The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	0	1936	5400138		Aeromonas_phage(100.0%)	1	NA	NA
WP_001087189.1|220_1936_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	4.3e-41
>prophage 2
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	8288	9242	5400138		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|8288_8717_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|8828_9242_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 3
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	13669	14818	5400138		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705005.1|13669_14818_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 4
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	19524	26893	5400138		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|19524_21939_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|21967_23041_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|23040_24141_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|24145_25549_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|25845_25926_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|26155_26296_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|26312_26672_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|26635_26893_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 5
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	37090	42626	5400138	transposase	Stx2-converting_phage(75.0%)	6	NA	NA
WP_000019346.1|37090_38428_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
WP_000488366.1|38592_39258_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000116772.1|39324_39798_+	protein CbrB	NA	NA	NA	NA	NA
WP_001341423.1|40031_40706_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|40702_41050_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106902970.1|41069_42626_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	1.4e-160
>prophage 6
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	52133	55974	5400138		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|52133_52907_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|52997_53888_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|53887_54847_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|54933_55974_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 7
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	61504	64866	5400138		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|61504_63334_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|63495_64866_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 8
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	76818	77811	5400138		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845107.1|76818_77811_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 9
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	80979	86832	5400138		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|80979_82848_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|83014_83434_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387752.1|83441_84947_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|84951_85917_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|85941_86832_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 10
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	100132	101779	5400138		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012598.1|100132_101779_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	4.8e-66
>prophage 11
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	110252	115664	5400138		Bacillus_phage(33.33%)	4	NA	NA
WP_001238890.1|110252_112274_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001299253.1|112320_113805_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|113938_115204_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|115334_115664_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 12
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	119706	125850	5400138		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|119706_120837_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006625.1|120833_122096_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226587.1|122095_123163_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000676056.1|123181_124063_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|124040_124715_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|124719_125850_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 13
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	144321	148180	5400138		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|144321_145218_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213575.1|145217_145934_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383411.1|146017_148180_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
>prophage 14
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	155666	157496	5400138		Catovirus(100.0%)	1	NA	NA
WP_024026058.1|155666_157496_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	4.3e-84
>prophage 15
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	171927	175214	5400138		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|171927_173568_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|173646_173916_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|173919_174435_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|174437_175214_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 16
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	184004	184619	5400138		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|184004_184619_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 17
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	198305	201092	5400138		uncultured_virus(100.0%)	1	NA	NA
WP_000250048.1|198305_201092_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	1.9e-70
>prophage 18
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	205170	207641	5400138		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188776.1|205170_206580_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190579.1|206591_207641_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.6	5.0e-08
>prophage 19
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	211525	214301	5400138		Escherichia_phage(50.0%)	3	NA	NA
WP_000022286.1|211525_212314_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_000196715.1|212353_213250_-	sugar kinase	NA	NA	NA	NA	NA
WP_001370187.1|213422_214301_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	1.6e-47
>prophage 20
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	231308	234359	5400138		Escherichia_phage(100.0%)	1	NA	NA
WP_077637985.1|231308_234359_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.2	7.2e-07
>prophage 21
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	249122	253983	5400138		Bacillus_thuringiensis_phage(33.33%)	6	NA	NA
WP_001295522.1|249122_249743_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_077633693.1|249678_249900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001166063.1|250002_250986_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|251134_251809_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|251914_253288_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|253284_253983_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 22
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	265557	270061	5400138		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|265557_266403_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|266828_267074_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|267158_267644_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|267736_268663_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|268729_270061_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 23
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	287359	294606	5400138		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|287359_288022_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174084.1|288033_290535_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004448.1|290843_291923_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|291937_292258_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184804.1|292308_294606_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 24
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	311697	313542	5400138		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591366.1|311697_313542_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 25
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	322125	325178	5400138		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|322125_323076_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|323993_325178_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 26
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	329294	337623	5400138		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_001370153.1|329294_333323_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|333399_337623_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 27
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	346985	348749	5400138		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|346985_347657_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941125.1|347699_348290_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|348476_348749_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 28
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	354117	355707	5400138		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|354117_355707_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 29
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	371767	375451	5400138		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|371767_375451_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 30
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	400810	401926	5400138		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179162.1|400810_401926_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 31
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	411155	411764	5400138		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|411155_411764_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 32
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	417316	474238	5400138	tRNA,integrase,head,capsid,transposase,holin,terminase,portal,tail	Enterobacteria_phage(35.48%)	66	429510:429524	470685:470699
WP_001093921.1|417316_417598_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
WP_001061339.1|417634_418207_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|418206_418941_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|418943_419135_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829413.1|419136_419604_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_000145671.1|419750_420224_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|420220_420571_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000543621.1|420561_420897_-	hypothetical protein	NA	U5P0T3	Shigella_phage	97.3	5.7e-59
WP_096910863.1|420987_422201_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000081294.1|422539_423364_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000135680.1|423429_423792_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000981537.1|424249_424903_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|424998_425196_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514175.1|425223_425808_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	2.1e-56
WP_001087349.1|425804_426971_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	61.1	3.6e-116
WP_000626861.1|426967_427162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000061545.1|427379_428204_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	78.4	1.2e-89
WP_000988265.1|428214_429114_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	8.8e-139
WP_000203855.1|429110_430511_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
429510:429524	attL	CTGAAGGATGCGCAG	NA	NA	NA	NA
WP_001370224.1|430507_430765_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	9.5e-22
WP_001370152.1|430816_431806_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_085947772.1|432244_433457_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001339373.1|434142_434295_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143128.1|435117_436980_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.5	0.0e+00
WP_000284522.1|437129_437345_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|437349_437694_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|437744_438278_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056806.1|438548_439118_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|439117_439264_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|439486_439672_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|440197_440512_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|440593_440818_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|441204_441750_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|441724_443650_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|443646_443853_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|443849_445451_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_032212710.1|445431_446751_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.6e-232
WP_001299443.1|446760_447093_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024025845.1|447148_448174_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_000158899.1|448215_448611_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|448622_448976_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_024025847.1|448987_449566_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000683137.1|449562_449958_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|449965_450718_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|450731_451154_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|451180_451594_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212771.1|451574_454187_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000847401.1|454183_454513_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001299882.1|454512_455211_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_001370115.1|455216_455960_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_077696211.1|455905_456541_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_106902971.1|456776_460169_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	87.7	0.0e+00
WP_001230379.1|460235_460835_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_032212803.1|460899_462213_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_024174195.1|462214_462478_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.2	2.5e-33
WP_087661054.1|462483_463696_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_077633690.1|463662_463797_+|tail	phage tail protein	tail	A0A0N7BTS3	Escherichia_phage	100.0	2.6e-07
WP_001370116.1|464208_464814_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|465038_465689_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_085948186.1|465945_467102_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001217539.1|467549_467798_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|467859_468957_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_000543822.1|469045_470083_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|470216_470459_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000918363.1|471690_473106_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
470685:470699	attR	CTGCGCATCCTTCAG	NA	NA	NA	NA
WP_001147328.1|473158_474238_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 33
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	478445	482059	5400138		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357734.1|478445_481268_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	0.0e+00
WP_000168305.1|481522_482059_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 34
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	485876	487226	5400138		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|485876_487226_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 35
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	492811	494770	5400138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078252.1|492811_494770_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.5e-90
>prophage 36
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	504166	506314	5400138		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|504166_506314_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 37
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	511480	517849	5400138		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066010.1|511480_513466_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.1	1.3e-147
WP_001171691.1|513738_514668_-	allose kinase	NA	NA	NA	NA	NA
WP_001297586.1|514651_515347_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|515357_516338_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235232.1|516316_517849_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	5.3e-19
>prophage 38
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	524084	525700	5400138		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611423.1|524084_524765_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	4.2e-08
WP_001039799.1|524941_525700_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 39
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	531326	532115	5400138		Cedratvirus(100.0%)	1	NA	NA
WP_001193397.1|531326_532115_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	4.2e-12
>prophage 40
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	537051	538554	5400138		Burkholderia_virus(100.0%)	1	NA	NA
WP_001370445.1|537051_538554_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	1.8e-56
>prophage 41
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	559750	562962	5400138	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295082.1|559750_561268_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856834.1|561504_562962_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
>prophage 42
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	568719	648720	5400138	tRNA,integrase,transposase,protease	Stx2-converting_phage(34.78%)	60	563352:563367	649150:649165
563352:563367	attL	ATCAGATCCGGCAGAT	NA	NA	NA	NA
WP_000997984.1|568719_570258_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_000612591.1|570307_570655_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|570651_571032_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_094185360.1|572143_573300_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000422707.1|573558_573984_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_001239100.1|574637_584309_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_000609742.1|586182_586857_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953032.1|586905_587895_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
WP_001121620.1|588503_590153_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000603950.1|593135_593684_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_001066419.1|596131_597688_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|597707_598055_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|598051_598726_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_106902972.1|598779_599070_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.1	9.4e-34
WP_001341423.1|599066_599741_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001218843.1|600731_601997_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|602376_602952_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068972.1|602988_604686_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|604661_605000_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|605115_606417_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|606534_607971_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|608307_608784_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015800.1|608799_610056_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|610331_610625_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729116.1|610668_612324_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|612461_612815_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000940538.1|614128_615157_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|615198_615765_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|615816_615942_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|616052_616199_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|616380_616698_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238375.1|616694_617228_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	8.0e-47
WP_001370451.1|617316_618450_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|618512_618872_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|618882_619278_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|619288_620023_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|620015_621824_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|622148_623126_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001399652.1|623344_624847_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|624898_625213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|625209_625524_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236847.1|625552_628876_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934905.1|628897_629866_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|629960_631013_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|631107_631653_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|632516_632570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|632552_633692_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|633690_635238_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|635209_635671_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990308.1|635689_637027_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001370456.1|637036_638884_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	1.3e-59
WP_001280339.1|638876_639827_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|639912_640221_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|640296_641577_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|641662_642922_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|642924_643929_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089298.1|644010_644208_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|644311_645610_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|645814_646240_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076328.1|646278_648720_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	8.4e-67
649150:649165	attR	ATCTGCCGGATCTGAT	NA	NA	NA	NA
>prophage 43
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	652652	653816	5400138		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943960.1|652652_653816_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
>prophage 44
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	695357	701845	5400138		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|695357_695888_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265920.1|696197_697154_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205810.1|697293_698796_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001370425.1|698809_699832_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595987.1|699818_700814_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|700846_701845_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 45
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	706161	708923	5400138		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|706161_706626_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|706784_708923_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 46
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	712562	718659	5400138		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181322.1|712562_713510_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	1.8e-12
WP_001387276.1|713694_713748_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|713888_716585_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|716790_717177_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|717249_717711_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013029.1|717723_718659_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	6.5e-52
>prophage 47
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	727003	736017	5400138	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416382.1|727003_729859_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001188289.1|729858_730341_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|730435_731947_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584118.1|732213_733314_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|733313_734396_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294543.1|734514_736017_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
>prophage 48
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	741146	745578	5400138		Acanthamoeba_polyphaga_mimivirus(50.0%)	2	NA	NA
WP_001300770.1|741146_742166_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_001022619.1|744108_745578_-	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
>prophage 49
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	757096	765323	5400138		uncultured_virus(33.33%)	7	NA	NA
WP_001040178.1|757096_759244_-	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
WP_000148644.1|759294_759681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000504876.1|759677_761021_-	McrC family protein	NA	NA	NA	NA	NA
WP_000177022.1|761013_763089_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
WP_000168569.1|763258_764131_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_001338066.1|764212_764335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338800.1|764342_765323_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	55.0	1.2e-101
>prophage 50
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	768686	770363	5400138		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|768686_769289_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|769766_770363_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 51
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	779490	780951	5400138		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|779490_780951_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 52
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	787519	788074	5400138		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|787519_788074_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 53
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	795586	796543	5400138	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181167.1|795586_796543_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.3e-60
>prophage 54
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	816565	821930	5400138		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919567.1|816565_818230_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410142.1|818278_819640_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091570.1|819854_820769_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|820907_821930_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 55
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	825157	826437	5400138		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|825157_825895_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_001370442.1|825897_826437_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	1.1e-27
>prophage 56
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	834628	870460	5400138	integrase,transposase,holin,terminase,tail	Enterobacteria_phage(40.0%)	44	831596:831609	841492:841505
831596:831609	attL	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001218283.1|834628_835846_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.5	1.7e-238
WP_000206721.1|838412_839033_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	92.7	3.6e-115
