The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	0	5887	5401672		Planktothrix_phage(50.0%)	5	NA	NA
WP_000803190.1|931_2248_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_000099276.1|2345_3233_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_000572165.1|3229_4075_+	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_000907790.1|4076_5147_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073591.1|5143_5887_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.9e-09
>prophage 2
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	25896	28344	5401672		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|25896_28344_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 3
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	37573	38800	5401672		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105463.1|37573_38800_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 4
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	43179	45573	5401672		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|43179_45573_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 5
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	51542	52421	5401672		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|51542_52421_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 6
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	58984	62751	5401672		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|58984_59704_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|59700_61053_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|61128_62751_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 7
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	79725	80562	5401672		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|79725_80562_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 8
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	104789	108816	5401672		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000601850.1|104789_105353_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	3.5e-61
WP_000963792.1|105438_106659_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|106725_108816_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
>prophage 9
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	112415	114329	5401672		Tupanvirus(100.0%)	1	NA	NA
WP_097601829.1|112415_114329_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	1.5e-74
>prophage 10
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	119862	125436	5401672		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|119862_120249_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|120248_120608_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|120615_120903_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|121028_121403_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|121499_121970_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|122066_124181_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|124251_125436_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 11
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	145313	146785	5401672	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004477.1|145313_146261_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
WP_000114986.1|146275_146785_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 12
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	157273	161427	5401672		Planktothrix_phage(50.0%)	4	NA	NA
WP_000078339.1|157273_158032_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	9.7e-30
WP_001369379.1|158039_159143_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019674.1|159152_160334_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|160401_161427_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 13
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	167931	168816	5401672		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|167931_168816_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 14
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	174153	178667	5401672		Escherichia_phage(50.0%)	4	NA	NA
WP_000843960.1|174153_174984_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_000275535.1|175326_176181_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_001341904.1|176216_177107_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132907.1|177167_178667_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
>prophage 15
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	188709	189753	5401672		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|188709_189753_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 16
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	206249	208774	5401672	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|206249_207317_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|207406_208774_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 17
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	212740	213238	5401672	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|212740_213238_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 18
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	216943	218434	5401672		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|216943_218434_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 19
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	228360	243155	5401672		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|228360_229290_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|229385_231722_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|231951_232605_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|232601_233330_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|233326_233959_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|234172_234445_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|234441_235296_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000183676.1|235341_235833_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|235950_236238_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|236260_237694_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|237741_238467_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|238473_239031_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|238999_239575_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|239571_240138_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|240158_241145_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922902.1|241158_242136_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|242345_243155_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 20
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	247223	248700	5401672		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|247223_247502_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|247728_248700_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 21
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	255328	258201	5401672	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|255328_257263_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|257352_258201_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 22
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	261720	270220	5401672	transposase	Escherichia_phage(33.33%)	5	NA	NA
WP_085948178.1|261720_262933_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000207685.1|263581_264925_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|265555_266008_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031055.1|266035_267523_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133033.1|267547_270220_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 23
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	275701	277591	5401672		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|275701_277591_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 24
