The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	39245	114785	5385516	portal,integrase,protease,terminase,head,tail,holin,transposase,capsid	Escherichia_phage(36.07%)	84	49991:50050	101943:103253
WP_001260835.1|39245_40067_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|40166_40250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|40342_40678_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|41074_42328_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|42434_43328_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|43462_44683_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|44807_45503_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071792357.1|45455_46748_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148724.1|46906_47521_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
WP_000526512.1|47563_48418_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213025.1|48419_49037_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	2.1e-75
49991:50050	attL	TTGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGAC	NA	NA	NA	NA
WP_085961182.1|50045_51258_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_072095802.1|51261_52785_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.7	7.4e-130
WP_000041657.1|52845_55272_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_001295396.1|55470_55776_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|55883_56594_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_106905594.1|56596_57157_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|57191_57533_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295394.1|58199_59414_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836060.1|59425_60445_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.7	1.0e-18
WP_072095801.1|60502_60613_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|60632_61928_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001368608.1|61947_62184_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_075865852.1|62271_64734_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.5	2.3e-125
WP_000199475.1|64826_65015_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|65011_65200_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|65764_65974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|65974_66613_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379563.1|66624_66777_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000362153.1|67042_67462_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|67562_67844_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|67827_68253_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095674.1|68275_69244_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000790459.1|69250_69991_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450861.1|70020_70791_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	1.2e-80
WP_022582018.1|70806_71199_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	5.9e-39
WP_001266130.1|71195_71492_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_000403779.1|72184_72541_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_000063625.1|72589_72802_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000555106.1|73002_73716_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.1	1.2e-34
WP_001278450.1|73831_73936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902693.1|74125_74338_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	6.8e-26
WP_072128871.1|74505_74784_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	3.7e-11
WP_001265167.1|74785_75835_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_024221875.1|75847_76207_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	8.0e-35
WP_106905595.1|76203_76803_+	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	9.3e-52
WP_085961182.1|76854_78067_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_032324269.1|78418_78616_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
WP_000483509.1|78767_79826_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_025380333.1|80469_82320_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411809.1|82767_82974_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_000731192.1|82978_83323_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992128.1|83373_83907_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_072095843.1|84063_84246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280927.1|84258_84390_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	76.7	9.7e-07
WP_071974579.1|84612_84819_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|84883_85108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453587.1|85556_86102_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027330.1|86076_88002_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|87998_88205_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|88201_89803_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123292.1|89783_91103_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001365129.1|91112_91445_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|91500_92526_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_022581670.1|92567_92963_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000752994.1|92974_93328_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_106905596.1|93339_93918_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	1.1e-78
WP_000683137.1|93914_94310_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|94317_95070_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479051.1|95083_95506_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533442.1|95532_95946_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000847298.1|98534_98864_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_097455664.1|98863_99562_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	2.0e-130
WP_061330346.1|99567_100311_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	1.4e-145
WP_085961182.1|100733_101947_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001230496.1|105990_106590_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
101943:103253	attR	GTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAAAAACACCGGAATACAGGGCAACGGATAACGGTAAACAGAACACGTACTTTTCGTCGCTGGATAACATGATTGCTCAGGGGAACCCGATGCCGGTGCCTTACGGTGAAATGCTGGTTGGCTCACGGCGAATCTCCCAGGACATCAGTACCCGTGATGAAGGCGGTGACGGGAAGGTGGTGGTTATCGGGCGGCAGGGGTAAAGCATAAAAAAATCCCGCAGTGTATGGAGGCTGCGGGAACAGAAAATGAAGATTAACCACAGGGAGTTTTGTTTTTATTGGCCCGAAAAAACTGTAACGCCCGGGAATGATATCTGCCACGGGGGCGTACAGAAAATGTGAAGAAATTCAGAAATTTTATTCCGTCATGACACAGGCACCCTCCGGGGTGCCTGTCGTTTTTGGGGCATAAACAGATTCAGACATCAGACAGGAGAGGGGGACAGAGTGGGTAAAGGTGGCGGCAGGGCGCACACGCCGGTAGAGGCAAAGGACAATCTTAAGTCCACGCAGATGATGAGCGTGATTGACGCCATTGGTGAAGGGCCGATTGAAGGTCCGGTGAAGGGGCTGCAGAGTATTCTGGTGAACAAAACCCCGCTGACGGACACGGACGGTAATCCTGTGATACATGGTGTGACAGCGGTCTGGCGCGCCGGGGAGCAGGAGCAGACACCGCCGGAAGGTTTTGAGTCATCCGGTTCTGAAACCGCACTGGGCGTGGAAGTGACGAAGGCAAAGCCGGTGACGCGCACCATTACGTCCGCGAACATTGACCGCCTGCGGGTCACCTTCGGGGTGCAGTCACTGTTGGAGACCACCTCAAAGGGCGACCGTAATCCCTCTTCTGTCCGACTGCTGATTCAGCTGCAGCGTAACGGTAACTGGGTGACGGAAAAGGATGTCACCATTAACGGCAAGACCACCTCGCAGTTTCTGGCGTCGGTGATTCTGGAGAATCTGCCTCCCCGTCCCTTTAACATCCGGATGGTCCGGGAGACGGCGGACAGCACCACGGACCAGCTGCAGAATAAGACGCTCTGGTCGTCATACACCGAAATCATCGATGTGAAACAGTGCTACCCGAACACGGCCATTGTGGGGCTGCAGGTGGATGCGGAGCAGTTCGGCGGCCAGCAGATGACGGTGAACTACCATATCCGCGGTCGCATCATCCAGGTGCCGTCAAACTATGACCCGGAAAAACGCACGTACAGCGGTATCTGGGACGGCAGTCTGAAACCGGCATACA	NA	NA	NA	NA
WP_106905597.1|106654_107968_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	1.7e-77
WP_001023400.1|107969_108239_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	7.1e-44
WP_122988840.1|108349_108427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|108641_109655_+	peptidase M85	NA	NA	NA	NA	NA
WP_096846665.1|110025_110340_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_106873538.1|110742_111956_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
WP_000527802.1|113085_114546_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_000214712.1|114581_114785_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 2
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	302223	362696	5385516	portal,integrase,tRNA,head,terminase,tail,holin,transposase,capsid	Escherichia_phage(50.79%)	71	340598:340613	363048:363063
WP_000837918.1|302223_303357_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	2.4e-117
WP_001295593.1|303497_303932_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_122988840.1|305968_306046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101700.1|306156_306426_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_106905600.1|306427_307741_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001216290.1|307805_308429_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106905601.1|308497_311974_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.5	0.0e+00
WP_159032317.1|312220_312853_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	91.4	1.7e-96
WP_025404499.1|312798_313542_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_097455664.1|313547_314246_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	2.0e-130
WP_000847298.1|314245_314575_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001358663.1|317122_318319_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000533442.1|318614_319028_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|319054_319477_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|319490_320243_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|320250_320646_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_106905596.1|320642_321221_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	1.1e-78
WP_000752994.1|321232_321586_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_022581670.1|321597_321993_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000063258.1|322034_323060_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|323115_323448_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123292.1|323457_324777_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001443752.1|324757_326359_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|326355_326562_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027330.1|326558_328484_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|328458_329004_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001303940.1|329392_329617_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|329698_330013_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|330538_330724_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|330946_331093_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|331092_331662_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|331932_332466_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|332516_332861_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411802.1|332865_333072_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000466957.1|335940_336372_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301789.1|336821_337535_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|337669_337867_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000211416.1|338110_338692_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000640148.1|338965_339520_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000228019.1|339516_339807_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_106905603.1|339806_340181_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	88.7	1.1e-58