WP_001242716.1|839032_839395_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_000008189.1|839385_839922_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	4.8e-100
WP_001311077.1|840842_841535_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
841492:841505	attR	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001191671.1|841632_841893_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	1.2e-40
WP_000515839.1|841885_842437_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.9	2.2e-100
WP_001087356.1|842433_843582_+	peptidase	NA	K7PLX4	Enterobacteria_phage	86.9	7.2e-178
WP_000620698.1|843578_843803_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_024025783.1|844613_845108_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
WP_000066917.1|845107_845761_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|845757_846084_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|846080_846470_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|846489_847299_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001223334.1|847314_847830_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_001299344.1|847839_848829_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001205460.1|848846_849188_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|849200_849749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|849735_850662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|850926_851130_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799669.1|851280_852339_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	2.9e-181
WP_001370417.1|852781_853213_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	99.3	3.5e-69
WP_000216636.1|853209_853377_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_032212796.1|853784_855635_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_085948186.1|855757_856913_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000411802.1|857348_857555_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032212794.1|857554_858052_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	3.8e-91
WP_001208681.1|858268_858454_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|858982_859297_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|859378_859603_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|859644_860010_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_077760350.1|860301_860703_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.7	5.6e-61
WP_085947772.1|860695_861909_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001130973.1|861934_862630_+	hypothetical protein	NA	Q6H9T2	Enterobacteria_phage	99.6	8.6e-126
WP_001216289.1|862697_863321_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	2.5e-68
WP_032212792.1|863385_864576_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	95.5	4.8e-76
WP_001023428.1|864577_864847_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_001118085.1|864957_865539_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_077633702.1|865606_866236_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	8.7e-77
WP_001143789.1|866317_866959_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.6	1.4e-106
WP_001217539.1|867119_867368_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|867587_869174_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|869566_870172_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|870298_870460_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 57
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	876095	877418	5400138		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477794.1|876095_877418_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	3.0e-79
>prophage 58
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	884161	889516	5400138		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093813.1|884161_885394_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046749.1|885700_887368_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409459.1|887578_889516_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 59
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	892852	894966	5400138		Bacillus_phage(50.0%)	2	NA	NA
WP_001188659.1|892852_893542_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219604.1|893541_894966_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
>prophage 60
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	906740	919735	5400138		Cyanophage(16.67%)	12	NA	NA
WP_000130185.1|906740_907694_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094683.1|907808_908396_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|908430_908997_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|909145_909859_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|909884_910289_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|910665_912582_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|912670_913801_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|913904_914114_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001274825.1|914668_915430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173014.1|915449_916943_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	1.2e-28
WP_024174211.1|917072_918317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681368.1|918568_919735_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 61
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	926775	929592	5400138	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286853.1|926775_929592_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.0	2.3e-76
>prophage 62
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	934035	935184	5400138		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|934035_935184_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 63
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	940654	946315	5400138		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|940654_942208_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349932.1|942281_943499_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|943627_944770_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|944800_946315_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 64
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	954153	955553	5400138		Bacillus_phage(50.0%)	2	NA	NA
WP_024174212.1|954153_954633_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	4.0e-29
WP_000257192.1|954710_955553_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 65
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	963285	968708	5400138		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|963285_966192_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035664.1|966356_968708_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.0e-37
>prophage 66
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	975071	975770	5400138		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|975071_975770_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 67
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	988472	990197	5400138		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425658.1|988472_990197_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 68
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1016170	1017214	5400138		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|1016170_1017214_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 69
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1021459	1022011	5400138		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|1021459_1022011_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 70
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1030638	1032063	5400138		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1030638_1032063_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 71
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1039615	1046238	5400138		Mamastrovirus(33.33%)	5	NA	NA
WP_001189608.1|1039615_1041166_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_000996827.1|1041367_1043758_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|1043963_1044500_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651602.1|1044540_1045203_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|1045311_1046238_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 72
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1049500	1053738	5400138	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_000339944.1|1049500_1050403_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
WP_000905383.1|1050476_1051328_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000805451.1|1051339_1052134_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_087661054.1|1052524_1053738_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 73
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1061623	1068429	5400138	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|1061623_1063042_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937425.1|1063080_1064007_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|1064043_1064499_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396034.1|1064676_1065381_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294703.1|1065395_1065926_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001399192.1|1065999_1068429_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	5.1e-40
>prophage 74
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1073671	1074469	5400138		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1073671_1074469_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 75
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1080380	1080725	5400138		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1080380_1080725_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 76
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1084654	1086079	5400138	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|1084654_1086079_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 77
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1097963	1098722	5400138		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|1097963_1098722_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 78
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1107550	1111666	5400138		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569433.1|1107550_1108147_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.5	2.1e-27
WP_001294778.1|1108183_1111666_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 79
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1124625	1125657	5400138		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593995.1|1124625_1125657_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 80
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1132317	1140170	5400138		Indivirus(25.0%)	9	NA	NA
WP_000997002.1|1132317_1133121_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	1.6e-38
WP_000648545.1|1133117_1134032_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1134272_1135073_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211688.1|1135150_1135921_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644675.1|1135968_1137327_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|1137398_1138154_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|1138187_1138910_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1138906_1139374_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|1139438_1140170_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
>prophage 81
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1150647	1153437	5400138		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000614345.1|1150647_1153437_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	1.1e-81
>prophage 82
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1164398	1170866	5400138		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103286.1|1164398_1166540_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	6.3e-26
WP_000508718.1|1166615_1170866_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	2.9e-22
>prophage 83
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1178223	1182142	5400138		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|1178223_1178802_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|1179007_1179775_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1179745_1180486_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|1180641_1180920_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729706.1|1180922_1181183_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543899.1|1181368_1182142_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 84
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1187193	1188360	5400138		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001396230.1|1187193_1188360_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	32.0	3.2e-32
>prophage 85
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1193037	1203635	5400138	transposase	Streptococcus_phage(40.0%)	9	NA	NA
WP_000749879.1|1193037_1194093_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
WP_001285288.1|1194380_1195484_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893273.1|1195495_1196749_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001111349.1|1197065_1197476_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121328.1|1197454_1198411_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667013.1|1198420_1200619_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.8e-37
WP_000643328.1|1200615_1201572_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070692.1|1201568_1202258_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_085948186.1|1202478_1203635_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 86
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1219812	1223117	5400138		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001299025.1|1219812_1220682_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001399107.1|1220841_1221435_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474082.1|1221446_1221683_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046304.1|1221791_1223117_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 87
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1228691	1239167	5400138	holin	Catovirus(33.33%)	5	NA	NA
WP_001159108.1|1228691_1230362_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	3.1e-60
WP_000089103.1|1230375_1231848_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001299022.1|1231861_1232449_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|1232577_1234611_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_072097009.1|1235183_1239167_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	1.4e-124
>prophage 88
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1251253	1255791	5400138		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|1251253_1252738_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|1252730_1253702_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|1253698_1254655_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692737.1|1254741_1255791_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.1e-71
>prophage 89
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1264167	1266054	5400138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010255.1|1264167_1266054_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	4.1e-53
>prophage 90
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1269056	1269956	5400138		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952507.1|1269056_1269956_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
>prophage 91
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1274497	1278777	5400138		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177895.1|1274497_1277572_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.3	0.0e+00
WP_000805871.1|1277694_1278777_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	4.1e-191
>prophage 92
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1284187	1286148	5400138		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044318.1|1284187_1285138_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
WP_001013519.1|1285134_1286148_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	4.1e-44
>prophage 93
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1289427	1290537	5400138		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842084.1|1289427_1290537_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	8.9e-32
>prophage 94
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1295836	1296604	5400138		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939372.1|1295836_1296604_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 95
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1303570	1304728	5400138		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|1303570_1304728_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 96
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1312143	1313259	5400138		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|1312143_1313259_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 97
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1317548	1327520	5400138		Bacillus_phage(60.0%)	6	NA	NA
WP_001298537.1|1317548_1318460_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001306939.1|1319635_1320820_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698922.1|1320945_1324089_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221312.1|1324085_1325288_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.4e-06
WP_000113924.1|1325477_1326167_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	8.2e-36
WP_000893623.1|1326224_1327520_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 98
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1334472	1343453	5400138	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|1334472_1335600_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|1335622_1335955_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|1335982_1337830_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1337840_1338812_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974815.1|1338940_1339288_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|1339464_1340349_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001370344.1|1340647_1341187_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1341337_1341787_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150466.1|1341790_1342894_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.9e-53
WP_001021161.1|1342982_1343453_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 99
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1367159	1372206	5400138	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122252.1|1367159_1367783_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1367908_1369183_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1369370_1371725_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1371933_1372206_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 100
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1375334	1376030	5400138		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|1375334_1376030_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 101
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1379353	1382900	5400138		Bacillus_phage(100.0%)	2	NA	NA
WP_001235626.1|1379353_1381126_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.9	5.7e-49
WP_001256203.1|1381118_1382900_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	8.9e-42
>prophage 102
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1391735	1394885	5400138		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1391735_1394885_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 103
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1401893	1410455	5400138		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1401893_1402445_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122007.1|1402573_1404505_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1404557_1404887_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1404886_1405492_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1405601_1407476_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|1407656_1408301_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|1408536_1409499_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801843.1|1409495_1410455_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 104
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1417084	1514753	5400138	tRNA,integrase,head,capsid,transposase,protease,terminase,portal,tail	Enterobacteria_phage(45.0%)	88	1473879:1473925	1506227:1506273
WP_000186631.1|1417084_1417564_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365135.1|1417767_1418562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001370330.1|1418699_1419041_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	9.3e-41
WP_000083976.1|1419255_1421760_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	1.4e-114
WP_000883019.1|1422021_1422954_+	glutaminase A	NA	NA	NA	NA	NA
WP_000982172.1|1422956_1424249_+	amino acid permease	NA	NA	NA	NA	NA
WP_001026747.1|1424373_1424781_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000970323.1|1424781_1425240_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|1425236_1426154_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157535.1|1426299_1426977_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
WP_001323739.1|1426963_1427743_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|1427805_1428660_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148959.1|1428720_1429530_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|1429519_1430143_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1430113_1430800_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561833.1|1430796_1433211_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014917.1|1433639_1437830_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
WP_000879785.1|1437810_1438302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158006.1|1439303_1440398_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1440466_1441393_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1441622_1442105_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1442182_1442998_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001370296.1|1443087_1444869_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	6.0e-38
WP_000943556.1|1444881_1445658_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|1445757_1446636_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401125.1|1446804_1448259_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|1448318_1449680_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001370313.1|1449736_1451038_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001370319.1|1451059_1452205_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
WP_000540996.1|1452432_1453218_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001370308.1|1453228_1454464_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703894.1|1454485_1455535_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580865.1|1455851_1457519_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|1457528_1458788_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001325209.1|1458798_1459614_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855398.1|1459610_1460504_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815538.1|1460642_1461710_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1461706_1462216_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|1462333_1463056_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|1463058_1463553_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1463726_1465112_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1465147_1465669_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1465776_1465989_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1465990_1466857_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776558.1|1467337_1467880_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_001370299.1|1468821_1471431_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691047.1|1471443_1472451_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001396973.1|1472461_1472977_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805418.1|1472979_1473612_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1473879:1473925	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001370298.1|1473938_1475102_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	9.8e-199
WP_000446905.1|1474957_1475329_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|1475300_1475579_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|1475626_1475845_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|1475943_1476225_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_087661054.1|1476281_1477494_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_029594360.1|1477552_1478077_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.7	2.2e-89
WP_001027188.1|1478051_1479977_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_000198151.1|1479973_1480186_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	95.7	1.6e-27
WP_001370283.1|1480182_1481784_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000123282.1|1481764_1483084_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.7	6.3e-226
WP_001358596.1|1483093_1483426_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_106902974.1|1483480_1484506_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.5	1.7e-186
WP_000158899.1|1484547_1484943_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|1484954_1485308_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_024025847.1|1485319_1485898_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000683138.1|1485894_1486290_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001370356.1|1486297_1487038_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479147.1|1487053_1487476_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_000459457.1|1487457_1487892_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840238.1|1487884_1490446_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.7	0.0e+00
WP_000847371.1|1490442_1490772_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_001152565.1|1490771_1491470_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000194780.1|1491475_1492219_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|1492155_1492788_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515724.1|1492848_1496190_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_085947772.1|1496210_1497423_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001230348.1|1497592_1498192_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_077633707.1|1500355_1501327_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	89.3	2.1e-37
WP_000885574.1|1501326_1501911_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|1501965_1502634_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|1502690_1502996_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226375.1|1503179_1504664_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1504850_1505804_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|1506316_1507078_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1506227:1506273	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|1507260_1508151_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662369.1|1508151_1511124_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383947.1|1511110_1513348_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420919.1|1513616_1514753_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 105
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1519828	1529926	5400138		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_001289076.1|1519828_1524658_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	39.3	1.6e-16
WP_001160804.1|1524677_1525139_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103165.1|1525166_1527068_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.0e-27
