_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000215758.1|1869983_1870775_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	5.7e-65
WP_000615813.1|1871004_1872000_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
1870884:1870903	attR	TTTTCATCAACAAGGATTTT	NA	NA	NA	NA
WP_000127788.1|1871996_1873175_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|1873441_1874662_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_096987139.1|1874820_1876827_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	2238109	2329998	5168620	terminase,tail,tRNA,plate,integrase,transposase,head	Burkholderia_virus(28.85%)	107	2248332:2248349	2300807:2300824
WP_096987067.1|2238109_2240740_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_022646015.1|2240868_2241369_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2241437_2242499_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132236.1|2242578_2243076_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	2.6e-31
WP_001328874.1|2243220_2244306_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_000573321.1|2244562_2245126_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000196934.1|2245122_2246082_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000216201.1|2246092_2246464_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001077354.1|2246467_2247247_+	sorbitol-6-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000252908.1|2247352_2247712_+	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_000804550.1|2247778_2248552_+	glucitol operon DNA-binding transcriptional repressor SrlR	NA	NA	NA	NA	NA
2248332:2248349	attL	TCAACGAGGTCTATACCG	NA	NA	NA	NA
WP_001287401.1|2248544_2249510_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
WP_077516558.1|2249506_2251021_-	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_096986971.1|2251207_2252647_+	anaerobic nitric oxide reductase flavorubredoxin	NA	NA	NA	NA	NA
WP_096986970.1|2252643_2253777_+	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_075861746.1|2253855_2256096_-	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_001078777.1|2256248_2256776_-	electron transport protein HydN	NA	NA	NA	NA	NA
WP_012602466.1|2256924_2257938_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.6	4.6e-27
WP_024242331.1|2258193_2259651_+	PTS cellobiose/arbutin/salicin transporter subunit IIBC	NA	NA	NA	NA	NA
WP_075861763.1|2259659_2261084_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_106901722.1|2261170_2261413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023892644.1|2261801_2262434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023277510.1|2262548_2262947_-	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_031606346.1|2262918_2263371_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	2.8e-24
WP_000123379.1|2263360_2263576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023892711.1|2263565_2263796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023892693.1|2263792_2264476_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.8	5.3e-35
WP_001610539.1|2264472_2264778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023892694.1|2264787_2265060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140141.1|2265348_2265879_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	67.9	1.1e-59
WP_000843446.1|2265906_2266176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960676.1|2266178_2267345_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.9	3.3e-122
WP_042093485.1|2267355_2269125_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	1.2e-227
WP_023892590.1|2269128_2270043_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.2	3.4e-69
WP_021530190.1|2270053_2270362_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	9.3e-24
WP_000200153.1|2270414_2270603_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
WP_023892592.1|2271111_2272098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001069607.1|2272494_2272710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031606340.1|2272708_2273113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023892594.1|2273088_2273832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023892595.1|2273962_2274313_+	membrane protein	NA	A4JWP3	Burkholderia_virus	52.2	9.9e-22
WP_023892596.1|2274315_2275038_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.9	3.7e-63
WP_042093481.1|2275027_2275681_+	lipoprotein	NA	J9SVN7	Pseudomonas_phage	32.1	1.1e-08
WP_000175097.1|2275677_2276004_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227702.1|2276003_2276315_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	3.0e-30
WP_023892598.1|2276317_2276866_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	47.3	1.7e-36
WP_023892599.1|2276862_2278179_+|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	63.3	9.8e-147
WP_023892600.1|2278178_2279675_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.4	4.4e-167
WP_000117556.1|2279655_2280477_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_023892601.1|2280479_2280938_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.2	2.2e-29
WP_001273074.1|2281152_2282268_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_023892602.1|2282282_2283236_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	9.9e-64
WP_023892603.1|2283245_2283584_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_023892604.1|2283585_2284032_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	1.7e-34
WP_042093479.1|2284031_2284496_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	2.0e-38
WP_031606341.1|2284492_2284747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729860.1|2284736_2286164_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	77.6	5.7e-217
WP_000034294.1|2286163_2286685_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110117.1|2286687_2286969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084230.1|2287066_2287402_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|2287346_2287484_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_042093478.1|2287577_2290043_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.8	1.6e-169
WP_023892609.1|2290042_2290927_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	45.0	2.8e-52
WP_010989167.1|2290923_2291139_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000807996.1|2291126_2292281_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	4.2e-85
WP_042093476.1|2292277_2292805_+|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	2.0e-21
WP_000859112.1|2292861_2293209_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_001219105.1|2293199_2294303_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	54.3	3.2e-106
WP_042093474.1|2294295_2294874_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	64.7	1.6e-64
WP_106901723.1|2294876_2295845_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	55.2	7.7e-64