WP_085947970.1|340264_341477_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
340598:340613	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_071525388.1|341790_342042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967410.1|342278_342491_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_001278450.1|342679_342784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610382.1|342899_343253_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.8	3.2e-36
WP_029594466.1|343249_343594_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	93.5	2.0e-46
WP_000063625.1|343657_343870_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000761449.1|343918_344332_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	6.6e-57
WP_001118155.1|344332_344728_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_032313847.1|344743_345514_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	5.7e-86
WP_000788990.1|345535_346282_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_000702023.1|347169_347592_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_001033914.1|347588_347831_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|347927_348347_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379546.1|348652_348805_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_000394548.1|348816_349455_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|349455_349665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560227.1|350234_350456_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_001359121.1|350455_350626_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
WP_001519830.1|350700_350976_+	phage protein	NA	A0A0U2QW85	Escherichia_phage	92.3	4.9e-40
WP_000102216.1|351077_354203_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	82.8	0.0e+00
WP_001004423.1|354214_355267_+	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.3	1.4e-116
WP_021500490.1|355330_355525_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001298826.1|355517_355706_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|355805_356021_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040838.1|356022_357258_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.3	1.1e-240
WP_001157377.1|357310_358246_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123735.1|358374_359748_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	6.6e-53
WP_000387388.1|360225_361209_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001401302.1|361463_362696_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	1.8e-17
363048:363063	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
>prophage 3
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	446338	505977	5385516	integrase,protease,terminase,head,tail,transposase,capsid	Stx2-converting_phage(33.33%)	61	462154:462181	506114:506141
WP_000422045.1|446338_447388_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|447607_448366_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278904.1|448362_448953_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291215.1|448992_449868_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_022581766.1|450080_451976_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|452003_452624_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285684.1|452620_453502_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|453639_453684_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_000763498.1|455336_456932_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_024221648.1|456935_458294_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|458305_459499_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443065.1|459498_460305_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807658.1|460685_460865_+	general stress protein	NA	NA	NA	NA	NA
WP_001056550.1|460950_461451_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|461496_462003_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
462154:462181	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|462504_462723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|465485_466076_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001401309.1|466259_466907_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.6	1.9e-42
WP_001414184.1|467043_467190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|467617_467896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106873533.1|469197_472671_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_050439450.1|473013_473646_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194723.1|473591_474335_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_032162053.1|474345_475044_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	97.0	1.2e-130
WP_000807954.1|475043_475385_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_025380485.1|475377_478620_-|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.8	0.0e+00
WP_001453698.1|478671_478881_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|478976_479351_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_022581165.1|479356_480073_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	1.2e-125
WP_000133393.1|480140_480485_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|480481_480928_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|480924_481275_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125988.1|481285_481612_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001074112.1|484299_484521_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
WP_022581168.1|484565_486503_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.1	0.0e+00
WP_062881144.1|486566_488228_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.5	0.0e+00
WP_025380492.1|488224_488788_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	5.2e-89
WP_001358663.1|489293_490490_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001059384.1|491039_491729_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|491725_492091_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|492091_493147_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|493148_493427_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|493496_493754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|493974_494187_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|494465_495224_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|495921_496086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|496082_496817_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_157832601.1|496850_497393_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020557.1|497304_498345_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	86.7	3.9e-90
WP_000705622.1|498316_498868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|498851_499079_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|499155_499563_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|499827_500127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|500199_500418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|500440_500848_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|500825_501059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|501052_501220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|501619_501808_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|501804_501993_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000113189.1|504620_504869_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|504846_505977_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
506114:506141	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 4
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	618923	690699	5385516	integrase,tRNA,terminase,head,tail,holin,transposase,capsid	Stx2-converting_phage(36.17%)	76	663671:663686	700423:700438
WP_001353282.1|618923_620030_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|620065_620707_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|620710_622081_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265481.1|622249_622921_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|622920_624381_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|624982_625264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|625520_626063_-|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224599.1|626268_626682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380886.1|626694_627030_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907455.1|627042_628098_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000796958.1|628097_628304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|628555_628780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|628906_629179_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|629189_629600_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|629596_629848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833618.1|630048_631449_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000770178.1|631445_631745_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204985.1|631750_631984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|631976_632441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|632430_632643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|632635_632833_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000106745.1|632963_633137_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_125090562.1|633261_633588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000953272.1|633637_633826_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085256.1|634190_635420_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001295435.1|635668_636790_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|636838_638065_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|638314_639451_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799400.1|639434_640298_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|640661_642023_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|642083_642359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|642438_642564_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_085961182.1|643290_644503_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_106905606.1|645980_649382_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	2.9e-219
WP_001301673.1|649972_652321_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|652340_652430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024262417.1|652536_652806_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	5.4e-44
WP_106873504.1|652807_654121_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_045895398.1|654185_654785_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	98.5	7.5e-110