WP_000253818.1|1527804_1529253_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770959.1|1529242_1529926_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	3.9e-30
>prophage 106
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1533071	1536215	5400138		Leptospira_phage(100.0%)	1	NA	NA
WP_000573965.1|1533071_1536215_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	9.8e-60
>prophage 107
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1547656	1553699	5400138		Tupanvirus(50.0%)	3	NA	NA
WP_000077734.1|1547656_1551538_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
WP_000096742.1|1551753_1552887_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|1552883_1553699_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 108
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1568245	1570068	5400138		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|1568245_1568875_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029813.1|1568847_1570068_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
>prophage 109
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1573177	1575292	5400138		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|1573177_1574743_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|1574863_1575292_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 110
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1590717	1591363	5400138		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1590717_1590927_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|1590979_1591363_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 111
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1596178	1598617	5400138		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1596178_1597390_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|1597528_1598617_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 112
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1605627	1608210	5400138	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001370324.1|1605627_1608210_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.5e-183
>prophage 113
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1615148	1618681	5400138		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367854.1|1615148_1616819_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	5.2e-76
WP_001207522.1|1616902_1617838_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1617955_1618681_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 114
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1626577	1627657	5400138		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1626577_1627657_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 115
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1631752	1633417	5400138		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|1631752_1633417_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 116
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1638183	1641997	5400138	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023106.1|1638183_1640130_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|1640332_1641997_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 117
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1646278	1647043	5400138		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|1646278_1647043_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 118
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1653604	1659585	5400138		Bacillus_phage(33.33%)	4	NA	NA
WP_000186093.1|1653604_1654282_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	1.2e-26
WP_001370345.1|1654278_1656963_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001344323.1|1656955_1657528_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087947.1|1657536_1659585_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	1.9e-27
>prophage 119
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1666104	1667318	5400138	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_087661054.1|1666104_1667318_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 120
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1672642	1675584	5400138		Hokovirus(50.0%)	2	NA	NA
WP_000628032.1|1672642_1674061_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	8.9e-61
WP_001032694.1|1674102_1675584_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 121
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1678962	1679754	5400138		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114026.1|1678962_1679754_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	31.5	2.2e-08
>prophage 122
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1715650	1719170	5400138		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|1715650_1716370_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|1716366_1717308_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|1717421_1717802_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|1718117_1719170_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 123
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1723523	1730096	5400138		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|1723523_1724540_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096864.1|1724800_1726273_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|1726340_1727129_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1727257_1727407_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113004.1|1727572_1728346_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|1728345_1729035_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|1729037_1730096_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 124
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1740451	1741741	5400138		Klosneuvirus(100.0%)	1	NA	NA
WP_001399447.1|1740451_1741741_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 125
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1748222	1749131	5400138		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1748222_1749131_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 126
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1760442	1775254	5400138		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996092.1|1760442_1762179_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001296990.1|1762171_1763167_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001370323.1|1763169_1763841_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|1764069_1765434_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145128.1|1765665_1766148_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001218655.1|1766267_1768418_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_000386551.1|1768445_1769408_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443508.1|1769548_1770634_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|1770862_1771123_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|1771387_1771654_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|1771727_1772405_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430053.1|1772446_1774729_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1774993_1775254_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 127
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1778794	1784019	5400138		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|1778794_1779517_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|1779513_1780173_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1780311_1781058_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1781461_1781965_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001370348.1|1782263_1783151_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1783385_1783451_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1783503_1784019_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 128
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1789016	1797358	5400138		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|1789016_1790609_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168796.1|1790849_1792115_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114235.1|1792266_1793082_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209377.1|1793227_1795660_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001370343.1|1795665_1796565_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001295294.1|1796695_1797358_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	3.3e-26
>prophage 129
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1800676	1802548	5400138		Planktothrix_phage(100.0%)	1	NA	NA
WP_001370314.1|1800676_1802548_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 130
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1813883	1815086	5400138		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1813883_1815086_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 131
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1823652	1832802	5400138		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|1823652_1823910_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1824069_1824357_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1824340_1825063_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684320.1|1825123_1826026_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1826113_1826590_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126052.1|1826940_1828053_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000995994.1|1828147_1829281_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_000105443.1|1829290_1830244_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|1830240_1831086_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1831145_1831634_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149708.1|1831674_1832802_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	6.0e-28
>prophage 132
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1836139	1838877	5400138		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|1836139_1836868_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|1837085_1837601_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1837726_1838050_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|1838046_1838877_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 133
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1842464	1844183	5400138		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|1842464_1844183_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 134
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1853479	1880072	5400138	tRNA,transposase,protease	Stx2-converting_phage(20.0%)	19	NA	NA
WP_000188139.1|1853479_1855426_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1855498_1855723_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1856045_1856366_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1856396_1858673_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001066422.1|1858798_1860355_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|1860374_1860722_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|1860718_1861393_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001040187.1|1862074_1862293_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1862577_1863282_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202187.1|1863323_1865045_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001043587.1|1865045_1866812_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537420.1|1866934_1867900_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|1868444_1868939_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077046.1|1869073_1873258_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.3e-86
WP_001370278.1|1873412_1874024_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067741.1|1874034_1875378_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	6.2e-80
WP_000886683.1|1875468_1876761_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850292.1|1876999_1879444_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.7	3.3e-220
WP_000213102.1|1879454_1880072_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	3.8e-77
>prophage 135
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1886380	1889595	5400138		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1886380_1887121_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1887312_1889595_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 136
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1893693	1894782	5400138		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057127.1|1893693_1894782_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.3e-80
>prophage 137
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1899868	1908589	5400138	transposase	Stx2-converting_phage(60.0%)	7	NA	NA
WP_000167336.1|1899868_1900153_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705700.1|1900359_1902624_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1902660_1904409_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570542.1|1904405_1905392_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_001341423.1|1905994_1906669_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|1906665_1907013_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|1907032_1908589_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
>prophage 138
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1921831	1932964	5400138	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1921831_1922380_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|1922406_1923054_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1923275_1924466_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977914.1|1924650_1925739_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000117881.1|1926340_1927741_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|1927909_1929112_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193847.1|1929377_1931990_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090514.1|1932196_1932964_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 139
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1948899	1950807	5400138		Tupanvirus(100.0%)	1	NA	NA
WP_000053123.1|1948899_1950807_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 140
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	1955473	2066199	5400138	integrase,head,capsid,transposase,protease,terminase,holin,portal,tail	Escherichia_phage(33.33%)	141	1975144:1975162	2022240:2022258
WP_000156526.1|1955473_1957234_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|1957419_1957872_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|1957946_1958999_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1959355_1959865_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000841914.1|1960083_1960713_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875061.1|1960675_1962838_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|1962847_1963294_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001295354.1|1963416_1965471_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1965502_1965961_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1966056_1966719_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1966891_1967305_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1967349_1967667_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1967724_1968915_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048233.1|1969009_1969288_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1969284_1969614_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1969704_1970364_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001370339.1|1970771_1971791_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000273151.1|1971768_1972011_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_032212635.1|1972078_1974514_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	2.7e-57
WP_001098749.1|1974594_1974798_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449182.1|1974800_1974983_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
1975144:1975162	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_000394568.1|1975728_1976118_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	39.3	1.9e-21
WP_000379585.1|1976129_1976282_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000948459.1|1976597_1977074_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1977197_1977494_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693884.1|1977516_1977942_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262384.1|1978013_1979084_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	62.2	8.2e-59
WP_001151153.1|1979124_1979547_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266134.1|1979543_1979840_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1979836_1980298_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1980275_1980632_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1980682_1980895_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1980980_1981145_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1981146_1981410_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1981420_1982290_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1982405_1982510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1982698_1982911_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|1983078_1983357_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|1983358_1984408_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_000904103.1|1984420_1984780_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|1984788_1985319_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917767.1|1985560_1985758_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000024329.1|1985909_1986986_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	87.1	3.8e-181
WP_085948186.1|1987568_1988725_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001443281.1|1988848_1989175_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_032212642.1|1989474_1991421_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	96.9	0.0e+00
WP_000142777.1|1991557_1991737_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|1991777_1992023_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|1992099_1992315_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|1992319_1992853_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|1993123_1993693_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1993692_1993839_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1994066_1994252_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373410.1|1994728_1995205_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_001077625.1|1995201_1997325_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|1997321_1997534_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1997533_1999036_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1998980_2001005_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2001092_2001419_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|2001411_2001693_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|2001695_2002319_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682716.1|2002331_2002730_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235098.1|2002737_2003490_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479043.1|2003503_2003926_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532075.1|2003952_2004261_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_106875770.1|2004304_2006950_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.5	0.0e+00
WP_000847306.1|2006946_2007276_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001365123.1|2007275_2007974_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_106902976.1|2007984_2008728_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.3	1.4e-145
WP_077698919.1|2008673_2009306_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	1.6e-102
WP_106902977.1|2009554_2013031_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.0	0.0e+00
WP_001230497.1|2013097_2013697_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_032212761.1|2013761_2015075_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2015076_2015346_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000938124.1|2015800_2017162_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|2017538_2017691_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001299351.1|2017973_2018993_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|2018970_2019213_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034468.1|2019280_2021752_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_001098307.1|2021845_2022037_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|2022033_2022222_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|2022795_2022981_+	hypothetical protein	NA	NA	NA	NA	NA
2022240:2022258	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_000394511.1|2023167_2023557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2023698_2023854_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|2024130_2024418_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|2024417_2024609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|2024636_2025038_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|2025146_2025419_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|2025402_2025828_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|2026034_2026490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072097015.1|2026568_2027693_+	DNA-binding protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000788752.1|2027689_2028430_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.0	2.0e-117
WP_000450862.1|2028455_2029226_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001151233.1|2029241_2029655_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160651.1|2030006_2030780_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|2031145_2031283_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|2031327_2031540_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_072145984.1|2031707_2031986_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|2031987_2033037_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|2033049_2033421_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|2033410_2033782_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|2033933_2034752_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917739.1|2035038_2035236_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	5.7e-27
WP_000261909.1|2035373_2036087_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2036534_2036966_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|2037315_2037459_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_032212763.1|2037444_2039382_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143462.1|2039517_2039697_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|2039737_2040010_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284518.1|2040086_2040302_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731198.1|2040306_2040651_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
WP_000992152.1|2040701_2041235_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_012816791.1|2041753_2041939_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302717.1|2042423_2042738_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|2042819_2043044_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|2043446_2043956_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001370721.1|2043927_2045856_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.8e-261
WP_000259002.1|2045839_2046046_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|2046042_2047635_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001254023.1|2047624_2049130_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_000256807.1|2049166_2049514_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522623.1|2049571_2050600_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2050651_2051035_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204559.1|2051027_2051381_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000975030.1|2051395_2051929_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|2051925_2052321_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|2052328_2053081_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|2053094_2053526_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|2053552_2053966_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000082371.1|2053946_2056526_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.6	0.0e+00
WP_000847298.1|2056522_2056852_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|2056851_2057550_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_024174194.1|2057555_2058299_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	1.4e-142
WP_000090917.1|2058235_2058868_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_101329699.1|2058928_2062408_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001233099.1|2062475_2063075_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	1.1e-108
WP_101329698.1|2063139_2064453_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_001023455.1|2064454_2064724_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000767049.1|2064945_2065488_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.0	9.3e-51
WP_106420821.1|2065432_2065627_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|2065617_2066199_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
>prophage 141
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2069223	2075682	5400138		Bacillus_phage(33.33%)	6	NA	NA
WP_001120109.1|2069223_2069916_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	1.3e-17
WP_001370111.1|2070055_2071228_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063166.1|2071227_2073768_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.3e-70
WP_000211826.1|2073764_2074364_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|2074456_2074762_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|2074761_2075682_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 142
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2079983	2082084	5400138		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|2079983_2080157_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001370093.1|2080240_2081569_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.5e-232
WP_001028092.1|2081589_2082084_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	6.5e-51
>prophage 143
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2096844	2097909	5400138		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|2096844_2097909_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 144
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2102732	2103566	5400138		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2102732_2103566_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 145
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2107700	2108234	5400138		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|2107700_2108234_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 146
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2117542	2118463	5400138		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|2117542_2118463_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 147
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2123125	2123371	5400138		Salmonella_phage(100.0%)	1	NA	NA
WP_032282396.1|2123125_2123371_-	DNA damage-inducible protein I	NA	A0A0M4REN2	Salmonella_phage	50.6	2.5e-11
>prophage 148
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2139255	2140197	5400138		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|2139255_2140197_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 149
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2152554	2153736	5400138		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008538.1|2152554_2153289_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
WP_000103754.1|2153499_2153736_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 150