WP_042093473.1|2295851_2296469_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.4	1.3e-64
WP_000503754.1|2296468_2296972_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	53.4	1.1e-42
WP_001165548.1|2297043_2297616_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_000132961.1|2298228_2298699_-	hydrogenase maturation peptidase HycI	NA	NA	NA	NA	NA
WP_001291919.1|2298691_2299102_-	HycH family protein	NA	NA	NA	NA	NA
WP_000067399.1|2299098_2299866_-	formate hydrogenlyase subunit HycG	NA	NA	NA	NA	NA
WP_000493785.1|2299865_2300408_-	formate hydrogenlyase subunit HycF	NA	NA	NA	NA	NA
WP_001288134.1|2300417_2302127_-	hydrogenase large subunit	NA	NA	NA	NA	NA
2300807:2300824	attR	CGGTATAGACCTCGTTGA	NA	NA	NA	NA
WP_000115226.1|2302144_2303068_-	formate hydrogenlyase subunit HycD	NA	NA	NA	NA	NA
WP_089583013.1|2303070_2304897_-	formate hydrogenlyase subunit 3	NA	NA	NA	NA	NA
WP_001079186.1|2304893_2305505_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000158061.1|2305629_2306091_-	formate hydrogenlyase regulator HycA	NA	NA	NA	NA	NA
WP_124056873.1|2306178_2306397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299100.1|2306302_2306653_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_096986969.1|2306656_2307529_+	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_075861749.1|2307519_2307792_+	hydrogenase 3 maturation protein HypC	NA	NA	NA	NA	NA
WP_001212982.1|2307791_2308913_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_096986968.1|2308909_2309920_+	hydrogenase maturation carbamoyl dehydratase HypE	NA	NA	NA	NA	NA
WP_001361307.1|2309993_2312072_+	formate hydrogenlyase transcriptional activator FlhA	NA	NA	NA	NA	NA
WP_000301062.1|2312116_2312545_+	transporter	NA	NA	NA	NA	NA
WP_000015479.1|2312583_2312928_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_001272887.1|2313214_2315776_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	4.6e-31
WP_096986967.1|2315881_2316538_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	1.3e-51
WP_001295181.1|2316588_2317356_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_106901725.1|2317551_2318460_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	3.3e-117
WP_000590408.1|2318456_2319719_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001278992.1|2319715_2320354_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_001136937.1|2320358_2321135_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_096986966.1|2321223_2322588_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000562982.1|2322626_2322863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097291288.1|2322873_2324325_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_001208067.1|2324725_2325133_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000081550.1|2325252_2326245_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2326307_2327447_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2327586_2328213_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2328206_2328968_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_075861751.1|2328948_2329998_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	4503579	4576434	5168620	protease,tRNA,transposase,plate	Emiliania_huxleyi_virus(11.11%)	58	NA	NA
WP_024223346.1|4503579_4504932_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4504961_4507394_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758958.1|4507515_4508001_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_064524990.1|4508004_4509030_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4509134_4509590_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4509593_4510382_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_096986641.1|4510381_4511530_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569424.1|4511526_4512123_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294757.1|4512159_4515642_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4515654_4516614_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_097291328.1|4516711_4518853_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4518909_4519299_+	VOC family protein	NA	NA	NA	NA	NA
WP_096986639.1|4519363_4520677_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|4520710_4520971_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4520957_4521158_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001540755.1|4521323_4521869_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|4521865_4522288_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001601560.1|4522301_4523012_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_096986638.1|4523166_4523991_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|4524043_4525762_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4525873_4526581_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|4526577_4526982_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4527099_4527915_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4527954_4528608_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4528600_4529632_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|4529819_4530395_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_096987254.1|4536152_4536956_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.7	1.3e-37
WP_000648565.1|4536952_4537867_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4538107_4538908_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_096987255.1|4538984_4539755_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4539802_4541161_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_096987256.1|4541232_4541988_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|4542021_4542744_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4542740_4543208_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001366128.1|4543272_4544004_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_096987257.1|4544540_4545326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236645.1|4545462_4545942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|4545951_4546866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096987258.1|4546909_4547392_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_096987210.1|4547415_4548768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123000017.1|4548778_4552213_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_022645208.1|4552321_4553737_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_022645209.1|4553741_4554485_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_097291454.1|4554481_4557241_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.2	4.2e-83