WP_106905607.1|654851_658328_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	97.2	0.0e+00
WP_097455678.1|658568_659198_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	3.5e-102
WP_001303040.1|659143_659881_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_000835336.1|659934_660813_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000410309.1|661076_661229_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|661338_661593_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_032162127.1|661609_662308_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	1.8e-131
WP_032313828.1|662307_662649_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	1.5e-62
WP_106873583.1|662641_665884_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.0	0.0e+00
663671:663686	attL	CAGTTCACCCAGCGCT	NA	NA	NA	NA
WP_122994012.1|665931_666141_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	7.4e-33
WP_001030047.1|666236_666611_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001275505.1|666616_667333_-	hypothetical protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_000133391.1|667391_667736_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|667732_668179_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|668175_668526_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125968.1|668536_668863_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	98.1	2.7e-53
WP_001063027.1|671389_671611_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	98.6	9.9e-36
WP_106873582.1|671655_673593_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_025404317.1|673656_675318_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.2	0.0e+00
WP_000958392.1|675314_675878_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001372000.1|676166_676532_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.6e-62
WP_001302977.1|676573_676759_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|676888_677029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|677385_677610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|677674_677881_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001003112.1|678527_679061_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_000138558.1|679220_679493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|679748_679955_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000143049.1|680247_682098_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|683268_684090_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_032162108.1|684086_684461_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	6.4e-35
WP_001265233.1|684473_685523_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_032162212.1|685524_685803_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_106873538.1|686133_687346_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	2.5e-168
WP_077793350.1|687343_689281_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	6.7e-59
WP_000003742.1|689342_689612_+	excisionase	NA	NA	NA	NA	NA
WP_022581747.1|689580_690699_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	3.5e-84
700423:700438	attR	AGCGCTGGGTGAACTG	NA	NA	NA	NA
>prophage 5
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	847478	958509	5385516	portal,integrase,lysis,bacteriocin,terminase,tail,holin,transposase,capsid	Escherichia_phage(76.47%)	114	878845:878862	962218:962235
WP_085961182.1|847478_848691_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001142971.1|849122_849797_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|849797_850262_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000467898.1|850271_851942_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612148.1|851967_852288_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|852296_852599_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_159032318.1|852613_853387_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000591994.1|854266_855886_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|855978_856338_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|857023_857314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085961182.1|857559_858772_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_101892115.1|858738_860667_+	fimbrial biogenesis outer membrane usher protein	NA	A0A0N7BTS3	Escherichia_phage	86.2	4.2e-05
WP_001400598.1|860682_862017_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000843912.1|862013_862703_+	molecular chaperone	NA	NA	NA	NA	NA
WP_000010421.1|862848_863631_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.4	6.5e-13
WP_000639306.1|864317_865130_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000194267.1|865134_865626_+	FidL-like protein	NA	NA	NA	NA	NA
WP_024221542.1|865725_867240_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287449.1|867607_870031_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000610456.1|872049_873375_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|873376_873790_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000258771.1|873839_874904_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	8.1e-91
WP_000154383.1|876425_877553_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|877610_878441_-	FTR1 family protein	NA	NA	NA	NA	NA
878845:878862	attL	TGAGCGATTTTTGATAGT	NA	NA	NA	NA
WP_001247494.1|879623_880967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905614.1|881115_882624_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|882782_882992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001400597.1|883046_887009_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001400596.1|887048_887687_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001307708.1|889064_889757_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|889768_890155_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001400595.1|890162_890963_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001189.1|890972_891563_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|891573_892068_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001400594.1|892088_893417_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	3.8e-231
WP_001273658.1|893499_893673_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_100031069.1|894604_902986_-	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	97.6	0.0e+00
WP_000012448.1|903054_904320_-	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	99.0	3.4e-205
WP_000540391.1|904330_904582_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455649.1|904591_905038_-	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000509481.1|905040_905697_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000035558.1|905790_906192_-	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000078907.1|906248_906389_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835360.1|906621_907356_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_001301884.1|907446_908064_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000455634.1|908069_908348_-	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_000197192.1|908362_909631_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_001146326.1|909627_911253_-	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_001303606.1|911545_911734_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_025380479.1|911871_912141_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_086259215.1|914075_914726_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	99.5	5.1e-120
WP_000829200.1|914725_915289_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_001290743.1|915272_915734_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_001140442.1|915783_916173_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_000214474.1|916228_917443_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345010.1|917466_918474_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787519.1|918631_920776_-|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000143988.1|920775_922482_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086069.1|922462_923269_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_001301714.1|923324_923528_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_000738505.1|923677_923971_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001082654.1|924002_924467_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000455406.1|924474_924624_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|924623_925193_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000087461.1|925467_926001_-	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_000284506.1|926005_926221_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290217.1|926297_926570_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143462.1|926610_926790_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_106905615.1|926925_928863_-	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.5	0.0e+00
WP_000738068.1|929348_929618_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|929629_930589_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|930971_931124_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|931372_931807_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|931799_931994_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|931990_932554_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|932561_933011_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001260358.1|933010_933982_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000913116.1|933971_935492_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001271433.1|935485_935863_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|936029_936224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|936394_936598_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|936693_937407_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|937501_938971_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|938967_939921_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_016051777.1|940537_941323_+	regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001369605.1|941578_942253_+	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_000934197.1|942547_942829_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_000995345.1|942849_943131_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000459721.1|943147_944098_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_106905616.1|944094_944784_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	99.6	2.9e-134
WP_106905617.1|944783_945365_+	DUF669 domain-containing protein	NA	A0A0N7KZV4	Escherichia_phage	99.0	3.1e-105
WP_001071603.1|945439_945787_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|945850_946672_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_062891081.1|946748_947192_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	98.6	7.3e-78
WP_106905618.1|947299_948178_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	99.3	7.2e-178