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2157008	2158651	5400138		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|2157008_2157650_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267955.1|2157646_2158651_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 151
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2170982	2171240	5400138		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2170982_2171240_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 152
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2178529	2313030	5400138	integrase,head,capsid,transposase,holin,protease,portal,terminase,tail,lysis	Enterobacteria_phage(27.73%)	167	2209439:2209457	2292896:2292914
WP_001033695.1|2178529_2179231_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251388.1|2179230_2180475_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291280.1|2180503_2181415_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|2181430_2182252_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759317.1|2182407_2183454_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2183450_2184245_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000824186.1|2184553_2184757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001113310.1|2184734_2185202_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000074974.1|2185278_2186397_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|2186365_2186635_-	excisionase	NA	NA	NA	NA	NA
WP_106902978.1|2186696_2188595_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	6.5e-59
WP_085948186.1|2188622_2189779_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000560212.1|2190558_2190780_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_001331716.1|2191185_2191350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2191492_2191792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2192144_2192423_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2192424_2192616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|2192636_2193008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2193105_2193408_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693944.1|2193404_2193830_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|2193852_2194815_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151187.1|2194855_2195278_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	3.9e-65
WP_000935423.1|2195383_2195596_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|2195628_2195847_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_001370098.1|2195848_2196007_+	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	75.6	2.2e-13
WP_106902979.1|2196067_2197567_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	55.6	1.6e-153
WP_000631725.1|2197586_2197934_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|2197930_2198605_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136865621.1|2198610_2198829_+	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.8	7.6e-12
WP_000208016.1|2198839_2199709_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|2199824_2199929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024174193.1|2200117_2200330_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.5e-28
WP_000756560.1|2200447_2200795_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	81.7	9.2e-44
WP_000046991.1|2200915_2201188_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.1	1.9e-12
WP_001265272.1|2201189_2202239_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.1e-108
WP_001121083.1|2202251_2202626_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.4e-35
WP_000762899.1|2202622_2203444_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	8.2e-83
WP_000917750.1|2203669_2203867_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935558.1|2204017_2205076_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.1	3.8e-189
WP_001344632.1|2205963_2206095_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_032212668.1|2206537_2208388_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.1	0.0e+00
WP_000411804.1|2208834_2209041_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_087661054.1|2209085_2210299_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
2209439:2209457	attL	GCTCCAGTGCATCCAGCAC	NA	NA	NA	NA
WP_000138558.1|2210609_2210882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|2211041_2211575_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|2212221_2212428_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2212492_2212717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|2212834_2213991_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000347013.1|2214340_2214481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208049.1|2214610_2214724_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	85.7	2.9e-07
WP_000088311.1|2214791_2215094_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094185360.1|2215191_2216347_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_077760344.1|2216340_2217084_+|portal	phage portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	99.3	7.2e-78
WP_000125984.1|2217080_2217407_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2217417_2217768_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2217764_2218211_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2218207_2218552_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275483.1|2218617_2219334_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.1e-127
WP_000710949.1|2219348_2219723_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|2219818_2220028_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212947.1|2220079_2223322_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|2223314_2223656_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_032212666.1|2223655_2224354_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_124983447.1|2225054_2225684_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.2	1.5e-97
WP_106875776.1|2225924_2229401_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.1	0.0e+00
WP_024174257.1|2229469_2230045_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_032212660.1|2230109_2231423_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_032212659.1|2231424_2231694_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
WP_012817749.1|2231819_2232572_-	type III effector	NA	NA	NA	NA	NA
WP_001370123.1|2233688_2234807_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_032282421.1|2234803_2236597_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2236615_2237323_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|2237319_2237907_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063978.1|2237903_2238302_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|2238298_2239156_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263584.1|2239289_2240834_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460789.1|2240845_2241982_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|2241994_2242087_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|2242166_2243465_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208650.1|2243579_2245760_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|2245779_2246226_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|2246213_2247353_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742335.1|2247398_2249495_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|2249494_2250241_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|2250237_2250882_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|2250988_2251294_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|2251735_2251948_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|2252233_2252446_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|2252456_2252645_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|2252619_2252850_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2252839_2253013_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818477.1|2253061_2254135_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001399304.1|2254206_2256951_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
WP_000533662.1|2257045_2258119_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.7	1.3e-200
WP_001303849.1|2258096_2258315_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|2258354_2258522_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000022062.1|2258610_2258892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208006.1|2259006_2259804_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000582238.1|2259814_2260570_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	4.2e-142
WP_106902980.1|2260571_2260949_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	90.4	3.1e-61
WP_000763386.1|2260945_2261167_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_001443983.1|2261265_2261547_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548546.1|2261557_2261749_-	DUF1382 family protein	NA	A0A0P0ZC49	Stx2-converting_phage	100.0	4.3e-27
WP_032204932.1|2261721_2261904_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.2e-28
WP_000186740.1|2261903_2262581_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100845.1|2262577_2263363_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|2263368_2263665_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372922.1|2263719_2263884_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	9.3e-23
WP_001198859.1|2263852_2264017_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	9.0e-26
WP_001132915.1|2264089_2264458_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	96.7	1.1e-63
WP_000213975.1|2264643_2264844_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_072097037.1|2265592_2266048_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	6.8e-63
WP_096910866.1|2266396_2267215_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001274756.1|2267381_2268095_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|2268195_2268396_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|2268514_2268808_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185425.1|2268840_2269740_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	6.0e-172
WP_000788869.1|2269736_2270438_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145926.1|2270434_2270725_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|2270798_2271239_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_001254222.1|2271235_2271418_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566869.1|2271414_2271585_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001108066.1|2271577_2272198_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	2.0e-94
WP_001028836.1|2272194_2272860_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	3.2e-130
WP_000750155.1|2273071_2274031_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|2274369_2274492_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097237.1|2274506_2275196_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_122986323.1|2275379_2276123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|2276208_2276367_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001341423.1|2278862_2279537_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|2279533_2279881_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|2279900_2281457_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000411802.1|2281679_2281886_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001135302.1|2281885_2282383_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000092313.1|2282379_2282817_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001307652.1|2283770_2283965_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001429103.1|2284392_2284899_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_001299181.1|2284870_2286799_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	1.8e-261
WP_000259002.1|2286782_2286989_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|2286985_2288578_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001254023.1|2288567_2290073_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_000256807.1|2290109_2290457_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522623.1|2290514_2291543_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2291594_2291978_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204559.1|2291970_2292324_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000975030.1|2292338_2292872_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|2292868_2293264_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
2292896:2292914	attR	GTGCTGGATGCACTGGAGC	NA	NA	NA	NA
WP_001143019.1|2293271_2294024_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|2294037_2294469_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|2294495_2294909_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000082371.1|2294889_2297469_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.6	0.0e+00
WP_000847298.1|2297465_2297795_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|2297794_2298493_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_032212652.1|2298498_2299242_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	5.6e-147
WP_122994837.1|2299187_2299820_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	93.3	3.1e-98
WP_106902981.1|2300055_2303532_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.1	0.0e+00
WP_024174257.1|2303600_2304176_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_032212660.1|2304240_2305554_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_032212659.1|2305555_2305825_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
WP_001131642.1|2305938_2306514_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|2306804_2307386_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|2307453_2308089_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|2308216_2309275_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|2309349_2310000_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|2310182_2310773_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|2311046_2311910_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531590.1|2311893_2313030_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.2	2.1e-28
>prophage 153
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2318050	2319421	5400138		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|2318050_2319421_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 154
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2322557	2326286	5400138		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444487.1|2322557_2323808_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001399714.1|2323910_2324234_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	66.4	5.5e-43
WP_032141808.1|2324766_2324877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373106.1|2324929_2325334_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|2325554_2326286_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 155
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2343011	2344699	5400138		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|2343011_2343431_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457619.1|2343430_2344699_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.9e-209
>prophage 156
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2371441	2374193	5400138		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|2371441_2373121_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|2373245_2374193_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 157
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2377329	2384133	5400138		Pseudomonas_phage(33.33%)	9	NA	NA
WP_000804731.1|2377329_2378412_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|2378411_2379245_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|2379241_2379634_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|2379637_2380447_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|2380482_2381337_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170954.1|2381485_2381593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170965.1|2382020_2382128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295620.1|2382532_2383633_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|2383902_2384133_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 158
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2395386	2405397	5400138		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|2395386_2396925_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|2396921_2397632_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|2397631_2398309_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|2399034_2399877_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|2399926_2400385_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001399713.1|2400497_2401403_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|2401494_2402508_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|2402709_2403618_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|2403761_2404175_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|2404779_2405397_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 159
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2413807	2415822	5400138		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|2413807_2414821_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|2414817_2415822_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 160
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2425161	2449578	5400138	transposase,tail	Escherichia_phage(40.0%)	29	NA	NA
WP_000048547.1|2425161_2427633_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.6e-57
WP_001090200.1|2427725_2427917_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2427913_2428102_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2428499_2428667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2428660_2428894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2428871_2429279_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2429301_2429520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2429592_2429892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2430156_2430564_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2430640_2430868_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705623.1|2430851_2431403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2431374_2432415_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157830737.1|2432326_2432869_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|2432902_2433637_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_122368318.1|2433633_2433798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2434496_2435255_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2435533_2435746_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|2435966_2436224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2436293_2436572_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001370670.1|2436573_2437566_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	47.3	7.3e-78
WP_085947772.1|2437850_2439063_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001101707.1|2440782_2441052_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_106902982.1|2442077_2443403_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	5.0e-215
WP_106409364.1|2444998_2445121_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2445227_2446139_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2446204_2446774_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|2447941_2448220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2448647_2448794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2448930_2449578_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
>prophage 161
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2457527	2460485	5400138		Acinetobacter_phage(100.0%)	2	NA	NA
WP_024174254.1|2457527_2458886_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763513.1|2458889_2460485_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	1.9e-51
>prophage 162
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2465418	2470710	5400138	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559250.1|2465418_2466177_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422070.1|2466396_2467446_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	7.9e-22
WP_001031530.1|2467481_2467733_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|2468112_2470710_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 163
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2475634	2476225	5400138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|2475634_2476225_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 164
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2484040	2489698	5400138		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484982.1|2484040_2485975_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001356195.1|2486042_2487170_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|2487314_2488103_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968852.1|2488470_2488824_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|2488891_2489698_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 165
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2502613	2503879	5400138		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|2502613_2503879_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 166
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2517881	2518964	5400138		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|2517881_2518964_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 167
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2537146	2537662	5400138		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|2537146_2537662_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 168
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2543989	2630796	5400138	tRNA,integrase,transposase,holin,terminase,portal,protease,tail	Escherichia_phage(44.26%)	91	2544841:2544857	2634087:2634103
WP_000628065.1|2543989_2545222_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2544841:2544857	attL	GTTTTTTGCGCTGATAA	NA	NA	NA	NA
WP_000387388.1|2545476_2546460_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|2546734_2546908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123758.1|2546937_2548311_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157421.1|2548439_2549375_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000040852.1|2549426_2550662_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2550663_2550879_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2550957_2551167_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2551159_2551354_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000595429.1|2551410_2552220_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
WP_000102191.1|2552212_2554882_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	59.6	2.0e-194
WP_001427414.1|2554962_2555133_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560223.1|2555132_2555354_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001169149.1|2555778_2555931_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_001253182.1|2556311_2556776_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_000171139.1|2556880_2557156_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_000702023.1|2557139_2557562_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000899743.1|2557574_2558432_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	94.4	4.0e-80
WP_000788989.1|2558438_2559185_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_001370676.1|2559206_2559968_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	2.0e-120
WP_001151266.1|2559983_2560400_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.2	1.6e-58
WP_001275735.1|2560396_2560870_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	2.9e-64
WP_001204666.1|2561192_2561771_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156213.1|2561730_2562828_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
WP_085947598.1|2563381_2564544_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000813257.1|2564646_2564802_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_000119356.1|2565013_2565193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|2565211_2565697_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000940340.1|2566158_2566758_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000228018.1|2566757_2567048_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|2567044_2567599_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_106875738.1|2569140_2571087_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.1	0.0e+00
WP_000142777.1|2571223_2571403_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|2571443_2571689_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|2571765_2571981_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|2571985_2572519_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|2572789_2573359_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2573358_2573505_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2573732_2573918_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348566.1|2574433_2574910_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.2	2.2e-80
WP_001077633.1|2574906_2577030_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000102415.1|2577026_2577239_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974578.1|2577238_2578741_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.4	4.5e-289
WP_001114424.1|2578685_2580710_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_024025855.1|2580797_2581124_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	2.3e-49
WP_001281345.1|2581116_2581398_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
WP_000974955.1|2581400_2582024_+	hypothetical protein	NA	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_000682719.1|2582036_2582435_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	2.9e-70
WP_000235098.1|2582442_2583195_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|2583208_2583631_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|2583657_2584071_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212711.1|2584051_2586664_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.9	0.0e+00
WP_000847298.1|2586660_2586990_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212713.1|2586989_2587688_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_032212700.1|2587698_2588442_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_136865629.1|2588387_2589017_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	4.4e-105
WP_032212631.1|2589257_2592731_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.0	0.0e+00
WP_001230471.1|2592798_2593398_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_032212629.1|2593462_2594776_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023356.1|2594777_2595047_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_122988840.1|2595157_2595235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|2595449_2596463_+	peptidase M85	NA	NA	NA	NA	NA
WP_085948186.1|2596511_2597668_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001295593.1|2598522_2598957_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837940.1|2599097_2600231_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	59.1	6.3e-118