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	283418	291211	5401672		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|283418_283721_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449041.1|283771_284215_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|284194_284713_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001298741.1|284840_285476_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000147619.1|285548_286589_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|286702_287278_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|287287_287878_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246855.1|287897_288293_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249157.1|288250_290287_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809253.1|290350_291211_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 25
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	314220	315366	5401672		Streptococcus_phage(100.0%)	1	NA	NA
WP_001297158.1|314220_315366_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 26
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	323353	325648	5401672		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|323353_325648_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 27
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	351664	352630	5401672		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|351664_352630_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 28
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	365051	373221	5401672	tRNA	Herpes_simplex_virus(33.33%)	5	NA	NA
WP_001082880.1|365051_368144_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
WP_000212475.1|368327_369311_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|369529_369862_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000627213.1|369903_371394_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000094671.1|371700_373221_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	3.1e-35
>prophage 29
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	379037	391578	5401672	tRNA,protease	Enterobacteria_phage(40.0%)	11	NA	NA
WP_032275606.1|379037_380855_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	47.9	1.1e-127
WP_001399692.1|381142_381388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|381384_381807_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114742.1|382273_382468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|382464_384354_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133408.1|384611_384893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000228937.1|385634_386141_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|386219_388061_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918826.1|388255_390001_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|390111_390327_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|390564_391578_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 30
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	397954	399193	5401672	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708470.1|397954_399193_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.7e-92
>prophage 31
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	404330	405764	5401672		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869168.1|404330_405764_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	1.5e-39
>prophage 32
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	415278	426240	5401672		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|415278_415932_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|416192_416363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|416420_417194_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000188373.1|417309_418125_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|418162_419323_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|419328_420000_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|420147_421629_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|421833_422463_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|422463_422886_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444756.1|422910_423738_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105738.1|423737_424319_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|424347_426240_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 33
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	430067	440890	5401672		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|430067_430460_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183500.1|430512_430995_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|431540_433799_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|434031_434769_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|434843_436256_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095149.1|436366_438586_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|438628_438886_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_106914091.1|438936_439863_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|440062_440890_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 34
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	446966	447851	5401672		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|446966_447851_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 35
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	470065	471238	5401672		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524977.1|470065_471238_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	1.4e-40
>prophage 36
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	503644	508106	5401672	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_085948269.1|503644_504858_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
WP_077631037.1|504899_505037_+	malate transporter	NA	NA	NA	NA	NA
WP_001344959.1|505345_505549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|506892_508106_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 37
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	517391	518930	5401672		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723934.1|517391_518930_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
>prophage 38
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	541618	542780	5401672	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948265.1|541618_542780_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
>prophage 39
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	547998	548988	5401672		Salmonella_phage(100.0%)	1	NA	NA
WP_000953028.1|547998_548988_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
>prophage 40
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	553284	554498	5401672	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948178.1|553284_554498_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 41
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	582031	583186	5401672		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|582031_583186_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 42
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	604187	604865	5401672		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|604187_604865_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 43
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	622872	624105	5401672		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|622872_624105_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 44
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	632633	638001	5401672		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195029.1|632633_635507_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
WP_000951964.1|635767_636511_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001344773.1|636567_638001_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
>prophage 45