WP_000157000.1|948174_948378_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_106905619.1|948370_948610_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	96.2	2.6e-37
WP_085961182.1|948879_950093_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_106905620.1|950234_950645_+	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	98.4	6.5e-73
WP_000403783.1|950622_950979_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|951029_951242_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|951275_951458_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|951623_952259_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_106905621.1|952346_952565_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	97.2	4.3e-31
WP_000212746.1|952566_952854_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_047081478.1|952857_953481_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	96.1	3.6e-115
WP_106905622.1|953836_954475_+	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.1	1.6e-118
WP_000809302.1|954530_954962_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_106905623.1|954958_955585_+	adenine methylase	NA	G9L6F9	Escherichia_phage	99.5	5.2e-122
WP_001291843.1|955544_955757_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994798.1|955792_956200_+	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	81.5	2.0e-50
WP_000497812.1|956564_956816_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208772.1|956861_957146_+	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_044191060.1|957198_958509_+|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	99.3	2.0e-253
962218:962235	attR	ACTATCAAAAATCGCTCA	NA	NA	NA	NA
>prophage 6
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	989059	1091735	5385516	portal,integrase,protease,head,terminase,tail,holin,transposase,capsid,plate	Escherichia_phage(32.08%)	89	1022008:1022067	1090480:1091789
WP_000003670.1|989059_989647_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|989643_990351_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|990369_992163_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|992159_993278_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001443410.1|993894_994278_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_112077135.1|994723_995899_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001401301.1|996025_996274_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	96.3	2.8e-39
WP_106905624.1|996295_997627_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	2.0e-78
WP_045894001.1|997691_998291_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	97.5	5.3e-108
WP_000649829.1|1001945_1002473_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_052915903.1|1002663_1003296_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	7.1e-103
WP_001357740.1|1003988_1004687_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404276.1|1004686_1005016_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
WP_000479105.1|1008010_1008442_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001357739.1|1008455_1009208_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000683066.1|1009215_1009611_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|1009607_1010141_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_159032315.1|1010265_1010508_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_000201523.1|1010500_1010875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|1010926_1011955_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_001253961.1|1012395_1013901_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000831765.1|1013890_1015483_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259002.1|1015479_1015686_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001300238.1|1015669_1017598_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
WP_000235436.1|1017569_1018079_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|1018480_1018705_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|1018786_1019101_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1019628_1019814_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280929.1|1020041_1020173_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|1020185_1020368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992157.1|1020523_1021057_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	3.1e-99
WP_000731192.1|1021107_1021452_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000411809.1|1021456_1021663_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
1022008:1022067	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_085961182.1|1022049_1023263_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001368722.1|1025601_1026033_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|1026483_1027197_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|1027331_1027529_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|1027753_1028308_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217447.1|1028316_1028676_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|1028688_1029738_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1029739_1030012_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1030133_1030478_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1030597_1030810_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1031043_1031601_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1031602_1031821_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|1031948_1032260_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|1032252_1032480_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_042353845.1|1032476_1032758_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000450617.1|1032790_1033507_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_085953672.1|1034230_1035444_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_001262348.1|1035594_1036677_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000693858.1|1036748_1037174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747948.1|1037157_1037400_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|1037791_1038130_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_001345283.1|1038422_1038575_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000394546.1|1038586_1039225_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1039225_1039435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1040005_1040194_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1040190_1040382_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_085953785.1|1041620_1042834_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_000096346.1|1044318_1044522_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533625.1|1044521_1045547_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001302302.1|1045782_1046580_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000055685.1|1046917_1048180_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	3.8e-71
WP_001242259.1|1051171_1051444_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_000983666.1|1051594_1051849_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	1.0e-12
WP_000235844.1|1051845_1052307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022581241.1|1052642_1053704_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000075767.1|1055830_1057945_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.1	2.2e-23
WP_000727981.1|1057949_1058369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284344.1|1058340_1059609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001202999.1|1059687_1059969_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000477874.1|1069249_1070302_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378561.1|1070616_1071933_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060259.1|1072034_1073489_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_022581204.1|1073831_1074548_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122985555.1|1075180_1076824_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011039.1|1076941_1077892_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011447.1|1077993_1078911_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001310930.1|1079368_1080304_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193786.1|1080365_1081445_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|1081456_1082200_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|1082196_1082742_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_000609174.1|1084636_1084984_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|1084980_1085364_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_001313066.1|1085548_1085728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000514100.1|1086931_1088083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001069811.1|1088166_1089039_+	GTPase family protein	NA	NA	NA	NA	NA
WP_085961182.1|1090521_1091735_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
1090480:1091789	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTTCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCGCCTGTACTTCCTGTTGATGCCAGTAATCCGGCTTCCTTAAGCCGCTGTGTGTAGGCCAGCGATACATACTGAGAACCTTTATCACTGTGATGGACCGTGCCGGACGGTCGACGGGCCCATAACGCCTGCTCCAGTGCATCCAGCACGAATGTCGTCTCCATGGACGATGAGACCCGCCACCCCACAATGTATCCGGCAAACACATCAATGATGAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACAGTGCATCTGGCCACTCTGATACCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTATACCTTGTGATTTTCATCGTATACGCGCTGTATCTCTTTCTTCAGCCAGTCATCGCGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAGTGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATAGCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGCTCCAGCTCTTTCAGACGCTGACGTTCAGCGGTGGTGAGCCCTCCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGAGCAATGGAACAAATTGTCGCCCATTGTGAGTCATATTCGCCCTGACTTTCCAGAACCATACGGACTGCCCGTTGACGGACTTCAGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCA	NA	NA	NA	NA
>prophage 7
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	1190800	1291886	5385516	tRNA,lysis,head,terminase,tail,holin,transposase,capsid	Enterobacteria_phage(35.42%)	89	NA	NA
WP_000476014.1|1190800_1192162_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001318299.1|1192492_1192810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|1193215_1194115_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_000178552.1|1194196_1194976_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000823260.1|1197521_1197806_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|1197836_1198289_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853896.1|1198298_1199561_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|1199589_1200444_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|1200751_1201804_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858489.1|1202060_1203338_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846214.1|1203334_1204339_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	30.0	2.6e-14