WP_000628168.1|2600596_2604121_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2604394_2604661_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001295716.1|2604657_2605080_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|2605190_2606180_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_000900919.1|2606387_2609027_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698141.1|2609023_2609209_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001296730.1|2609216_2609543_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067509.1|2609714_2610620_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138618.1|2610855_2612355_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000535469.1|2612412_2614686_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186507.1|2614933_2616979_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191073.1|2617263_2618193_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2618204_2618492_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072831.1|2618500_2619247_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189197.1|2619261_2619759_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206362.1|2619766_2620837_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292357.1|2620833_2621601_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969780.1|2621600_2622389_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973382.1|2622390_2623818_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018416.1|2623807_2624230_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206188.1|2624229_2625435_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632286.1|2625461_2626775_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039890.1|2626875_2627826_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123454.1|2627807_2628398_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000097838.1|2628629_2629490_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_085948186.1|2629639_2630796_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
2634087:2634103	attR	GTTTTTTGCGCTGATAA	NA	NA	NA	NA
>prophage 169
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2638399	2642302	5400138		Klosneuvirus(100.0%)	1	NA	NA
WP_000139574.1|2638399_2642302_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 170
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2646241	2647190	5400138		Escherichia_phage(50.0%)	2	NA	NA
WP_001397126.1|2646241_2646772_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	2.4e-19
WP_000731833.1|2647016_2647190_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 171
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2658448	2670484	5400138	transposase	Escherichia_phage(33.33%)	11	NA	NA
WP_096910863.1|2658448_2659662_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000826419.1|2660310_2661519_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	9.5e-205
WP_001326689.1|2661558_2662773_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429141.1|2662825_2663362_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001301045.1|2663434_2665396_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|2665487_2665718_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|2665939_2666116_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|2666161_2666578_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760614.1|2666656_2668063_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047456.1|2668307_2669453_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|2669470_2670484_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 172
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2678936	2681039	5400138		Salmonella_phage(100.0%)	1	NA	NA
WP_000689366.1|2678936_2681039_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	1.8e-134
>prophage 173
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2685946	2688088	5400138		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103401.1|2685946_2688088_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.4	6.3e-26
>prophage 174
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2699902	2701447	5400138		Escherichia_phage(100.0%)	1	NA	NA
WP_000702557.1|2699902_2701447_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 175
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2708333	2708624	5400138		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|2708333_2708624_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 176
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2714636	2716077	5400138		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|2714636_2714921_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642421.1|2715066_2716077_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	1.2e-24
>prophage 177
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2719350	2721256	5400138		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285540.1|2719350_2720277_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193519.1|2720269_2721256_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	2.5e-17
>prophage 178
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2725572	2729379	5400138		Klosneuvirus(50.0%)	2	NA	NA
WP_024174248.1|2725572_2727972_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|2727996_2729379_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 179
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2734659	2741595	5400138		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_072097035.1|2734659_2737455_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	1.2e-19
WP_000832446.1|2737499_2739872_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628546.1|2739909_2741595_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	1.9e-09
>prophage 180
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2758895	2760296	5400138		Escherichia_phage(100.0%)	1	NA	NA
WP_032204084.1|2758895_2760296_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.2	6.9e-106
>prophage 181
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2767718	2769254	5400138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194883.1|2767718_2769254_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
>prophage 182
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2777135	2778554	5400138		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|2777135_2778554_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 183
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2786300	2924770	5400138	head,capsid,transposase,holin,terminase,portal,protease,tail	Enterobacteria_phage(32.14%)	156	NA	NA
WP_000091199.1|2786300_2786684_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|2786715_2786934_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_085948186.1|2787452_2788609_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001022785.1|2789721_2791395_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|2791450_2791762_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001370581.1|2791789_2793112_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|2793226_2793538_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|2793736_2794435_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|2794479_2795379_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054189.1|2795573_2796761_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|2796887_2796983_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592837.1|2797201_2798092_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_000671731.1|2798346_2798739_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024746.1|2799014_2799533_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001370614.1|2799576_2801622_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|2801758_2802505_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|2802593_2803280_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|2803457_2803661_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000347482.1|2805246_2806530_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2806589_2806904_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_122993102.1|2807274_2808288_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2808502_2808580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023386.1|2808690_2808960_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_032212694.1|2808961_2810275_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_001230496.1|2810339_2810939_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_032212772.1|2811005_2814482_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.1	0.0e+00
WP_077696211.1|2814717_2815353_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_001370115.1|2815298_2816042_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_001299882.1|2816047_2816746_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847401.1|2816745_2817075_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_032212771.1|2817071_2819684_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000533440.1|2819664_2820078_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|2820104_2820527_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|2820540_2821293_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683137.1|2821300_2821696_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_024025847.1|2821692_2822271_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	6.6e-79
WP_000753019.1|2822282_2822636_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|2822647_2823043_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_024025845.1|2823084_2824110_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_001299443.1|2824165_2824498_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_032212710.1|2824507_2825827_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.6e-232
WP_024026143.1|2825807_2827409_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000198153.1|2827405_2827612_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2827608_2829534_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2829508_2830054_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2830440_2830665_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2830746_2831061_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2831586_2831772_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_085948186.1|2832007_2833163_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000539795.1|2833261_2833408_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2833407_2833977_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|2834247_2834781_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000731236.1|2834831_2835176_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411802.1|2835180_2835387_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023191.1|2835834_2837685_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000466957.1|2838163_2838595_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_096910863.1|2838722_2839936_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000301797.1|2840358_2841072_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917748.1|2841207_2841405_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
WP_000640035.1|2841629_2842184_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217447.1|2842192_2842552_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|2842564_2843614_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2843615_2843888_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2844009_2844354_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2844473_2844686_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104475.1|2844919_2845477_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.3	2.4e-33
WP_000683609.1|2845478_2845697_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2845824_2846136_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2846128_2846356_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2846352_2846634_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2846666_2847383_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2847416_2847878_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262401.1|2847870_2848938_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	85.3	1.9e-84
WP_000693878.1|2849006_2849432_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2849415_2849658_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2850049_2850388_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2850680_2850833_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2850844_2851483_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2851483_2851693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2852257_2852446_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2852442_2852631_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_085948186.1|2852916_2854073_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001487236.1|2854251_2854596_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	59.6	4.2e-33
WP_085948186.1|2856631_2857787_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_120795384.1|2859042_2859156_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2859224_2859458_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086528.1|2859774_2860362_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	6.1e-24
WP_001332695.1|2860459_2861035_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	3.2e-102
WP_072004194.1|2861034_2863989_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	6.0e-67
WP_001230525.1|2864053_2864653_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	8.8e-111
WP_000515486.1|2864719_2868118_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_001399694.1|2868178_2868826_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_000140752.1|2868723_2869467_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_001152409.1|2869472_2870171_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000447255.1|2870180_2870510_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	8.6e-60
WP_000372036.1|2870509_2873575_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_001161009.1|2873546_2873876_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001370402.1|2873884_2874271_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_000211089.1|2874331_2875075_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	4.0e-129
WP_001079398.1|2875086_2875488_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|2875484_2876063_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283147.1|2876074_2876350_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097046.1|2876342_2876666_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_077633710.1|2878724_2880305_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	1.1e-288
WP_001072975.1|2880232_2880445_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000133409.1|2881927_2882209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860401.1|2882466_2884356_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000126660.1|2885014_2885437_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001399692.1|2885433_2885679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833609.1|2885966_2887793_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	2.0e-129
WP_001261504.1|2887789_2888089_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113138.1|2888095_2888416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024200973.1|2888408_2888672_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000179578.1|2888809_2889115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130338.1|2889172_2889370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038673.1|2889490_2890069_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	65.4	4.9e-58
WP_000229066.1|2890128_2890353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087661054.1|2890793_2892007_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001399690.1|2893014_2893986_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.7	3.1e-182
WP_000421825.1|2894060_2894600_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|2895152_2895359_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|2895659_2896070_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019140.1|2896221_2896395_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2896566_2896722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2896801_2896867_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2896869_2897058_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2897068_2897281_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2897642_2898140_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2898136_2898670_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_024025755.1|2898982_2899198_-|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	5.5e-31
WP_000066485.1|2899951_2900167_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000087756.1|2900467_2900680_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2900734_2900824_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000203370.1|2901450_2901636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047121.1|2902796_2903549_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
WP_001265275.1|2903562_2904612_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
WP_012775982.1|2904613_2904892_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_096910863.1|2905164_2906377_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001296941.1|2907651_2907888_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000997984.1|2908045_2909584_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_000612591.1|2909633_2909981_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001066422.1|2910162_2911719_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|2911738_2912086_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|2912082_2912757_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000836078.1|2912998_2913565_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	30.2	1.5e-11
WP_001370501.1|2913576_2914791_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|2914996_2915323_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_000705196.1|2915457_2915799_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2915833_2916394_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_024025734.1|2916396_2917107_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2917214_2917520_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041709.1|2917718_2920145_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.0e-214
WP_024025733.1|2920205_2922629_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	2.9e-205
WP_000213028.1|2922639_2923257_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|2923258_2924113_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2924155_2924770_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 184
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2942531	2943833	5400138		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|2942531_2943833_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 185
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2953728	2955540	5400138		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|2953728_2955540_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 186
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2975038	2976313	5400138	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2975038_2976313_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 187
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2983224	2984723	5400138		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|2983224_2983746_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|2983826_2984723_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 188
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	2993525	3002317	5400138		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|2993525_2994341_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2994468_2995050_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|2995195_2996365_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2996530_2996620_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2996918_2997944_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|2997940_2998873_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182361.1|2998985_3000197_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|3000487_3001636_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|3001675_3002317_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 189
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3007821	3010088	5400138		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|3007821_3008634_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069986.1|3008637_3009423_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|3009419_3010088_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 190
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3018377	3023461	5400138		environmental_halophage(33.33%)	5	NA	NA
WP_000144589.1|3018377_3019598_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	1.7e-92
WP_000908001.1|3019594_3020866_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948876.1|3020840_3021587_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	7.6e-11
WP_000089364.1|3021596_3023084_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|3023092_3023461_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 191
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3043761	3061598	5400138	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_000069374.1|3043761_3046140_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|3046472_3047306_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|3047462_3048509_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001399170.1|3048640_3048832_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175614.1|3048835_3050272_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001370474.1|3050334_3051048_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209785.1|3051294_3051759_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|3051836_3052586_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154183.1|3052585_3053137_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|3053199_3054180_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|3054280_3054580_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|3054584_3056972_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018605.1|3056986_3057970_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|3058252_3058297_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3058419_3058776_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3058829_3059027_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|3059123_3059666_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|3059669_3061598_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 192
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3072865	3075127	5400138		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|3072865_3075127_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 193
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3081465	3082293	5400138		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|3081465_3082293_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 194
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3089769	3090990	5400138		Klosneuvirus(100.0%)	1	NA	NA
WP_000081996.1|3089769_3090990_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	2.5e-27
>prophage 195
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3097765	3098419	5400138		Planktothrix_phage(100.0%)	1	NA	NA
WP_001370496.1|3097765_3098419_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	2.9e-14
>prophage 196
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3104017	3105979	5400138		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|3104017_3105979_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 197
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3110905	3114990	5400138		Tupanvirus(50.0%)	4	NA	NA
WP_001120535.1|3110905_3111547_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_000438810.1|3111639_3112998_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|3113114_3113873_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723723.1|3114009_3114990_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 198
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3123803	3124658	5400138		Indivirus(100.0%)	1	NA	NA
WP_001186347.1|3123803_3124658_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.1e-10
>prophage 199
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3127976	3132553	5400138		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|3127976_3129260_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|3129406_3130882_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|3131062_3132553_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 200
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3147307	3155413	5400138	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_024026081.1|3147307_3148993_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	3.4e-35
WP_000290576.1|3149197_3149779_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220952.1|3149818_3150514_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128842.1|3150571_3152482_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	1.7e-91
WP_001295493.1|3152613_3152958_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|3153319_3153679_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|3153798_3153978_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855002.1|3154051_3155413_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.6e-41
>prophage 201
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3159275	3160832	5400138		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|3159275_3160832_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 202
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3166473	3166683	5400138		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3166473_3166683_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 203
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3172013	3174062	5400138		Moraxella_phage(100.0%)	1	NA	NA
WP_001055780.1|3172013_3174062_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	2.3e-86
>prophage 204
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3181559	3186028	5400138		Escherichia_phage(33.33%)	7	NA	NA
WP_000812712.1|3181559_3182216_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976478.1|3182610_3182952_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879277.1|3182964_3183837_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168739.1|3183840_3184215_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3184353_3184584_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|3184685_3185342_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944246.1|3185365_3186028_+	exodeoxyribonuclease X	NA	A0A0A7RWA3	Clostridium_phage	32.5	4.4e-10
>prophage 205
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3194084	3195560	5400138		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|3194084_3195560_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 206
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3199559	3206623	5400138		Bacillus_virus(50.0%)	9	NA	NA
WP_001184022.1|3199559_3200882_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|3200897_3201830_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000203009.1|3201908_3202664_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.7e-18
WP_000571465.1|3202660_3203446_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|3203592_3204603_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|3204611_3205223_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|3205361_3205427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024930.1|3205497_3206100_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|3206101_3206623_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 207
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3210641	3212692	5400138		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|3210641_3211460_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|3211512_3211908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|3211948_3212692_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 208
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3219308	3290999	5400138	tRNA,plate,integrase,capsid,head,transposase,holin,terminase,portal,tail	Enterobacteria_phage(64.71%)	83	3255384:3255443	3291942:3292065
WP_001025305.1|3219308_3221042_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	5.7e-86
WP_001341423.1|3221222_3221897_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|3221893_3222241_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106902985.1|3222260_3223817_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	3.7e-161