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	641925	657317	5401672	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|641925_642822_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|642846_643557_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813220.1|643562_645296_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|645386_646484_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|646494_648012_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192826.1|648054_648603_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|648657_648729_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|648725_648851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|648852_650301_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001345944.1|650736_652656_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|652655_653144_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|653179_654547_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_001295158.1|654582_655899_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280192.1|655916_657317_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 46
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	681596	682352	5401672		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|681596_682352_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 47
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	705191	707686	5401672		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603508.1|705191_705953_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
WP_000256438.1|706267_707686_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 48
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	717317	724090	5401672		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|717317_718031_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|718099_718789_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|719473_720004_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|720016_722263_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|722413_723289_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|723295_724090_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 49
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	729567	740695	5401672		Bacillus_phage(50.0%)	5	NA	NA
WP_001138219.1|729567_732456_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	9.0e-68
WP_001285980.1|732448_735991_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	2.6e-08
WP_000775974.1|735990_737817_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.9	5.4e-26
WP_000237947.1|737878_739210_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|739441_740695_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
>prophage 50
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	744553	750433	5401672	tRNA	Tetraselmis_virus(25.0%)	6	NA	NA
WP_001066234.1|744553_745150_+	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	5.3e-23
WP_001341841.1|745221_746169_+	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.9	6.9e-17
WP_000678646.1|746753_747851_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|747927_748734_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184265.1|748784_749228_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001299897.1|749227_750433_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
>prophage 51
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	761959	762715	5401672		Bacillus_phage(100.0%)	1	NA	NA
WP_001344755.1|761959_762715_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 52
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	767573	768422	5401672		Vibrio_phage(100.0%)	1	NA	NA
WP_000100393.1|767573_768422_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 53
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	775956	778713	5401672		Hokovirus(100.0%)	1	NA	NA
WP_000186445.1|775956_778713_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 54
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	784102	789022	5401672		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|784102_785740_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|785827_787126_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268451.1|787185_788058_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288224.1|788071_788212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|788350_789022_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 55
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	793494	794280	5401672		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021329.1|793494_794280_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.0e-21
>prophage 56
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	818010	820043	5401672		Hokovirus(50.0%)	2	NA	NA
WP_001090398.1|818010_819438_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|819437_820043_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 57
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	823155	826871	5401672		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001295182.1|823155_823917_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|823910_824537_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272595.1|824676_825816_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|825878_826871_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 58
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	832079	839219	5401672		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|832079_832718_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590389.1|832714_833977_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|833973_834882_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|835077_835845_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_097601851.1|835895_836552_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.4	5.6e-50
WP_001272924.1|836657_839219_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 59
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	858686	859700	5401672		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001341827.1|858686_859700_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	3.9e-26
>prophage 60
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	867273	868239	5401672		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|867273_868239_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 61
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	873705	879265	5401672	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|873705_874203_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|874282_875344_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140519.1|875586_876087_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_106914095.1|876214_878845_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	1.6e-79
WP_000906486.1|879079_879265_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 62
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	892081	897377	5401672		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|892081_893284_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777939.1|893638_894598_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000246506.1|894607_896752_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	9.3e-195
WP_000080947.1|896724_897135_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223219.1|897131_897377_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	4.1e-06
>prophage 63
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	901312	905437	5401672		Clostridium_phage(50.0%)	4	NA	NA
WP_000522424.1|901312_901762_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156820.1|901762_902425_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001344737.1|902445_903846_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|904156_905437_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 64
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	910747	975235	5401672	terminase,portal,tail,protease,transposase	Enterobacteria_phage(58.62%)	88	NA	NA
WP_001426837.1|910747_912466_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	5.5e-307