WP_000011993.1|1204335_1205301_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1205274_1206021_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351783.1|1206072_1206891_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822274.1|1206955_1207756_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195570.1|1207752_1208541_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|1208763_1209036_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000133660.1|1209155_1209980_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153074.1|1210198_1210537_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000405695.1|1210618_1211653_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945452.1|1211668_1214149_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677393.1|1214164_1214839_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830457.1|1214918_1215461_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|1215753_1216035_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|1216297_1217407_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001400694.1|1217538_1219572_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001556120.1|1223516_1227149_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636925.1|1227209_1227527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300974.1|1227833_1228922_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294387.1|1228932_1231212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333512.1|1231204_1232341_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001400695.1|1232337_1234338_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|1234462_1234924_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|1234963_1235434_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|1235480_1236200_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1236196_1237882_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001261971.1|1238396_1238645_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	100.0	2.4e-38
WP_085961182.1|1239404_1240617_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_024173613.1|1240987_1241371_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	100.0	1.1e-66
WP_001025673.1|1242022_1243264_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.7	3.2e-216
WP_024262412.1|1244256_1244526_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	7.1e-44
WP_106905628.1|1244527_1245841_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.9	1.8e-76
WP_001230489.1|1245905_1246505_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_106905629.1|1246572_1250052_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	88.7	0.0e+00
WP_097455678.1|1250292_1250922_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.7	3.5e-102
WP_045895598.1|1250867_1251611_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	3.6e-146
WP_106905630.1|1251621_1252320_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	96.6	1.3e-129
WP_000807954.1|1252319_1252661_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_106905631.1|1252653_1255896_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.6	0.0e+00
WP_122994012.1|1255943_1256153_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	7.4e-33
WP_001030047.1|1256248_1256623_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_106905632.1|1256628_1257345_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_000133393.1|1257412_1257757_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|1257753_1258200_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|1258196_1258547_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125988.1|1258557_1258884_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001074112.1|1261572_1261794_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	95.9	3.2e-34
WP_022581168.1|1261838_1263776_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.1	0.0e+00
WP_062881144.1|1263839_1265501_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.5	0.0e+00
WP_000958387.1|1265497_1266061_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000829192.1|1266349_1266715_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|1266756_1266957_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|1267088_1267415_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012816791.1|1267815_1268001_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280923.1|1268223_1268355_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000661708.1|1268449_1269145_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	98.7	3.6e-124
WP_000992065.1|1269418_1269952_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	6.2e-100
WP_000731192.1|1270002_1270347_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000411809.1|1270351_1270558_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_106873535.1|1270851_1272702_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_000466924.1|1273188_1273620_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_022581947.1|1273809_1273998_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	66.7	7.9e-18
WP_085961182.1|1274071_1275284_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001216963.1|1275827_1275935_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1275915_1276647_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|1276651_1277578_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000220837.1|1277570_1278728_-	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_001130308.1|1278734_1279652_-	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000871507.1|1279862_1282160_-	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_000097402.1|1282355_1284071_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001319943.1|1284108_1285041_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_001295454.1|1285214_1285802_-	YIP1 family protein	NA	NA	NA	NA	NA
WP_001296821.1|1285971_1286550_+	DedA family protein	NA	NA	NA	NA	NA
WP_000079538.1|1286679_1287441_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001078139.1|1287493_1288930_-	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000691708.1|1289153_1289237_+	protein YohP	NA	NA	NA	NA	NA
WP_001264861.1|1289609_1290557_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_001295452.1|1290795_1291194_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000968208.1|1291190_1291886_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
>prophage 8
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	1789171	1795484	5385516	tail	Enterobacteria_phage(57.14%)	7	NA	NA
WP_000162574.1|1789171_1789654_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|1790502_1790751_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001121225.1|1791344_1791995_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491541.1|1792219_1793095_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.6	2.8e-158
WP_001023407.1|1793235_1793505_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_106905636.1|1793506_1794820_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.9	6.3e-77
WP_001230532.1|1794884_1795484_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
>prophage 9
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	2096279	2106868	5385516	integrase	Enterobacteria_phage(88.89%)	12	2091841:2091853	2110021:2110033
2091841:2091853	attL	ACGATCCGCGCGT	NA	NA	NA	NA
WP_025404448.1|2096279_2098613_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_000856729.1|2098627_2098948_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459319.1|2099083_2099539_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244665.1|2099531_2099819_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025404449.1|2099811_2100402_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	97.0	4.5e-67
WP_001149160.1|2100398_2100665_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283035.1|2101216_2101951_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
WP_000638631.1|2101947_2102448_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446132.1|2102521_2103094_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000611230.1|2103404_2103827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000220867.1|2103823_2105695_-	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	21.7	5.3e-13
WP_001218984.1|2105704_2106868_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.9	2.9e-203
2110021:2110033	attR	ACGCGCGGATCGT	NA	NA	NA	NA
>prophage 10
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	2903484	2913875	5385516	integrase	Enterobacteria_phage(100.0%)	10	2896871:2896883	2908611:2908623
2896871:2896883	attL	AACGCCTGAAAGG	NA	NA	NA	NA
WP_001218986.1|2903484_2904660_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	93.0	1.3e-211
WP_000503665.1|2904664_2905573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446137.1|2907052_2907625_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000638631.1|2907698_2908199_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283035.1|2908195_2908930_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	2.7e-130
2908611:2908623	attR	CCTTTCAGGCGTT	NA	NA	NA	NA
WP_001149160.1|2909481_2909748_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001244665.1|2910335_2910623_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459319.1|2910615_2911071_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|2911206_2911527_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_044788993.1|2911541_2913875_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
>prophage 11
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	3183795	3267950	5385516	portal,integrase,tRNA,lysis,protease,terminase,head,tail,holin,capsid,plate	Escherichia_phage(35.56%)	90	3216793:3216839	3250475:3250521
WP_000560983.1|3183795_3184233_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001343389.1|3184277_3185219_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|3188118_3188337_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086385.1|3188553_3188796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|3189125_3190055_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|3190051_3190687_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|3190683_3191586_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077697102.1|3191598_3194649_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753595.1|3194842_3195676_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001400645.1|3195828_3196884_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931324.1|3196933_3198682_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019458.1|3198681_3199752_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446023.1|3199741_3201193_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729614.1|3201203_3201650_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000749945.1|3202127_3203522_+	glycoporin	NA	NA	NA	NA	NA