WP_001171554.1|3223965_3224346_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3224342_3224690_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997984.1|3224739_3226278_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_001370468.1|3226385_3226874_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|3226993_3227386_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|3227385_3229464_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278912.1|3229456_3230605_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983611.1|3230806_3231451_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763874.1|3231461_3231851_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	34.6	1.0e-06
WP_000036378.1|3231865_3232915_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|3232917_3233778_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483246.1|3233796_3235398_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.2e-15
WP_001370571.1|3235443_3237105_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000147302.1|3237249_3237753_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001355823.1|3237773_3239738_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3239742_3240669_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906322.1|3240665_3241553_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3241679_3242258_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|3242260_3242611_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|3243390_3243819_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001370485.1|3243825_3245250_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|3245224_3246025_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|3246191_3247178_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187811.1|3247192_3248707_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|3248776_3249766_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3250562_3251066_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|3251144_3251396_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3251510_3251597_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237866.1|3251859_3252183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3252353_3252851_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|3252888_3253128_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|3253318_3254530_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|3254591_3255257_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
3255384:3255443	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|3255613_3256615_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865386.1|3256620_3256968_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000786769.1|3257663_3258068_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|3258157_3258295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3258366_3258570_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3258591_3258942_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159467.1|3258952_3259231_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	5.3e-34
WP_000514274.1|3259242_3259485_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000021655.1|3259481_3259595_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_029594336.1|3259709_3260105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985144.1|3260128_3260332_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000153711.1|3260328_3260595_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000108347.1|3260591_3260891_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.9	9.0e-40
WP_122985482.1|3260902_3261520_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564228.1|3261516_3261906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000686474.1|3264820_3265780_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	6.4e-180
WP_000211270.1|3265784_3266096_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	4.2e-48
WP_001289970.1|3266159_3266543_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	9.8e-31
WP_000711111.1|3266634_3267165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087807.1|3267694_3268741_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
WP_000613773.1|3268740_3270492_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262656.1|3270646_3271483_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.5e-148
WP_001055112.1|3271506_3272559_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_000632364.1|3272604_3273405_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	97.4	3.3e-137
WP_000063078.1|3273507_3274002_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	2.3e-88
WP_000864901.1|3274001_3274202_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104342.1|3274204_3274528_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	100.0	4.2e-51
WP_000072327.1|3274524_3274917_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|3274913_3275321_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920594.1|3275458_3275926_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356316.1|3275918_3276554_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_001271900.1|3276550_3277132_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.4e-100
WP_000213447.1|3277128_3277479_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111920.1|3277482_3278379_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_000071720.1|3278371_3278902_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_087661054.1|3280489_3281702_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000885638.1|3282218_3282836_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_001447286.1|3282799_3283345_-	transferase	NA	NA	NA	NA	NA
WP_000853431.1|3284023_3286831_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_000333494.1|3286817_3286973_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665308.1|3286981_3287347_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|3287401_3287914_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005425.1|3287913_3289098_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000132830.1|3289255_3290365_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488108.1|3290407_3290668_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3290858_3290999_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
3291942:3292065	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 209
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3297256	3298009	5400138		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|3297256_3298009_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 210
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3310359	3311028	5400138		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334596.1|3310359_3311028_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
>prophage 211
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3325045	3337427	5400138		Bacillus_phage(28.57%)	12	NA	NA
WP_024026113.1|3325045_3326740_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.0e-18
WP_000009307.1|3326910_3327093_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|3327171_3328089_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212238.1|3328261_3329182_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|3329170_3329641_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|3329621_3331040_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365561.1|3331106_3331802_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_072097048.1|3331841_3332207_-	permease	NA	NA	NA	NA	NA
WP_000824361.1|3332773_3333847_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	8.1e-99
WP_000218204.1|3334438_3335290_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826745.1|3335397_3336756_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.2	5.1e-05
WP_001339045.1|3336755_3337427_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 212
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3340971	3343992	5400138	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_001079059.1|3340971_3341502_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_101329674.1|3342719_3343992_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	8.3e-175
>prophage 213
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3349835	3354601	5400138	integrase,transposase	Acinetobacter_phage(50.0%)	3	3340994:3341008	3369326:3369340
3340994:3341008	attL	AAATTTATTTACATT	NA	NA	NA	NA
WP_085948186.1|3349835_3350991_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000067202.1|3353372_3353576_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|3353575_3354601_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
3369326:3369340	attR	AATGTAAATAAATTT	NA	NA	NA	NA
>prophage 214
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3363353	3364567	5400138	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_087661054.1|3363353_3364567_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 215
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3372588	3373851	5400138	integrase	Stenotrophomonas_phage(100.0%)	1	3372348:3372407	3384272:3384358
3372348:3372407	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_000055677.1|3372588_3373851_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.2e-72
WP_000055677.1|3372588_3373851_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.2e-72
3384272:3384358	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTCAA	NA	NA	NA	NA
>prophage 216
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3389949	3390759	5400138		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000034.1|3389949_3390759_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.1	4.1e-10
>prophage 217
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3408252	3409419	5400138		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830155.1|3408252_3409419_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	6.5e-227
>prophage 218
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3417063	3417963	5400138		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|3417063_3417963_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 220
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3451797	3458591	5400138		Bacillus_phage(25.0%)	6	NA	NA
WP_001370567.1|3451797_3453168_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.9e-32
WP_032211551.1|3453360_3454797_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	9.7e-47
WP_000699721.1|3454799_3456023_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479842.1|3456019_3456499_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|3456501_3457467_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|3457469_3458591_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 221
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3462835	3473311	5400138		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|3462835_3463675_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137094.1|3463852_3466015_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|3466017_3466461_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|3466466_3467606_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454701.1|3468264_3469848_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252305.1|3470121_3471975_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|3471996_3472578_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|3472669_3473311_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 222
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3477975	3479322	5400138		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469744.1|3477975_3479322_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.4	1.3e-05
>prophage 223
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3493822	3500696	5400138	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675158.1|3493822_3495226_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|3495222_3495945_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|3496135_3496468_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|3496676_3496973_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|3496974_3497271_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476010.1|3497373_3498735_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	6.1e-216
WP_001295425.1|3499064_3499382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807346.1|3499796_3500696_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
>prophage 224
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3509916	3513473	5400138		Serratia_phage(50.0%)	4	NA	NA
WP_000846247.1|3509916_3510921_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	3.7e-13
WP_000011997.1|3510917_3511883_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|3511856_3512603_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351455.1|3512654_3513473_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
>prophage 225
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3524121	3526155	5400138	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001370528.1|3524121_3526155_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 226
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3537787	3547229	5400138		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001370574.1|3537787_3538924_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001370558.1|3538920_3540921_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|3541045_3541507_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370504.1|3541547_3542018_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_000598641.1|3542064_3542784_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3542780_3544466_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3544687_3545419_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3545478_3545586_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3545566_3546298_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|3546302_3547229_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 227
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3567545	3569066	5400138		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|3567545_3569066_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 228
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3572760	3576546	5400138		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|3572760_3573429_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425430.1|3573686_3574523_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489250.1|3574554_3576546_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 229
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3580615	3581473	5400138		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|3580615_3581473_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 230
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3596096	3600397	5400138		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848208.1|3596096_3597563_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	2.3e-43
WP_000198822.1|3597680_3598667_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001296828.1|3598705_3599419_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|3599830_3600397_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 231
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3606151	3613800	5400138		Vibrio_phage(50.0%)	7	NA	NA
WP_000194915.1|3606151_3607741_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|3607744_3608089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|3608421_3609612_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|3609639_3610335_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578135.1|3610484_3612245_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	7.1e-100
WP_000494183.1|3612369_3612654_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|3612792_3613800_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 232
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3625498	3626116	5400138		Bacillus_virus(100.0%)	1	NA	NA
WP_001296826.1|3625498_3626116_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 233
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3634884	3640662	5400138		Bacillus_phage(25.0%)	5	NA	NA
WP_000422169.1|3634884_3636528_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	7.2e-14
WP_000884957.1|3636603_3637254_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786348.1|3637253_3638318_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	2.4e-18
WP_000406103.1|3638391_3639447_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_106902986.1|3639558_3640662_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.7	1.6e-118
>prophage 234
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3644938	3649781	5400138		Hokovirus(50.0%)	2	NA	NA
WP_000876014.1|3644938_3647788_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559125.1|3647954_3649781_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 235
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3664704	3678818	5400138		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281242.1|3664704_3667332_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990766.1|3667478_3668201_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_024025996.1|3668328_3672063_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	24.8	3.1e-20
WP_001075170.1|3672758_3675044_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|3675190_3676321_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|3676320_3676575_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301048.1|3676628_3677279_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000772514.1|3677741_3678818_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	43.8	1.3e-08
>prophage 236
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3684711	3689027	5400138	transposase	Sodalis_phage(50.0%)	4	NA	NA
WP_000140570.1|3684711_3685614_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000992959.1|3685654_3686458_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001370560.1|3686475_3687765_-	MFS transporter	NA	NA	NA	NA	NA
WP_001370513.1|3687821_3689027_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	5.5e-27
>prophage 237
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3692630	3697634	5400138		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|3692630_3693233_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001399222.1|3693540_3694680_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.7	3.8e-30
WP_000461657.1|3694683_3695652_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860242.1|3695651_3697634_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 238
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3732046	3735274	5400138		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|3732046_3732646_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|3732704_3734537_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203394.1|3734623_3735274_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	28.0	2.1e-09
>prophage 239
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3745833	3747694	5400138		Sodalis_phage(50.0%)	2	NA	NA
WP_000156151.1|3745833_3746724_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.6	2.6e-66
WP_001293612.1|3746920_3747694_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 240
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3751905	3753423	5400138		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|3751905_3753423_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 241
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3759899	3761036	5400138		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|3759899_3761036_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 242
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3769591	3770677	5400138		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|3769591_3770677_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 243
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3788547	3855689	5400138	integrase,capsid,transposase,protease,holin,tail	Escherichia_phage(58.33%)	84	3789555:3789579	3855884:3855908
WP_000368131.1|3788547_3789480_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3789555:3789579	attL	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000885695.1|3789702_3798078_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	97.0	0.0e+00
WP_001370495.1|3798146_3799139_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.0	3.3e-163
WP_085948186.1|3799211_3800368_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000540396.1|3800689_3800941_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	97.4	5.1e-12
WP_000455646.1|3800950_3801397_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_000509480.1|3801399_3802053_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	96.8	1.1e-109
WP_000035554.1|3802146_3802548_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.0	3.9e-70
WP_000682942.1|3802977_3803700_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	76.7	9.0e-102
WP_001399382.1|3803846_3804404_-	hypothetical protein	NA	Q08J77	Stx2-converting_phage	98.9	5.5e-107
WP_001369201.1|3804409_3804691_-	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_000162956.1|3804705_3805974_-	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
WP_001146329.1|3805970_3807596_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_001370566.1|3807899_3808079_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001023433.1|3808216_3808486_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_000117996.1|3808487_3810326_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_000207919.1|3810322_3810973_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000829203.1|3810972_3811536_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
WP_001370499.1|3811519_3811981_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
WP_001140444.1|3812031_3812421_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214470.1|3812475_3813690_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.5	1.1e-232
WP_000345010.1|3813713_3814721_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787524.1|3814878_3817023_-	hypothetical protein	NA	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
WP_000143998.1|3817022_3818729_-	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	99.1	0.0e+00
WP_001086087.1|3818709_3819516_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	99.3	1.1e-132
WP_001109019.1|3819808_3820360_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_012816791.1|3820587_3820773_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000455406.1|3821000_3821150_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056887.1|3821149_3821719_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	2.6e-104
WP_000087714.1|3821993_3822527_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_000284510.1|3822531_3822747_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290216.1|3822823_3823096_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	3.1e-23
WP_000143462.1|3823136_3823316_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_000874429.1|3823451_3825389_-	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.7	0.0e+00
WP_000738068.1|3825875_3826145_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|3826156_3827116_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|3827498_3827651_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|3827899_3828334_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|3828326_3828521_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001108009.1|3828517_3829123_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	98.0	2.4e-95
WP_001004008.1|3829122_3829845_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_000178727.1|3829919_3830594_-	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.8	6.2e-113
WP_000201604.1|3830859_3831225_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	96.7	3.7e-43
WP_001254258.1|3831481_3831676_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153293.1|3831672_3832200_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
WP_000573864.1|3832196_3832799_-	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|3832791_3833208_-	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|3833381_3833597_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_000818843.1|3833741_3833948_-	hypothetical protein	NA	G9L683	Escherichia_phage	100.0	2.7e-27
WP_001036028.1|3834020_3834290_-	hypothetical protein	NA	G9L682	Escherichia_phage	100.0	2.9e-45
WP_001248397.1|3834286_3836680_-	DNA helicase	NA	G9L681	Escherichia_phage	99.7	0.0e+00
WP_000431329.1|3836676_3837564_-	hypothetical protein	NA	G9L680	Escherichia_phage	99.7	2.8e-145
WP_001244621.1|3837626_3837899_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000438537.1|3837921_3838221_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_001180318.1|3838327_3838555_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250472.1|3838633_3839341_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	1.5e-133
WP_000885926.1|3839401_3839743_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001189994.1|3839929_3840748_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001370067.1|3841196_3841538_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_096910863.1|3841698_3842912_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_157910050.1|3842949_3843486_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	94.8	1.1e-88
WP_000065353.1|3843666_3844035_+	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
WP_001198858.1|3844107_3844248_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361831.1|3844240_3844354_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|3844350_3844539_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|3844547_3845228_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000073097.1|3845224_3845812_+	hypothetical protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
WP_001111288.1|3845835_3846132_+	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_001370500.1|3846142_3846307_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_000812196.1|3846303_3846912_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	93.6	1.0e-82
WP_000034212.1|3846908_3847316_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|3847317_3847509_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206781.1|3847511_3847961_+	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.0e-20
WP_106902987.1|3848001_3848871_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.6	4.0e-64
WP_087661054.1|3848836_3850050_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000224734.1|3850555_3850753_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000628763.1|3851266_3852142_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	86.1	5.4e-141
WP_000969524.1|3852138_3852399_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
WP_000002101.1|3852398_3852683_+	ASCH domain-containing protein	NA	A0A0P0ZDM1	Stx2-converting_phage	97.9	7.7e-49
WP_000609349.1|3852731_3853400_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	95.2	1.1e-104
WP_001291844.1|3853640_3853853_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994804.1|3853888_3854275_+	DUF1627 domain-containing protein	NA	A0A2L1IV77	Escherichia_phage	100.0	4.6e-52
WP_000453637.1|3854353_3854536_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|3854519_3855689_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
3855884:3855908	attR	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 244
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3863734	3871308	5400138		Hokovirus(50.0%)	4	NA	NA
WP_001399259.1|3863734_3867328_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	31.8	8.6e-36
WP_001370527.1|3867383_3868526_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3868599_3869544_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|3869613_3871308_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 245
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3874999	3875920	5400138		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3874999_3875920_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 246
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3879738	3880473	5400138		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3879738_3880473_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 247