WP_000214990.1|912467_914216_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|914287_914704_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_085948178.1|915768_916981_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001289947.1|917333_917933_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
WP_001214463.1|917929_918097_-	DUF2737 family protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
WP_001111331.1|918107_918401_-	DUF2856 family protein	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
WP_000532424.1|918414_918927_-	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
WP_000335772.1|918927_919551_-	hypothetical protein	NA	Q8VNQ0	Enterobacteria_phage	99.5	6.8e-122
WP_001344729.1|919459_920011_-|transposase	IS3 family transposase	transposase	Q687G6	Enterobacteria_phage	100.0	2.6e-101
WP_106914096.1|920007_920199_-	hypothetical protein	NA	A0A0N7C1Z2	Escherichia_phage	66.2	7.8e-13
WP_085948178.1|920164_921378_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001177653.1|921739_922018_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000166207.1|922052_922199_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000065668.1|922191_923091_+	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000131492.1|923080_924517_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_001036037.1|924516_924786_+	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_001000130.1|924855_925134_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|925266_925482_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|925492_925729_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|925685_926132_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|926128_926656_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|926652_926835_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_106914098.1|927109_927814_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	98.7	1.8e-131
WP_000129903.1|927992_929930_+|tail	tail spike protein	tail	A0A140G5Z9	Enterobacteria_phage	88.9	1.9e-271
WP_000226656.1|929970_931038_-	acyltransferase	NA	NA	NA	NA	NA
WP_000951706.1|931814_932024_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000797281.1|932025_932214_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_001289935.1|932365_933139_-	ead/Ea22-like family protein	NA	Q08J58	Stx2-converting_phage	100.0	1.0e-143
WP_000774248.1|933135_933357_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_106914099.1|933455_933737_-	hypothetical protein	NA	Q6H9Z3	Enterobacteria_phage	98.9	1.2e-46
WP_000548531.1|933747_933939_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682315.1|933911_934094_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_106914100.1|934090_934753_-	YqaJ viral recombinase family protein	NA	H6WZG6	Escherichia_phage	99.5	1.4e-128
WP_085948178.1|934794_936008_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000100845.1|936080_936866_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|936871_937168_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372937.1|937242_937386_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|937354_937519_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065379.1|937591_937960_-	DUF2528 family protein	NA	H6WZH0	Escherichia_phage	100.0	4.5e-65
WP_032353701.1|938110_938581_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	4.1e-87
WP_000088201.1|938639_938912_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_016242500.1|939257_939953_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_000067727.1|940028_940244_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_024239821.1|940385_940682_+	hypothetical protein	NA	G9L678	Escherichia_phage	96.9	3.4e-47
WP_001549473.1|940703_941504_+	HNH endonuclease	NA	A0A125RNK0	Pseudomonas_phage	50.0	4.4e-65
WP_024239822.1|941515_942403_+	hypothetical protein	NA	G8C7U5	Escherichia_phage	77.4	2.2e-113
WP_024239823.1|942405_943251_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	73.2	6.2e-110
WP_106914101.1|943247_943538_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	99.0	5.5e-50
WP_001036037.1|943534_943804_+	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_001000130.1|943873_944152_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|944284_944500_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|944510_944747_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|944703_945150_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_097296580.1|945146_945674_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254257.1|945670_945853_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000566871.1|945849_946020_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	5.5e-26
WP_001292290.1|946012_946735_+	phage regulatory/antirepressor protein	NA	G9L692	Escherichia_phage	100.0	9.2e-131
WP_106914102.1|946734_947340_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	97.0	1.2e-94
WP_106914103.1|947336_947531_+	protein ninH	NA	G9L694	Escherichia_phage	92.2	3.3e-27
WP_001204849.1|947523_947958_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|948464_949412_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|949421_949691_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_012816791.1|950694_950880_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|951354_951831_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|951827_953951_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|953947_954160_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|954159_955662_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|955606_957631_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|957718_958045_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|958037_958319_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|958321_958945_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_000682711.1|958957_959104_+	hypothetical protein	NA	Q687G0	Enterobacteria_phage	100.0	3.5e-21
WP_085948178.1|959106_960320_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001444799.1|960374_960665_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.0	2.1e-49
WP_000235090.1|960672_961425_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|961438_961861_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|961887_962196_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918237.1|962239_964885_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|964881_965211_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_106914104.1|965918_966662_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.6e-147
WP_122996286.1|966607_967240_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|967486_970963_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|971030_971630_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279058.1|971694_973017_+|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
WP_001023452.1|973018_973288_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_001217540.1|973655_973904_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_000162574.1|974752_975235_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 65
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	984791	1029975	5401672	tRNA,capsid,terminase,portal,tail,holin,head,plate	Enterobacteria_phage(85.42%)	61	NA	NA
WP_000264774.1|984791_985559_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|985600_985948_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589821.1|986024_986507_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|986522_987749_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|987738_988257_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|988406_988772_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|988981_990052_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225214.1|990062_991184_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|991226_992387_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|992485_992533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|993757_994060_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001001394.1|994155_994482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001696654.1|994500_994842_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	2.5e-54