WP_096987212.1|4557249_4558011_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022645212.1|4558015_4559347_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4559349_4559874_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113710.1|4559870_4561151_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_063815230.1|4561175_4562258_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_096987213.1|4562221_4564072_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022645215.1|4564075_4564489_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022645216.1|4564495_4565971_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|4566021_4566246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096944962.1|4566280_4566781_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4567477_4567996_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_097415253.1|4568205_4570314_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	3.1e-25
WP_097291528.1|4574795_4575005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106901776.1|4575297_4576434_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP027447	Escherichia coli strain 2014C-3075 chromosome, complete genome	5168620	4630731	4713321	5168620	portal,terminase,capsid,tail,holin,plate,integrase,protease,head	Shigella_phage(49.15%)	89	4622491:4622507	4651553:4651569
4622491:4622507	attL	TGGCGGCAGCCGCGAAC	NA	NA	NA	NA
WP_000749879.1|4630731_4631787_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_001285288.1|4632074_4633178_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_022645230.1|4633189_4634443_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	3.4e-96
WP_000051887.1|4634647_4635811_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077873866.1|4635687_4636122_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_089538370.1|4636037_4636382_-	DNA-binding protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_000335007.1|4636378_4637257_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	6.3e-166
WP_000008187.1|4637247_4637784_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.9	1.8e-99
WP_000081287.1|4637911_4638736_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|4638801_4639164_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000917896.1|4639764_4640061_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000848748.1|4640233_4640908_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|4640998_4641199_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515830.1|4641242_4641794_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_001250269.1|4641969_4642149_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_106901778.1|4642138_4643080_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	1.9e-144
WP_001573323.1|4643076_4643571_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210170.1|4643570_4643897_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767111.1|4643893_4644283_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_001061397.1|4644302_4645100_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_032249117.1|4645107_4646097_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.8e-194
WP_001205460.1|4646114_4646456_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|4646468_4647017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901779.1|4647003_4647930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|4648194_4648398_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799659.1|4648548_4649601_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
WP_001120490.1|4649677_4650004_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001524097.1|4650007_4650484_+	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	96.2	1.2e-86
WP_106901780.1|4650467_4650860_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	83.7	9.7e-50
WP_000651448.1|4651106_4651427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106901781.1|4651522_4651873_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
4651553:4651569	attR	GTTCGCGGCTGCCGCCA	NA	NA	NA	NA
WP_147590313.1|4651998_4652493_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.2	2.5e-87
WP_147590322.1|4652726_4654223_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.2	1.5e-297
WP_000605606.1|4654234_4654417_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_105516875.1|4654416_4655658_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	2.2e-241
WP_001193631.1|4655635_4656286_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_106901784.1|4656300_4657506_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.8	5.3e-224
WP_000601365.1|4657555_4657756_+	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000927711.1|4657758_4658082_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4658078_4658489_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213504.1|4658463_4658970_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	95.2	6.3e-86
WP_106901785.1|4658966_4659527_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497753.1|4659535_4659706_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_001764254.1|4659689_4661186_+	hypothetical protein	NA	M1FN90	Enterobacteria_phage	100.0	1.7e-275
WP_000090998.1|4661185_4661542_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|4661541_4661811_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_106901786.1|4661952_4663788_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	4.5e-307
WP_147590315.1|4663848_4665177_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	5.5e-246
WP_047668520.1|4665173_4666253_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	5.9e-206
WP_096305467.1|4666252_4666801_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	9.6e-96
WP_130526343.1|4666800_4667226_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_106901788.1|4667212_4668271_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.3	3.6e-200
WP_000383548.1|4668261_4668846_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_106423022.1|4668972_4669491_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	71.9	1.8e-43
WP_001407366.1|4669512_4669953_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	1.6e-53
WP_000904981.1|4671036_4671591_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.8	1.7e-87