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3901889	3913583	5400138		Streptococcus_phage(40.0%)	11	NA	NA
WP_000443665.1|3901889_3903905_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|3903975_3904962_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3905191_3905953_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3906137_3907109_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3907492_3907750_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623149.1|3907794_3909522_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|3909562_3910072_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096647.1|3910113_3910965_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|3911069_3911438_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|3911440_3912352_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021016.1|3912485_3913583_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	33.2	3.2e-26
>prophage 248
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3916600	3917392	5400138		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|3916600_3917392_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 249
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3920870	3925954	5400138		Mycobacterium_phage(33.33%)	6	NA	NA
WP_024026008.1|3920870_3922175_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	2.1e-08
WP_000084590.1|3922232_3923132_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|3923227_3923803_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001399260.1|3924009_3924459_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|3924445_3924871_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|3925084_3925954_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 250
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3944602	3945553	5400138		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3944602_3945553_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 251
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3963613	3964327	5400138		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3963613_3964327_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 252
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3985359	3989361	5400138		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|3985359_3986649_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3986734_3987361_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|3987685_3988723_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|3988722_3989361_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 253
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	3995795	4002092	5400138		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|3995795_3995969_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|3996282_3996798_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|3996813_3997353_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138282.1|3997447_3999025_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|3999093_4000560_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|4000721_4002092_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 254
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4010921	4011353	5400138		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4010921_4011353_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 255
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4021238	4027695	5400138		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133580.1|4021238_4022522_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|4022699_4022900_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|4022911_4023247_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196586.1|4023248_4025099_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.4	3.6e-102
WP_000384411.1|4025115_4025631_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|4025726_4026050_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|4026066_4026453_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|4026480_4027695_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 256
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4042859	4044371	5400138		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493439.1|4042859_4044371_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	2.8e-12
>prophage 257
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4050129	4061437	5400138		Bacillus_phage(50.0%)	7	NA	NA
WP_000919163.1|4050129_4051383_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883083.1|4051710_4052901_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|4052945_4053284_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|4053344_4054679_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215866.1|4054668_4055382_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298980.1|4055546_4056974_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970075.1|4057549_4061437_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
>prophage 258
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4065555	4065816	5400138		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4065555_4065816_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 259
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4069275	4073018	5400138		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|4069275_4069956_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002528.1|4070228_4071203_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|4071218_4073018_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 260
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4077902	4177667	5400138	tRNA,integrase,capsid,head,transposase,holin,terminase,tail	Stx2-converting_phage(41.3%)	87	4161446:4161462	4185065:4185081
WP_001370572.1|4077902_4078640_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|4078771_4080106_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001370459.1|4080314_4081196_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|4081298_4081886_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4081941_4082325_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|4082629_4083319_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|4083366_4084404_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4084610_4085030_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001370531.1|4085098_4085797_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082964.1|4085828_4088489_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4088602_4089958_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|4090003_4090327_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|4090323_4091622_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|4097395_4099969_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040122.1|4100098_4100830_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|4100826_4101807_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197674.1|4101941_4102679_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4102949_4103291_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4103394_4103442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|4103540_4104701_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|4104743_4105865_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|4105875_4106946_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001370532.1|4107154_4107520_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4107669_4108188_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000589828.1|4109419_4109902_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4109978_4110326_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4110367_4111135_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4111165_4111714_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4111732_4111981_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4112118_4113480_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4113646_4114438_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_024026167.1|4114458_4115745_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001307957.1|4115799_4116393_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|4116515_4117394_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|4117479_4119141_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4119289_4119631_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|4119692_4119983_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4119972_4120449_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4120580_4121063_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938111.1|4122817_4124179_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001370486.1|4124555_4127957_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001370516.1|4128548_4130897_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|4130916_4131006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023386.1|4131112_4131382_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_032212694.1|4131383_4132697_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_032212696.1|4132761_4133361_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	98.5	1.4e-108
WP_032212697.1|4133427_4136901_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.3	0.0e+00
WP_000649829.1|4137034_4137562_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122994351.1|4137749_4138382_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.3	1.2e-97
WP_032212700.1|4138327_4139071_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_032212666.1|4139081_4139780_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807954.1|4139779_4140121_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212947.1|4140113_4143356_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|4143407_4143617_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710949.1|4143712_4144087_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275482.1|4144101_4144818_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	6.2e-127
WP_000133388.1|4144883_4145228_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|4145224_4145671_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|4145667_4146018_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|4146028_4146355_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|4148881_4149103_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173032.1|4149147_4151085_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001399696.1|4151148_4152810_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000958402.1|4152806_4153370_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_000095749.1|4154055_4154283_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|4154651_4154876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|4154961_4155147_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|4155664_4156198_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|4156248_4156593_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411795.1|4156597_4156804_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	2.0e-30
WP_000143014.1|4157096_4158950_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	95.9	0.0e+00
WP_001344632.1|4159392_4159524_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000101315.1|4160154_4161558_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
4161446:4161462	attL	TTGAAACTTTACAAAAA	NA	NA	NA	NA
WP_101329723.1|4161604_4162495_-	DNA methyltransferase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	29.0	4.9e-17
WP_001205467.1|4162546_4162897_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.1	6.8e-55
WP_001399360.1|4162896_4163139_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.1e-34
WP_001258395.1|4163380_4164241_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	97.2	8.6e-160
WP_000844622.1|4164240_4165209_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	98.8	2.3e-185
WP_000424040.1|4165210_4166869_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	98.7	0.0e+00
WP_096910863.1|4167718_4168931_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_106902988.1|4169376_4170600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413407.1|4170995_4171409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174260.1|4171523_4171919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|4173002_4174158_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370696.1|4175099_4176233_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000998846.1|4176241_4176463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234104.1|4176455_4177667_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4185065:4185081	attR	TTTTTGTAAAGTTTCAA	NA	NA	NA	NA
>prophage 261
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4183186	4183405	5400138		Salmonella_phage(100.0%)	1	NA	NA
WP_071532609.1|4183186_4183405_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	2.7e-09
>prophage 262
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4192969	4197094	5400138		Klosneuvirus(50.0%)	4	NA	NA
WP_001087606.1|4192969_4194250_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001370203.1|4194560_4195961_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|4195981_4196644_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|4196644_4197094_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 263
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4201029	4206322	5400138		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|4201029_4201275_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080959.1|4201271_4201679_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.7	2.7e-18
WP_000246504.1|4201651_4203796_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	1.7e-196
WP_000777969.1|4203805_4204765_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|4205119_4206322_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 264
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4219372	4224932	5400138	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|4219372_4219558_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|4219792_4222423_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|4222550_4223051_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|4223293_4224355_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132235.1|4224434_4224932_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.5e-31
>prophage 265
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4230398	4231364	5400138		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|4230398_4231364_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 266
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4238839	4239853	5400138		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001397354.1|4238839_4239853_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	2.3e-26
>prophage 267
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4259239	4266379	5400138		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|4259239_4261801_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141315.1|4261906_4262563_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	4.3e-50
WP_001297141.1|4262613_4263381_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4263576_4264485_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590409.1|4264481_4265744_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_001278994.1|4265740_4266379_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 268
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4271564	4275280	5400138		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|4271564_4272557_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272586.1|4272619_4273759_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|4273898_4274525_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|4274518_4275280_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 269
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4278392	4280425	5400138		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|4278392_4278998_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090329.1|4278997_4280425_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.6	4.8e-30
>prophage 270
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4289532	4290746	5400138	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_096910863.1|4289532_4290746_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
>prophage 271
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4305465	4306251	5400138		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|4305465_4306251_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 272
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4310663	4315584	5400138		Vibrio_phage(33.33%)	4	NA	NA
WP_001199970.1|4310663_4311335_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|4311473_4311614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036723.1|4312560_4313859_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210891.1|4313946_4315584_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.2	3.0e-153
>prophage 273
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4319616	4323731	5400138		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046788.1|4319616_4320918_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	1.1e-38
WP_000186458.1|4320974_4323731_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	4.9e-55
>prophage 274
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4331265	4332114	5400138		Vibrio_phage(100.0%)	1	NA	NA
WP_000100420.1|4331265_4332114_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 275
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4336972	4337728	5400138		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|4336972_4337728_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 276
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4349254	4364640	5400138	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001370229.1|4349254_4350460_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184246.1|4350459_4350903_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|4350953_4351760_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|4351836_4352934_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|4353512_4354766_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|4354997_4356329_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775946.1|4356390_4358217_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_001285996.1|4358216_4361759_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.2e-08
WP_001138171.1|4361751_4364640_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.8	8.1e-69
>prophage 277
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4370117	4376890	5400138		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|4370117_4370912_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|4370918_4371794_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|4371944_4374191_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|4374203_4374734_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|4375418_4376108_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|4376176_4376890_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 278
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4386521	4389016	5400138		Aichi_virus(50.0%)	2	NA	NA
WP_000256437.1|4386521_4387940_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|4388254_4389016_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 279
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4394759	4395515	5400138		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|4394759_4395515_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 280
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4419974	4435365	5400138	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|4419974_4421375_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001370233.1|4421392_4422709_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|4422744_4424112_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|4424147_4424636_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001399354.1|4424635_4426555_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001356278.1|4426990_4428439_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|4428440_4428566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|4428562_4428634_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192815.1|4428688_4429237_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|4429279_4430797_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|4430806_4431905_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813212.1|4431995_4433729_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715231.1|4433734_4434445_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|4434468_4435365_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 281
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4439170	4444543	5400138		Pandoravirus(50.0%)	3	NA	NA
WP_001343615.1|4439170_4440604_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	5.7e-31
WP_000951948.1|4440660_4441404_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195087.1|4441669_4444543_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	1.8e-262
>prophage 282
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4453071	4454304	5400138		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|4453071_4454304_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 283
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4472309	4472987	5400138		Bacillus_virus(100.0%)	1	NA	NA
WP_000956863.1|4472309_4472987_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	8.4e-09
>prophage 284
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4487280	4534300	5400138	tRNA,integrase,transposase,protease	Stx2-converting_phage(56.25%)	49	4494262:4494277	4529273:4529288
WP_001062128.1|4487280_4488435_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|4488870_4490265_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001370180.1|4490341_4490839_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4490933_4491641_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|4491720_4492452_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4492464_4493415_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4493523_4494087_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017112.1|4494086_4494533_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
4494262:4494277	attL	TCGGTTTGCCGCTGAA	NA	NA	NA	NA
WP_101329719.1|4494741_4495716_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4495688_4496393_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4496410_4496977_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4496973_4497264_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174739.1|4497271_4497865_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239917.1|4497857_4498994_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|4499309_4500296_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|4500340_4500844_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378942.1|4500843_4502145_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745214.1|4502200_4503208_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394120.1|4503324_4504371_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4504546_4505266_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|4505449_4505776_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4505775_4506495_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001298922.1|4506655_4507708_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4507735_4508011_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|4508075_4509155_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4509356_4510613_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001370231.1|4510661_4512797_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234502.1|4513194_4513902_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218841.1|4514280_4515546_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000997985.1|4515662_4517201_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	8.7e-296
WP_001341423.1|4517309_4517984_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|4517980_4518328_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|4518347_4519904_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_096855415.1|4519932_4520175_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	8.6e-41
WP_000422707.1|4521679_4522105_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_000624681.1|4522101_4522452_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_077633701.1|4523734_4523902_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000692312.1|4523970_4524192_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_024174207.1|4524354_4524729_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854916.1|4524775_4525153_+	toxin	NA	NA	NA	NA	NA
WP_000777666.1|4525149_4525638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839246.1|4525649_4525847_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001066419.1|4526107_4527664_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|4527683_4528031_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4528027_4528702_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_024174206.1|4528798_4529491_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
4529273:4529288	attR	TTCAGCGGCAAACCGA	NA	NA	NA	NA
WP_096910863.1|4529779_4530992_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000953521.1|4532005_4533370_-	EspK/GogB family type III secretion system effector	NA	Q9MBM1	Phage_Gifsy-1	29.5	7.3e-52
WP_001145628.1|4533661_4534300_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
>prophage 285
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4557842	4559381	5400138		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|4557842_4559381_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 286
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4570155	4575319	5400138	transposase	Stx2-converting_phage(25.0%)	8	NA	NA
WP_000491536.1|4570155_4571031_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	80.8	6.6e-131
WP_001323667.1|4571862_4572141_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_085947772.1|4572203_4573416_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000214037.1|4573413_4573731_+	DUF932 domain-containing protein	NA	NA	NA	NA	NA
WP_032212706.1|4573730_4573976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855068.1|4574069_4574543_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	2.5e-12
WP_001186728.1|4574558_4575035_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692312.1|4575097_4575319_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 287
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4609019	4610232	5400138	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_087661054.1|4609019_4610232_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
>prophage 288
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4633580	4634465	5400138		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|4633580_4634465_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 289
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4640541	4651364	5400138		Staphylococcus_phage(25.0%)	10	NA	NA
WP_000013149.1|4640541_4641369_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_001370149.1|4641568_4641982_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_024025906.1|4641950_4642496_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_000848528.1|4642546_4642804_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095155.1|4642846_4645066_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|4645176_4646589_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|4646663_4647401_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|4647633_4649892_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183502.1|4650436_4650919_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|4650971_4651364_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 290