WP_001696653.1|994852_995131_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	2.4e-34
WP_000514277.1|995142_995385_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|995381_995495_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_001696652.1|995581_995785_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	8.6e-26
WP_000153674.1|995781_996027_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_001696649.1|996023_996323_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	2.1e-41
WP_001036813.1|996334_996538_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_000713737.1|996534_997365_+	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.3	5.6e-132
WP_157916427.1|997418_998039_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	1.2e-09
WP_000564227.1|998035_998425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062865907.1|1001307_1002267_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	4.9e-180
WP_000211275.1|1002271_1002583_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	2.7e-47
WP_096976575.1|1002646_1002979_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	97.2	1.4e-54
WP_096976576.1|1002975_1003290_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	93.3	8.6e-49
WP_001167297.1|1003292_1003784_+	hypothetical protein	NA	G9L661	Escherichia_phage	92.6	7.5e-84
WP_000951706.1|1003785_1003995_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000087812.1|1005436_1006483_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613756.1|1006482_1008234_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_001262673.1|1008388_1009225_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055104.1|1009248_1010301_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_033552264.1|1010346_1011147_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	3.2e-124
WP_000063082.1|1011249_1011744_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|1011743_1011944_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|1011946_1012270_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|1012266_1012659_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780541.1|1012655_1013063_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	5.5e-64
WP_000920586.1|1013200_1013668_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_001388922.1|1013660_1014296_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_021529560.1|1014292_1014874_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	2.1e-101
WP_000213447.1|1014870_1015221_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_097456228.1|1015224_1016121_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	7.9e-156
WP_000071720.1|1016113_1016644_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_106914105.1|1016646_1018671_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	86.4	7.7e-175
WP_106914106.1|1018633_1019083_+|tail	phage tail protein	tail	A0A0A7NQ91	Enterobacteria_phage	95.1	6.5e-74
WP_106914158.1|1019028_1019166_+	hypothetical protein	NA	A0A222YXY8	Escherichia_phage	100.0	8.6e-14
WP_021529562.1|1019194_1019722_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.1	2.1e-92
WP_000905061.1|1020661_1021261_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|1021289_1021778_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_106914107.1|1021790_1024598_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.5	0.0e+00
WP_000333503.1|1024584_1024740_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|1024748_1025123_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|1025178_1025691_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_042028454.1|1025690_1026875_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	9.0e-224
WP_106914108.1|1027032_1028142_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.7e-195
WP_074435022.1|1028184_1028445_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|1028636_1028777_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001353016.1|1029026_1029224_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_106914109.1|1029168_1029975_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	51.9	3.7e-64
>prophage 66
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1033447	1036021	5401672		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|1033447_1036021_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 67
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1041873	1043172	5401672		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|1041873_1043172_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 68
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1048465	1054725	5401672	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|1048465_1048885_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1049091_1050129_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1050176_1050866_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1051169_1051553_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1051608_1052196_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|1052299_1053181_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1053390_1054725_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 69
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1060496	1064239	5401672		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|1060496_1062296_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|1062311_1063286_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|1063558_1064239_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 70
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1067697	1067958	5401672		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|1067697_1067958_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 71
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1072077	1083385	5401672		Bacillus_phage(50.0%)	7	NA	NA
WP_000970124.1|1072077_1075965_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	9.1e-132
WP_001297612.1|1076540_1077968_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|1078132_1078846_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|1078835_1080170_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|1080230_1080569_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|1080613_1081804_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|1082131_1083385_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 72
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1089143	1090655	5401672		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493456.1|1089143_1090655_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	9.6e-13
>prophage 73
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1105948	1112405	5401672		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|1105948_1107163_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|1107190_1107577_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|1107593_1107917_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|1108012_1108528_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196613.1|1108544_1110395_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|1110396_1110732_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|1110743_1110944_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|1111121_1112405_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 74
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1122290	1122722	5401672		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|1122290_1122722_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 75
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1131551	1137848	5401672		Escherichia_phage(60.0%)	6	NA	NA
WP_000937893.1|1131551_1132922_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.4	1.2e-41
WP_001299507.1|1133083_1134550_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|1134618_1136196_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755172.1|1136290_1136830_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