WP_000355484.1|4671648_4672422_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_040073705.1|4673133_4674969_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001019920.1|4675941_4676556_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|4676805_4677135_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_096986496.1|4677447_4678158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096986497.1|4678126_4679770_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_096986498.1|4679759_4682285_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716409.1|4682310_4682979_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730982.1|4683036_4683624_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|4683698_4684241_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000866436.1|4685324_4685465_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|4685464_4685728_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|4686092_4686194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182338.1|4686667_4687810_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000860025.1|4688054_4688975_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001328123.1|4689131_4690058_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012311907.1|4690257_4691151_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001172285.1|4691181_4692171_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001174452.1|4692197_4693049_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_096986500.1|4693614_4697868_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001361804.1|4697988_4698846_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001361805.1|4699093_4699963_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.6e-52
WP_001361806.1|4700124_4700718_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474078.1|4700729_4700966_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_096986501.1|4701074_4702400_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.6e-112
WP_096986502.1|4702626_4703481_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096986503.1|4704006_4704726_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_024704922.1|4704736_4706164_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370410.1|4706156_4706852_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_096986504.1|4707383_4709072_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	3.1e-60
WP_096986505.1|4709085_4710558_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295807.1|4710571_4711159_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_096986506.1|4711287_4713321_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	4.4e-21
>prophage 1
NZ_CP027448	Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence	170848	4878	92228	170848	integrase,transposase,protease	Stx2-converting_phage(35.71%)	57	25156:25184	71386:71414
WP_106901803.1|4878_5901_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000501973.1|6195_6681_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001352814.1|6668_6953_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_106901861.1|7343_8831_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_106901804.1|8935_9883_-|protease	omptin family outer membrane protease OmpP	protease	NA	NA	NA	NA
WP_106901805.1|10696_11122_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	76.3	7.3e-35
WP_000624720.1|11118_11469_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_061348415.1|13293_14730_-	alpha-hemolysin T1SS ABC transporter subunit HlyD	NA	NA	NA	NA	NA
WP_106901806.1|14748_16872_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.9	2.9e-47
WP_106901807.1|16943_20012_-	RTX toxin hemolysin HlyA	NA	NA	NA	NA	NA
WP_021569014.1|20023_20536_-	alpha-hemolysin-activating lysine-acyltransferase HlyC	NA	NA	NA	NA	NA
WP_106901808.1|25064_25148_-	hypothetical protein	NA	NA	NA	NA	NA
25156:25184	attL	TGTCAGCGCCAGTGATATAAGACGGTAAT	NA	NA	NA	NA
WP_106901809.1|26369_27347_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.8	1.4e-100
WP_001066941.1|27589_28330_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_106901862.1|28450_28621_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_106901810.1|30069_35007_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_069917678.1|35718_36411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064734886.1|38700_39375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032215196.1|39866_42080_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_032215195.1|42125_42515_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_069907188.1|44202_44907_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_032215191.1|47120_47309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032215190.1|47910_48324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032215189.1|48330_48909_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_069907187.1|49054_49471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069904603.1|49581_50637_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_106901811.1|52891_56422_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_106901812.1|56433_57609_-	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_032215042.1|59970_60225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077756518.1|60363_60531_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032215041.1|61834_62569_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159032886.1|63914_64010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159032887.1|63963_64161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106901814.1|64398_65073_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	31.6	9.5e-13
WP_032215038.1|65069_65417_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	4.5e-43
WP_072126895.1|67036_67189_+	anaerobic sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_089513792.1|67338_71238_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	32.1	1.3e-167
WP_147590341.1|71445_71667_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
71386:71414	attR	TGTCAGCGCCAGTGATATAAGACGGTAAT	NA	NA	NA	NA
WP_106901815.1|71690_72200_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	50.5	1.4e-21
WP_106901816.1|72196_72478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106901817.1|72621_72978_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159032888.1|74546_75887_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-18
WP_069906978.1|76214_76865_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.9	4.4e-15
WP_069906977.1|76864_77212_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	1.7e-45
WP_106901819.1|78838_79282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069907038.1|80607_80838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069907037.1|81584_82109_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_106901821.1|82165_84568_+	F4 (K88) fimbrial usher FaeD	NA	NA	NA	NA	NA
WP_069907035.1|84560_85352_+	F4 (K88) fimbrial chaperone FaeE	NA	NA	NA	NA	NA
WP_069907034.1|85386_85878_+	F4 (K88) fimbria minor subunit FaeF	NA	NA	NA	NA	NA
WP_069907033.1|86116_86887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069907032.1|87114_87912_+	F4 (K88) fimbria minor subunit FaeH	NA	NA	NA	NA	NA
WP_069907031.1|87942_88707_+	F4 (K88) fimbria minor subunit FaeI	NA	NA	NA	NA	NA
WP_077888280.1|89060_89396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106901822.1|90028_91255_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	32.9	1.4e-62
WP_106901823.1|91239_91884_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.5	9.6e-55
WP_106901824.1|91892_92228_-|transposase	transposase	transposase	NA	NA	NA	NA