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4656321	4667283	5400138		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|4656321_4658214_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|4658242_4658824_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|4658823_4659651_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|4659675_4660098_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917130.1|4660098_4660728_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	33.0	4.6e-17
WP_000735279.1|4660932_4662414_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|4662561_4663233_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442870.1|4663238_4664399_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	4.5e-87
WP_000188373.1|4664436_4665252_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001314167.1|4665367_4666141_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|4666198_4666369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|4666629_4667283_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 291
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4676796	4678230	5400138		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869175.1|4676796_4678230_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	2.3e-40
>prophage 292
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4683367	4741538	5400138	tRNA,transposase,protease	Acinetobacter_phage(19.05%)	59	NA	NA
WP_000708503.1|4683367_4684606_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.3e-92
WP_001305111.1|4684768_4685590_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001295541.1|4685679_4686048_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272796.1|4686152_4686770_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000935214.1|4686782_4687715_-	DNA-binding transcriptional activator TtdR	NA	NA	NA	NA	NA
WP_000986797.1|4687921_4688833_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000722957.1|4688829_4689435_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000804928.1|4689483_4690947_+	anion permease	NA	NA	NA	NA	NA
WP_001264365.1|4690989_4692003_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|4692240_4692456_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|4692566_4694312_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|4694506_4696348_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|4696426_4696933_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001274557.1|4697232_4698078_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000772026.1|4698162_4698360_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054228.1|4698379_4698868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106902990.1|4698864_4699245_-	toxin	NA	NA	NA	NA	NA
WP_001285487.1|4699334_4699703_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692312.1|4699778_4700000_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186728.1|4700062_4700539_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855068.1|4700554_4701028_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	2.5e-12
WP_001164974.1|4701121_4701367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001243192.1|4701925_4703704_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.2	5.2e-26
WP_000848829.1|4704816_4705227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348967.1|4705242_4705485_-	DNA polymerase III subunit gamma/tau	NA	NA	NA	NA	NA
WP_077252115.1|4705494_4705725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102649.1|4706054_4707125_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203527.1|4707121_4708027_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_122993339.1|4708023_4709304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|4709467_4710623_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001069798.1|4711904_4712777_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282124.1|4713107_4713290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066419.1|4713736_4715293_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|4715312_4715660_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4715656_4716331_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_087661054.1|4716435_4717649_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000301248.1|4717919_4718495_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|4718563_4719142_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|4719190_4720231_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|4720253_4720709_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|4720731_4721889_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|4721888_4722470_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|4722792_4723851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|4723860_4725003_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|4724995_4725769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|4725770_4726850_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|4726849_4727806_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506894.1|4727816_4729025_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|4729042_4729510_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|4729770_4730100_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|4730086_4730467_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001370715.1|4730509_4732051_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.8	3.9e-78
WP_001443493.1|4733433_4734105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|4734971_4735112_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_000803992.1|4735413_4735677_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000024297.1|4737672_4738032_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591998.1|4738124_4739744_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134819.1|4739968_4740244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|4740382_4741538_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 293
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4749441	4761670	5400138	transposase,protease	Stx2-converting_phage(75.0%)	9	NA	NA
WP_001034023.1|4749441_4753533_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_077633724.1|4753986_4754235_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	80.2	1.3e-28
WP_001341423.1|4754248_4754923_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|4754919_4755267_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|4755286_4756843_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000612591.1|4757101_4757449_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997983.1|4757498_4759037_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000035067.1|4759103_4759292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233443.1|4759309_4761670_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
>prophage 294
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4767592	4779919	5400138	tRNA,integrase	Salmonella_phage(40.0%)	9	4767792:4767806	4790186:4790200
WP_000268401.1|4767592_4768189_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
4767792:4767806	attL	TGCCAGAGGGCTTTA	NA	NA	NA	NA
WP_000290297.1|4768318_4769635_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
WP_001065895.1|4769931_4770696_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|4770972_4771596_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|4771749_4773270_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000633393.1|4773576_4775067_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000450589.1|4775108_4775441_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|4775659_4776643_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082882.1|4776826_4779919_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.0e-157
4790186:4790200	attR	TAAAGCCCTCTGGCA	NA	NA	NA	NA
>prophage 295
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4792674	4793640	5400138		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|4792674_4793640_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 296
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4819641	4821936	5400138		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|4819641_4821936_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 297
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4830245	4831391	5400138		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|4830245_4831391_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 298
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4854389	4862182	5400138		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809264.1|4854389_4855250_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.0	2.5e-50
WP_000249142.1|4855313_4857350_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246824.1|4857307_4857703_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|4857722_4858313_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|4858322_4858898_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147624.1|4859011_4860052_-	permease	NA	NA	NA	NA	NA
WP_001343556.1|4860124_4860760_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|4860887_4861406_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449043.1|4861385_4861829_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|4861879_4862182_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 299
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4868009	4869899	5400138		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|4868009_4869899_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 300
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4875380	4882019	5400138		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133060.1|4875380_4878053_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|4878077_4879565_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|4879592_4880045_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|4880675_4882019_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 301
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4886102	4888975	5400138	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|4886102_4886951_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|4887040_4888975_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 302
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4895603	4897081	5400138		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|4895603_4896575_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4896802_4897081_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 303
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4901149	4915932	5400138		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|4901149_4901959_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922859.1|4902168_4903146_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|4903159_4904146_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|4904166_4904733_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|4904729_4905305_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669787.1|4905273_4905831_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224098.1|4905837_4906563_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4906610_4908044_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4908066_4908354_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183675.1|4908471_4908951_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4908996_4909851_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4909847_4910120_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|4910333_4910966_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|4910962_4911691_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|4911687_4912341_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|4912570_4914907_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|4915002_4915932_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 304
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4922681	4927414	5400138		Salmonella_phage(50.0%)	5	NA	NA
WP_000445157.1|4922681_4923794_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979880.1|4923853_4924318_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209021.1|4924314_4925190_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|4925186_4925876_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|4925923_4927414_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 305
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4931118	4931616	5400138	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|4931118_4931616_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 306
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4935582	4938107	5400138	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001370190.1|4935582_4936950_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497724.1|4937039_4938107_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 307
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4954603	4955647	5400138		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4954603_4955647_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 308
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4966968	4967853	5400138		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258890.1|4966968_4967853_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	3.8e-25
>prophage 309
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4974357	4980975	5400138	transposase	Stx2-converting_phage(60.0%)	7	NA	NA
WP_000738579.1|4974357_4975383_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|4975450_4976632_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001370241.1|4976641_4977745_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032282037.1|4977752_4978352_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	8.8e-18
WP_001066419.1|4978380_4979937_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|4979956_4980304_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4980300_4980975_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
>prophage 310
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	4991563	4993035	5400138	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4991563_4992073_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004454.1|4992087_4993035_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 311
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5012912	5018486	5400138		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|5012912_5014097_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|5014167_5016282_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|5016378_5016849_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|5016945_5017320_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|5017445_5017733_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|5017740_5018100_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|5018099_5018486_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 312
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5024056	5033597	5400138		Tupanvirus(25.0%)	9	NA	NA
WP_000634793.1|5024056_5025970_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
WP_000057359.1|5025969_5026992_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|5026985_5027204_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|5027257_5028127_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|5028181_5028586_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|5028887_5029520_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|5029570_5031661_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_032212879.1|5031727_5032948_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|5033033_5033597_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 313
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5057847	5058684	5400138		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|5057847_5058684_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 314
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5075659	5079426	5400138		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|5075659_5077282_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|5077357_5078710_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|5078706_5079426_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 315
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5085989	5086868	5400138		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|5085989_5086868_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 316
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5092902	5095296	5400138		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081874.1|5092902_5095296_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 317
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5099675	5100902	5400138		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|5099675_5100902_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 318
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5110130	5112578	5400138		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|5110130_5112578_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 319
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5132587	5134398	5400138		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073599.1|5132587_5133331_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
WP_000907790.1|5133327_5134398_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 320
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5137939	5139422	5400138		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|5137939_5138653_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082110.1|5138654_5139422_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 321
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5145155	5147974	5400138		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|5145155_5146010_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|5146254_5147313_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|5147305_5147974_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 322
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5150977	5155109	5400138		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|5150977_5151604_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106567.1|5151677_5153876_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.0	7.2e-118
WP_000130621.1|5153977_5154223_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|5154443_5155109_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 323
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5163002	5168899	5400138		Bacillus_virus(33.33%)	6	NA	NA
WP_000173673.1|5163002_5163809_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
WP_001190062.1|5163814_5164216_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|5164335_5164695_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001259383.1|5164691_5164967_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	1.1e-15
WP_001343434.1|5165039_5166164_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149120.1|5166163_5168899_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 324
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5182504	5184547	5400138		Indivirus(100.0%)	1	NA	NA
WP_032282363.1|5182504_5184547_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.3	5.2e-46
>prophage 325
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5187892	5190027	5400138		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|5187892_5188246_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|5188299_5189589_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|5189601_5190027_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 326
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5194908	5195556	5400138		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|5194908_5195556_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 327
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5242053	5244038	5400138		Bacillus_virus(50.0%)	2	NA	NA
WP_000107042.1|5242053_5243058_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
WP_001196496.1|5243054_5244038_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
>prophage 328
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5254083	5256417	5400138		Escherichia_phage(100.0%)	1	NA	NA
WP_000013959.1|5254083_5256417_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 329
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5260071	5260284	5400138		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|5260071_5260284_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 330
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5264508	5265504	5400138		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|5264508_5265504_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 331
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5296550	5306294	5400138	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582456.1|5296550_5298395_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
WP_000206275.1|5298391_5299783_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|5299880_5300489_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000015193.1|5300717_5304989_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.8	4.3e-26
WP_000460276.1|5305002_5305404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136719529.1|5305535_5306294_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.9	1.2e-16
>prophage 332
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5328400	5337907	5400138		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|5328400_5328652_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|5328793_5329225_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|5329469_5331014_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|5331023_5332307_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483859.1|5332310_5333270_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982106.1|5333256_5334291_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	29.6	3.4e-09
WP_000646013.1|5334529_5335555_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
WP_001213834.1|5335564_5336761_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587764.1|5336974_5337907_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 333
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5341306	5343400	5400138		Catovirus(50.0%)	2	NA	NA
WP_000064013.1|5341306_5342290_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
WP_000364782.1|5342374_5343400_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
>prophage 334
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5350838	5355401	5400138		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|5350838_5351318_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114543.1|5351356_5352166_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|5352263_5352431_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|5352451_5352688_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|5352904_5353573_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050159.1|5353744_5354965_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	3.8e-44
WP_001298007.1|5354945_5355401_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 335
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5358774	5365525	5400138		Morganella_phage(25.0%)	6	NA	NA
WP_001370188.1|5358774_5359599_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_001370189.1|5359890_5360508_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001399398.1|5360504_5362187_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	5.7e-22
WP_001295237.1|5362444_5363068_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|5363122_5363398_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|5363416_5365525_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 336
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5370646	5372038	5400138		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|5370646_5372038_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 337
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5384156	5385491	5400138		Moraxella_phage(100.0%)	1	NA	NA
WP_001058151.1|5384156_5385491_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 338
NZ_CP027435	Escherichia coli strain 2014C-3599 chromosome, complete genome	5400138	5392913	5397063	5400138		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000168488.1|5392913_5394602_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	2.7e-56
WP_001315912.1|5394707_5394806_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|5395371_5395461_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|5395878_5397063_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
>prophage 1
NZ_CP027436	Escherichia coli strain 2014C-3599 plasmid unnamed, complete sequence	83611	0	3093	83611	integrase,transposase	Stx2-converting_phage(66.67%)	4	NA	NA
WP_000631725.1|391_739_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|735_1410_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|1463_1850_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_085948186.1|1936_3093_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 2
NZ_CP027436	Escherichia coli strain 2014C-3599 plasmid unnamed, complete sequence	83611	10661	18101	83611	integrase	Escherichia_phage(33.33%)	8	1894:1936	32927:32969
1894:1936	attL	TGAGGTGTACTGGCAATAGCGGACACTACCATTTGTTCTTTTT	NA	NA	NA	NA
WP_096910843.1|10661_10745_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.2e-07
WP_001044768.1|11198_11615_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|11611_11842_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000465041.1|12401_12815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|12816_13599_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000864810.1|13771_14125_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001213545.1|14537_15977_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|15980_18101_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
32927:32969	attR	TGAGGTGTACTGGCAATAGCGGACACTACCATTTGTTCTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP027436	Escherichia coli strain 2014C-3599 plasmid unnamed, complete sequence	83611	29431	45716	83611	transposase	Acinetobacter_phage(42.86%)	10	NA	NA
WP_101329731.1|29431_30970_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	4.3e-295
WP_000612591.1|31019_31367_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_097585947.1|31603_31918_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085948186.1|32969_34126_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_085948186.1|36066_37222_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000091308.1|38311_38677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|38676_39864_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000422675.1|40056_40533_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_096910863.1|41579_42792_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_101329732.1|44554_45716_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.4e-51
>prophage 4
NZ_CP027436	Escherichia coli strain 2014C-3599 plasmid unnamed, complete sequence	83611	62049	79772	83611	protease,transposase	Stx2-converting_phage(37.5%)	14	NA	NA
WP_001034100.1|62049_65952_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_000114001.1|66199_66457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106902992.1|66848_68005_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.3e-67
WP_001341455.1|68511_68994_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000274418.1|69038_69473_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001443814.1|69484_69703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086163.1|69702_70386_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_077249722.1|70769_71672_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921962.1|71944_72904_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	1.6e-61
WP_000445936.1|72903_73299_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000361610.1|75901_76879_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001341423.1|77177_77852_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|77848_78196_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066422.1|78215_79772_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