WP_000669403.1|1136845_1137361_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_001344399.1|1137674_1137848_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 76
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1144282	1148284	5401672		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_032256558.1|1144282_1144921_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	3.1e-29
WP_001341612.1|1144920_1145958_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|1146282_1146909_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|1146994_1148284_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 77
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1169553	1170267	5401672		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|1169553_1170267_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 78
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1188313	1189264	5401672		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|1188313_1189264_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 79
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1207818	1212757	5401672		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_000102891.1|1207818_1208688_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406004.1|1208901_1209327_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001325675.1|1209313_1209763_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_001426072.1|1209842_1210400_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001345170.1|1210495_1211395_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	7.7e-26
WP_001345171.1|1211452_1212757_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 80
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1216235	1231605	5401672		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517439.1|1216235_1217027_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
WP_000290223.1|1217197_1218214_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000458406.1|1218213_1219047_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852685.1|1219046_1219922_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021041.1|1219911_1221009_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_001297645.1|1221142_1222054_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|1222056_1222425_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096660.1|1222529_1223381_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|1223422_1223932_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|1223972_1225700_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|1225744_1226002_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|1226385_1227357_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|1227541_1228303_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|1228532_1229519_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|1229589_1231605_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 81
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1261726	1262647	5401672		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|1261726_1262647_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 82
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1266338	1273915	5401672		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|1266338_1268033_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_106914111.1|1268102_1269047_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|1269120_1270266_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_001443604.1|1270321_1273915_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 83
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1280568	1282002	5401672		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|1280568_1282002_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 84
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1285161	1392984	5401672	lysis,terminase,capsid,portal,tail,integrase,protease,bacteriocin,plate,holin,head,transposase	Escherichia_phage(59.65%)	136	1284943:1284966	1386727:1386750
1284943:1284966	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_032274263.1|1285161_1286331_+|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	100.0	7.5e-231
WP_024174014.1|1286314_1286497_-	helix-turn-helix domain-containing protein	NA	G3CFG7	Escherichia_phage	100.0	4.1e-27
WP_000497812.1|1286557_1286809_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1286796_1287030_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000994798.1|1287173_1287581_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	81.5	2.0e-50
WP_042357761.1|1287616_1287832_-	DUF1382 family protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
WP_032274264.1|1287764_1288643_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	63.6	3.7e-97
WP_000951706.1|1288639_1288849_-	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_000797281.1|1288850_1289039_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_032274265.1|1289190_1289739_-	ead/Ea22-like family protein	NA	A0A076GCN9	Escherichia_phage	73.6	7.0e-14
WP_000034263.1|1289735_1290500_-	ead/Ea22-like family protein	NA	G9L6G6	Escherichia_phage	57.4	4.6e-56
WP_000476216.1|1290496_1290736_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_000158001.1|1290728_1290932_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	98.5	3.0e-31
WP_032274359.1|1290928_1291807_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	99.3	5.5e-178
WP_032274360.1|1291914_1292391_-	hypothetical protein	NA	A0A2L1IV82	Escherichia_phage	96.8	3.4e-81
WP_032274361.1|1292467_1293289_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	99.3	7.2e-148
WP_001071603.1|1293352_1293700_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_032274363.1|1293774_1294362_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	99.0	5.8e-107
WP_032274364.1|1294361_1295051_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	99.1	5.0e-134
WP_032274365.1|1295047_1295998_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	99.7	5.4e-179
WP_032274366.1|1296015_1296297_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	98.9	1.4e-47
WP_032274367.1|1296317_1296599_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.9	8.7e-45
WP_032274380.1|1296893_1297532_-	antirepressor	NA	A0A0P0ZG08	Escherichia_phage	87.3	7.0e-106
WP_106914112.1|1297801_1298584_-	hypothetical protein	NA	A0A0H4IQ68	Shigella_phage	80.8	8.5e-114
WP_032274371.1|1299200_1300154_-	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	99.7	3.5e-186
WP_032274372.1|1300150_1301620_-	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.4	4.3e-284
WP_001056250.1|1301714_1302428_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240875.1|1302523_1302727_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_000470023.1|1303260_1303647_+	hypothetical protein	NA	A0A286S263	Klebsiella_phage	44.8	2.6e-23
WP_032274375.1|1303640_1305161_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	98.8	8.6e-304
WP_032274376.1|1305150_1306122_+	DNA primase	NA	A0A0H4IPK0	Shigella_phage	99.7	9.4e-195
WP_000077537.1|1306610_1307141_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|1307331_1307580_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289293.1|1307581_1309672_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
WP_000129796.1|1309743_1310676_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.7	3.1e-70
WP_000268104.1|1310678_1310900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|1310912_1311167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|1311168_1311450_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049431.1|1311446_1311719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097601929.1|1311723_1312017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|1312028_1312559_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|1312656_1313199_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564280.1|1313202_1313736_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.8e-68