WP_000619508.1|3203562_3203877_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179715.1|3203886_3204711_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211504.1|3205161_3206421_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144078.1|3206417_3207887_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217141.1|3208174_3209011_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001362440.1|3208994_3209933_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|3209929_3210964_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|3211248_3211869_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_022581810.1|3212128_3213112_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270249.1|3213260_3213935_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580424.1|3214050_3215424_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
WP_001033722.1|3215420_3216119_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|3216268_3216769_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3216793:3216839	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023384.1|3216954_3217935_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	100.0	4.7e-186
WP_001192857.1|3218004_3218298_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|3218450_3218723_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|3218892_3219393_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3219456_3219681_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|3219680_3219980_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113264.1|3219982_3220207_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027676.1|3220203_3220479_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	8.6e-45
WP_000268590.1|3220468_3222775_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
WP_029594353.1|3222753_3223206_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.0	3.0e-79
WP_001540306.1|3223690_3224629_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	97.8	7.2e-184
WP_000688782.1|3224629_3225622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140373.1|3225608_3226727_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	99.7	5.8e-172
WP_000038178.1|3227102_3228137_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	9.3e-201
WP_000156875.1|3228136_3229909_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085958.1|3230082_3230937_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.8	3.4e-140
WP_001248561.1|3230995_3232069_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
WP_000203465.1|3232072_3232816_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	97.2	1.9e-123
WP_000988633.1|3232915_3233425_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|3233424_3233628_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123124.1|3233631_3233913_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|3233912_3234410_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736594.1|3234424_3234850_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	96.5	2.5e-59
WP_000040677.1|3234837_3235281_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.1e-65
WP_000917157.1|3235370_3235838_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	3.3e-81
WP_001001792.1|3235830_3236283_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	9.1e-76
WP_000255497.1|3236354_3237140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093705.1|3237223_3237859_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_000127173.1|3237855_3238203_+|plate	baseplate assembly protein W	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121506.1|3238207_3239116_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	4.8e-161
WP_001285314.1|3239108_3239639_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_000104679.1|3239649_3241578_+	hypothetical protein	NA	U5N099	Enterobacteria_phage	71.2	6.6e-224
WP_000930007.1|3241546_3242110_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	93.6	1.9e-86
WP_000796111.1|3242361_3243429_-	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_001286678.1|3243762_3244953_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.6e-223
WP_001251408.1|3244965_3245484_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|3245540_3245816_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3245848_3245968_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069943.1|3245960_3248408_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.2	0.0e+00
WP_000978881.1|3248422_3248902_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	4.3e-84
WP_000887624.1|3248901_3250065_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	98.7	2.0e-204
WP_000468308.1|3250145_3250364_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|3250599_3251502_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3250475:3250521	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|3251682_3252645_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|3252963_3253953_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708998.1|3254059_3254815_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|3254869_3255637_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|3255744_3256344_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|3256444_3256885_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655983.1|3257096_3257396_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|3257422_3257851_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796310.1|3257855_3258602_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250650.1|3258698_3259709_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|3259938_3261447_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|3261469_3262315_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3262740_3262986_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000232687.1|3263024_3263651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024221530.1|3263773_3264448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000872908.1|3264507_3264993_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001308187.1|3265085_3266012_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|3266078_3267410_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|3267419_3267950_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 12
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	3501584	3567766	5385516	transposase,integrase,tRNA	Enterobacteria_phage(50.0%)	42	3514735:3514749	3569048:3569062
WP_085961182.1|3501584_3502798_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_032245854.1|3502835_3504158_+	melibiose:sodium transporter MelB	NA	NA	NA	NA	NA
WP_000198746.1|3504296_3504926_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_000066681.1|3505048_3506695_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_000899522.1|3506772_3508113_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000611288.1|3508683_3509403_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_022581427.1|3509399_3511031_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_000371704.1|3511211_3511442_+	4Fe-4S mono-cluster protein YjdI	NA	NA	NA	NA	NA
WP_000405653.1|3511453_3511726_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000398619.1|3511952_3512249_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_001173343.1|3512276_3512450_+	type V toxin-antitoxin system toxin GhoT	NA	NA	NA	NA	NA
WP_001295074.1|3512568_3514086_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856822.1|3514322_3515780_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	1.5e-47
3514735:3514749	attL	AAGCCAAAGGCAAAC	NA	NA	NA	NA
WP_001295383.1|3515838_3517986_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|3518065_3519400_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187177.1|3519765_3521304_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_085961182.1|3521793_3523007_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001378240.1|3523229_3525746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000820468.1|3525866_3528986_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069684.1|3529313_3530186_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001297234.1|3531409_3532894_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000804452.1|3533215_3533818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323667.1|3533904_3534183_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_071529669.1|3534862_3535012_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221499.1|3535830_3536400_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271016.1|3536658_3537060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221627.1|3537047_3537482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032162123.1|3538869_3540027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170152.1|3540741_3541935_-	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_000781202.1|3541949_3542594_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000196044.1|3542602_3543304_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000131689.1|3543319_3544348_-	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000194235.1|3544359_3545718_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000024636.1|3545844_3546753_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000950651.1|3548255_3548648_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_085961182.1|3549704_3550917_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000609742.1|3557565_3558240_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953025.1|3558288_3559278_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
WP_001121622.1|3559884_3561534_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001375513.1|3563196_3564816_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|3564812_3566384_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|3566500_3567766_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
3569048:3569062	attR	GTTTGCCTTTGGCTT	NA	NA	NA	NA
>prophage 13
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	3817806	3882466	5385516	portal,integrase,tRNA,protease,terminase,tail,transposase	Enterobacteria_phage(57.14%)	65	3817009:3817023	3829938:3829952
3817009:3817023	attL	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_001218292.1|3817806_3819030_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.5	1.2e-234
WP_000059336.1|3819130_3819583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000542348.1|3819624_3820107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024221786.1|3820396_3820993_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	93.4	6.1e-112
WP_085961182.1|3821062_3822275_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000934114.1|3822521_3824624_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|3824620_3824833_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985947.1|3824832_3826341_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001136588.1|3826285_3828313_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097042.1|3828399_3828723_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	3.2e-51
WP_001283153.1|3828715_3828991_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677102.1|3829002_3829581_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_024221681.1|3829577_3829979_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	5.4e-72
3829938:3829952	attR	GCGATGGCGGAAATC	NA	NA	NA	NA