WP_000465571.1|1313735_1314251_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	54.2	6.5e-46
WP_000973026.1|1314254_1314806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633442.1|1314802_1315114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145588.1|1315110_1315479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|1315494_1315827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|1315819_1316017_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|1316006_1316303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214363.1|1316299_1316809_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	5.1e-27
WP_000852377.1|1316878_1317304_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|1317375_1317876_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|1317910_1318339_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122257.1|1318322_1318541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|1318551_1318779_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270158.1|1318759_1319071_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000064454.1|1319063_1319354_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.4e-24
WP_000360581.1|1319356_1319938_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057666.1|1319937_1321602_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.0	2.0e-229
WP_000532587.1|1321601_1323191_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	8.5e-169
WP_000046905.1|1323174_1324506_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.0	1.6e-152
WP_000094812.1|1324627_1325101_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_000850812.1|1325277_1326402_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	7.5e-79
WP_001142982.1|1326401_1327349_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_047082305.1|1327392_1327764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104959.1|1327760_1328180_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	1.8e-33
WP_000627428.1|1328176_1328737_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	48.3	1.6e-42
WP_000848437.1|1328737_1328983_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606748.1|1328979_1330482_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.5	1.5e-138
WP_000015473.1|1330490_1330856_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|1330870_1331347_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|1331473_1333549_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|1333535_1334885_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_097601914.1|1334868_1335993_+|tail	phage tail protein	tail	C9DGQ3	Escherichia_phage	48.5	6.5e-91
WP_000980532.1|1335982_1336597_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|1336589_1337027_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|1337026_1338109_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|1338099_1338660_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|1338659_1339571_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|1339605_1340127_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|1340206_1340410_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|1340631_1341192_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|1341291_1343331_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|1343477_1343660_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|1343695_1343941_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|1343979_1344444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|1344558_1344759_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|1344712_1345450_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_106914113.1|1345442_1345793_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	4.3e-33
WP_032274377.1|1345800_1346364_+	bacteriophage lambda NinG family protein	NA	A0A0P0ZG59	Escherichia_phage	98.4	1.3e-103
WP_000144761.1|1346360_1346561_+	protein ninH	NA	G9L694	Escherichia_phage	92.4	1.2e-27
WP_001204831.1|1346553_1346979_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	73.2	1.2e-53
WP_000813244.1|1347178_1347334_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.6e-16
WP_001178557.1|1348055_1350017_+	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	36.7	6.3e-81
WP_071587234.1|1350067_1351171_+	type II restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_001304085.1|1351433_1351586_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_106914115.1|1352406_1354344_+	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	99.2	0.0e+00
WP_032210570.1|1354480_1354660_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	96.6	3.2e-24
WP_001290233.1|1354700_1354946_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|1355022_1355238_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|1355242_1355776_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001693758.1|1356046_1356616_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
WP_000455406.1|1356615_1356765_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1356772_1357237_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1357268_1357562_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1357711_1357915_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|1357970_1358777_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143992.1|1358757_1360464_+|terminase	bacteriophage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|1360463_1362608_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|1362765_1363773_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1363796_1365011_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1365066_1365456_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_016241162.1|1365505_1365967_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	99.3	3.0e-74
WP_000829200.1|1365950_1366514_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|1366513_1367164_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_000117994.1|1367160_1369098_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1369099_1369369_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1369508_1369697_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_032274353.1|1369991_1371617_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_032274352.1|1371613_1372882_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.5	7.1e-219
WP_000455633.1|1372896_1373175_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001459282.1|1373180_1373798_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000836187.1|1373877_1374615_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_000078907.1|1374847_1374988_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035555.1|1375044_1375446_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000509019.1|1375539_1376193_+	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000455645.1|1376195_1376642_+	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000540391.1|1376652_1376904_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012437.1|1376914_1378180_+	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_032274351.1|1378249_1386604_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	96.8	0.0e+00
WP_000368131.1|1386825_1387758_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1386727:1386750	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_000776768.1|1388051_1388807_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_106914116.1|1388988_1390047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159032328.1|1390413_1391805_-	long-chain fatty acid transporter FadL	NA	A0A0N7BTS3	Escherichia_phage	96.2	1.8e-05
WP_085948178.1|1391770_1392984_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 85
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1406946	1408032	5401672		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|1406946_1408032_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 86
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1416587	1417724	5401672		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|1416587_1417724_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 87