WP_000211121.1|3829989_3830733_+|tail	tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_001372042.1|3830793_3831180_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_001161009.1|3831188_3831518_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372002.1|3831489_3834555_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	97.0	0.0e+00
WP_000447248.1|3834554_3834884_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001152362.1|3834893_3835592_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.8	1.6e-132
WP_001400852.1|3835596_3836340_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.7e-149
WP_025380703.1|3836237_3836885_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.5e-111
WP_025380704.1|3836945_3840344_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_021530825.1|3840410_3841010_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	2.8e-109
WP_021530826.1|3841074_3844428_+|tail	phage tail fiber assembly protein	tail	X2KTY7	Enterobacteria_phage	37.3	2.1e-12
WP_000885593.1|3844427_3845003_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	5.0e-103
WP_000086527.1|3845100_3845691_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836769.1|3846069_3846303_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|3846371_3846485_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|3846911_3847160_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|3847379_3848966_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|3849358_3849964_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3850090_3850252_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|3850373_3851447_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563041.1|3851443_3852226_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088413.1|3852641_3853505_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143274.1|3853476_3855027_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001400453.1|3855284_3856064_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|3856190_3857513_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816471.1|3857564_3858788_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|3858844_3859564_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566150.1|3859724_3859988_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000105868.1|3860019_3861036_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|3861063_3861708_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|3861813_3862782_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|3862830_3864213_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093814.1|3864233_3865466_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	3.6e-82
WP_071792351.1|3865692_3865884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848792.1|3865932_3866145_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001140838.1|3866302_3866719_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000762717.1|3866744_3867542_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000023621.1|3867561_3868572_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000566332.1|3868705_3869593_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000046749.1|3869746_3871414_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409478.1|3871624_3873562_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068685.1|3873650_3873977_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001341279.1|3874061_3874583_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942344.1|3874634_3875282_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371688.1|3875278_3876148_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3876358_3876832_+	protein CreA	NA	NA	NA	NA	NA
WP_001188659.1|3876844_3877534_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219595.1|3877533_3878958_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	3.6e-09
WP_000920313.1|3879015_3880368_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3880427_3881144_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|3881239_3881380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223166.1|3881779_3882466_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	4434790	4504899	5385516	portal,lysis,protease,tRNA,terminase,head,tail,transposase,capsid	Enterobacteria_phage(52.94%)	66	NA	NA
WP_001295836.1|4434790_4435414_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|4435384_4436071_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001158010.1|4439192_4440287_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|4440355_4441282_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|4441510_4441993_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|4442070_4442886_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001400908.1|4442975_4444757_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	5.1e-37
WP_000943556.1|4444769_4445546_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765827.1|4445645_4446524_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401139.1|4446692_4448147_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006964.1|4448206_4449568_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|4449624_4450926_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000706340.1|4450947_4452102_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.5	6.0e-47
WP_000540946.1|4452230_4453016_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001400909.1|4453026_4454262_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_022581656.1|4454283_4455330_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580825.1|4455647_4457315_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_022581657.1|4457324_4458584_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|4458594_4459410_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855366.1|4459406_4460300_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815564.1|4460436_4461504_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|4461500_4462010_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212266.1|4462127_4462850_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|4462852_4463347_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|4463520_4464906_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143551.1|4464941_4465463_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4465570_4465783_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|4465784_4466651_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001400910.1|4467120_4467663_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|4467882_4468575_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001400911.1|4468605_4471215_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691070.1|4471227_4472235_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255119.1|4472245_4472761_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|4472763_4473396_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_085961182.1|4474300_4475514_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001135277.1|4475676_4476174_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4476390_4476573_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|4476663_4476957_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_032347049.1|4477317_4477512_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	2.2e-26
WP_000453587.1|4477900_4478446_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027330.1|4478420_4480346_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|4480342_4480549_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|4480545_4482147_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123292.1|4482127_4483447_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001365129.1|4483456_4483789_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|4483844_4484870_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_022581670.1|4484911_4485307_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000752994.1|4485318_4485672_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_106905596.1|4485683_4486262_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	1.1e-78
WP_000683138.1|4486258_4486654_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001342267.1|4486661_4487402_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|4487417_4487840_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|4487821_4488256_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_123001994.1|4490053_4490827_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.6	2.8e-117
WP_000847347.1|4490823_4491153_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152619.1|4491152_4491851_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194780.1|4491856_4492600_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|4492536_4493169_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_025404253.1|4493229_4496727_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_001233090.1|4496797_4497397_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_025404254.1|4497461_4500422_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885574.1|4500421_4501006_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|4501060_4501729_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|4501785_4502091_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|4502274_4503759_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|4503945_4504899_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 15
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	4717669	4748608	5385516	portal,integrase,lysis,terminase,head,tail,holin,transposase,capsid	Enterobacteria_phage(46.88%)	38	4711009:4711068	4719832:4720522
4711009:4711068	attL	AGTGGCCAGATGCACTGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCG	NA	NA	NA	NA
WP_000533643.1|4717669_4718740_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|4718717_4718936_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|4718975_4719143_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_085961182.1|4719266_4720479_+|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_064758453.1|4720445_4720580_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.0e-06
4719832:4720522	attR	AGTGGCCAGATGCACTGTGGCACGTCTCATGGCGGTTATGGGACTTGCCGGTGTTCTCCGGGGTAAAAAGGTCCGTACGACCATCAGCCGGAAAGCCGTTGCCGCAGGCGACCGCGTAAACCGTCAGTTCGTGGCAGAACGACCTGACCAGCTGTGGGTGGCTGATTTTACTTACGTCAGCACATGGCAGGGCTTCGTCTATGTGGCGTTCATCATTGATGTGTTTGCCGGATACATTGTGGGGTGGCGGGTCTCATCGTCCATGGAGACGACATTCGTGCTGGATGCACTGGAGCAGGCGTTATGGGCCCGTCGACCGTCCGGCACGGTCCATCACAGTGATAAAGGTTCTCAGTATGTATCGCTGGCCTACACACAGCGGCTTAAGGAAGCCGGATTACTGGCATCAACAGGAAGTACAGGCGACTCGTATGACAACGCGATGGCGGAGAGCATCAATGGTCTTTACAAAGCGGAGGTAATACACCGTAAGAGCTGGAAAAACCGTGCAGAAGTGGAACTGGCCACACTCACGTGGGTGGACTGGTATAACAATCGACGATTGCTGGAAAGGCTGGGCCATACTCCTCCGGCAGAAGCAGAAAAAGCTTATTATGCTTCCATCGGAAACGATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
WP_029594380.1|4720522_4720795_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	98.9	1.0e-42
WP_000736898.1|4720868_4721309_+	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000153262.1|4721305_4721833_+	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	3.6e-100
WP_001254222.1|4721829_4722012_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566868.1|4722008_4722179_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001108038.1|4722171_4722783_+	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_001028841.1|4722779_4723445_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.4	4.4e-127
WP_000750155.1|4723656_4724616_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|4724953_4725076_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|4725090_4725780_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|4725964_4726708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4726793_4726952_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_025404260.1|4727250_4727901_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	92.1	3.1e-109
WP_001358663.1|4727879_4729076_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_085947772.1|4730722_4731936_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000411802.1|4732258_4732465_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_085961182.1|4732909_4734123_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000092318.1|4734271_4734709_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000881338.1|4734858_4735476_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.4	1.2e-91
WP_001307652.1|4735663_4735858_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235436.1|4736252_4736762_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|4738644_4738851_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_025404261.1|4738847_4740440_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_024239710.1|4740429_4741935_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256846.1|4741971_4742319_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	9.9e-22
WP_000522623.1|4742376_4743405_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|4743456_4743840_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_025380275.1|4743832_4744282_+	host specificity protein J	NA	Q9LA64	Enterobacterial_phage	98.1	2.3e-55
WP_025404262.1|4744349_4744922_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	93.5	2.3e-100
WP_106873560.1|4744986_4746300_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023459.1|4746301_4746571_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|4746676_4747558_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001428038.1|4747774_4748608_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	9.3e-151
>prophage 16
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	4939832	5030602	5385516	portal,integrase,tRNA,protease,terminase,head,tail,holin,transposase,capsid	Enterobacteria_phage(34.0%)	90	4939790:4939807	5002716:5002733
4939790:4939807	attL	ATAAAAAAAGAGCCAGCG	NA	NA	NA	NA
WP_000117881.1|4939832_4941233_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001400545.1|4941402_4942605_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193850.1|4942870_4945483_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_001090499.1|4945525_4946293_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	3.4e-30
WP_000235178.1|4946289_4947081_-	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001226265.1|4948233_4949193_-	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001263920.1|4949185_4949761_-	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_000750296.1|4950116_4950656_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000845152.1|4950738_4951440_+	molecular chaperone	NA	NA	NA	NA	NA
WP_000286298.1|4951464_4954065_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000730621.1|4955133_4955676_+	fimbrial protein	NA	NA	NA	NA	NA
WP_001307699.1|4956190_4956901_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_001400546.1|4957011_4958022_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001400547.1|4958195_4958738_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224310.1|4958734_4959844_-	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_106905662.1|4960087_4962196_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053100.1|4962207_4964115_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.9e-53
WP_000333170.1|4964244_4965498_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000445542.1|4965502_4967143_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759123.1|4967139_4967703_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000828648.1|4967958_4968126_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227927.1|4968195_4968714_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156509.1|4968782_4970543_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|4970728_4971181_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750414.1|4971255_4972311_-	porin OmpA	NA	NA	NA	NA	NA
WP_000875041.1|4973985_4976148_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|4976157_4976604_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420536.1|4976726_4978781_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424181.1|4978812_4979271_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|4979366_4980029_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|4980201_4980615_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|4980659_4980977_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116291.1|4981034_4982225_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048228.1|4982319_4982598_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|4982594_4982924_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|4983014_4983674_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001299351.1|4984081_4985101_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|4985078_4985321_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_025380290.1|4985388_4987824_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001098307.1|4987917_4988109_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|4988105_4988294_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_159032316.1|4988949_4989165_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.7e-06
WP_085961182.1|4989130_4990344_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_072095850.1|4990418_4990538_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032313415.1|4990609_4991692_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788742.1|4991698_4992445_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_000451007.1|4992466_4993237_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|4993252_4993666_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|4994017_4994791_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|4995156_4995294_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013636.1|4995338_4995551_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|4995718_4995997_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265141.1|4995998_4997048_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
WP_001217436.1|4997060_4997432_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|4997421_4997793_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|4997944_4998763_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|4999049_4999247_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|4999384_5000098_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874348.1|5000865_5002716_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411814.1|5003164_5003371_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
5002716:5002733	attR	ATAAAAAAAGAGCCAGCG	NA	NA	NA	NA
WP_000138558.1|5003626_5003899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032162009.1|5004058_5004592_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_012816791.1|5005143_5005329_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|5005856_5006171_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|5006252_5006477_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|5006878_5007388_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300238.1|5007359_5009288_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	2.7e-262
WP_000259002.1|5009271_5009478_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831765.1|5009474_5011067_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_001253961.1|5011056_5012562_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000256809.1|5012598_5012946_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522615.1|5013003_5014032_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000201523.1|5014082_5014457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000975046.1|5014817_5015351_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_000683066.1|5015347_5015743_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_001357739.1|5015750_5016503_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000479105.1|5016516_5016948_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533423.1|5016974_5017388_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_032313647.1|5017368_5019948_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.8	0.0e+00
WP_025404276.1|5019944_5020274_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	2.2e-55
WP_001357740.1|5020273_5020972_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404352.1|5020977_5021721_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	5.9e-149
WP_052915903.1|5021666_5022299_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	7.1e-103
WP_000649829.1|5022489_5023017_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106905664.1|5024115_5026626_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.2	0.0e+00
WP_001360257.1|5026694_5027318_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_106873504.1|5027382_5028696_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_024262417.1|5028697_5028967_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	5.4e-44
WP_022581903.1|5029143_5030124_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.2	9.4e-86
WP_095111390.1|5030470_5030602_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
>prophage 17
NZ_CP027362	Escherichia coli strain 95-3192 chromosome, complete genome	5385516	5085870	5094970	5385516	tail,transposase	Enterobacteria_phage(77.78%)	10	NA	NA
WP_000078920.1|5085870_5086011_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|5086200_5086461_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132788.1|5086503_5087613_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.8e-195
WP_000005358.1|5087770_5088955_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	9.6e-226
WP_000290450.1|5088954_5089467_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651580.1|5089522_5089897_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	73.2	4.0e-37
WP_000333503.1|5089905_5090061_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_085961182.1|5092386_5093600_-|transposase	IS3-like element IS629 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_000484931.1|5093803_5094637_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	45.4	2.4e-58
WP_000897250.1|5094652_5094970_+	N-6 DNA methylase	NA	A0A2H4PQP4	Staphylococcus_phage	51.0	1.4e-19