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1424200	1425718	5401672		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|1424200_1425718_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 88
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1429929	1431790	5401672		Planktothrix_phage(50.0%)	2	NA	NA
WP_001293612.1|1429929_1430703_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	38.1	2.4e-23
WP_000156114.1|1430899_1431790_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	4.0e-67
>prophage 89
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1442349	1445577	5401672		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|1442349_1443000_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|1443086_1444919_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813860.1|1444977_1445577_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 90
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1483892	1486914	5401672		Cronobacter_phage(33.33%)	3	NA	NA
WP_000461661.1|1483892_1484861_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001345211.1|1484864_1486004_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	6.5e-30
WP_001297077.1|1486311_1486914_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 91
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1490066	1551663	5401672	lysis,integrase,protease,holin,transposase	Enterobacteria_phage(20.0%)	47	1507316:1507351	1539229:1539264
WP_000140560.1|1490066_1490969_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.3e-68
WP_001000358.1|1491162_1492353_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_106914118.1|1492349_1493609_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|1493598_1495227_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|1495499_1496858_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|1496862_1497939_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|1498401_1499052_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000179250.1|1499105_1499360_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|1499359_1500490_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|1500578_1502864_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001345213.1|1503559_1507294_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.6e-19
1507316:1507351	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000990754.1|1507421_1508144_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_046377551.1|1508290_1510918_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.6	1.6e-92
WP_000012296.1|1511066_1512755_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215757.1|1512751_1513378_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|1513372_1514443_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|1514420_1514639_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|1514744_1515089_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001254228.1|1515245_1515428_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001345214.1|1515931_1516759_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_042352449.1|1516797_1517730_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001108084.1|1518271_1518838_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|1518812_1519415_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|1519411_1520077_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|1520073_1520697_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_000499454.1|1521789_1521948_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|1522028_1522427_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1522569_1522785_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075144.1|1522784_1523282_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000092247.1|1523278_1523716_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000881316.1|1523865_1524390_+	hypothetical protein	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_085948178.1|1524429_1525643_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072145680.1|1525680_1526319_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_001025665.1|1527012_1528335_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_159032332.1|1529136_1533564_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|1533564_1535214_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|1535218_1535995_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000876014.1|1536269_1539119_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|1539318_1539969_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
1539229:1539264	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001249151.1|1539985_1542658_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|1543396_1544488_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|1544599_1545655_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|1545728_1546793_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|1546792_1547443_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422230.1|1547518_1549162_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758043.1|1549379_1551026_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|1551174_1551663_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 92
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1557930	1558548	5401672		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|1557930_1558548_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 93
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1568269	1587412	5401672	integrase,terminase,capsid	Vibrio_phage(33.33%)	21	1567977:1568002	1577269:1577294
1567977:1568002	attL	CCGTATAACTAAACGTATAACTAAAA	NA	NA	NA	NA
WP_001369202.1|1568269_1569193_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001229488.1|1569355_1569844_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001018604.1|1569971_1570133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|1570136_1570331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080641.1|1570461_1570707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833625.1|1570908_1572309_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_000770163.1|1572305_1572605_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001205000.1|1572610_1572844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174018.1|1572836_1573283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345228.1|1573498_1575307_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	41.1	2.9e-08
WP_000387403.1|1575261_1575468_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_106914120.1|1575964_1577206_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	2.1e-98
WP_000256200.1|1577575_1579336_-	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
1577269:1577294	attR	CCGTATAACTAAACGTATAACTAAAA	NA	NA	NA	NA
WP_001135667.1|1579355_1579583_-	YejL family protein	NA	NA	NA	NA	NA
WP_000050788.1|1579764_1580772_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.0	7.7e-83
WP_000494183.1|1580910_1581195_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|1581319_1583080_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|1583228_1583924_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213360.1|1583951_1585142_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|1585474_1585819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194877.1|1585822_1587412_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
>prophage 94
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1593166	1597467	5401672		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|1593166_1593733_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|1594144_1594858_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|1594896_1595883_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_000848220.1|1596000_1597467_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.2	1.9e-42
>prophage 95
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1611948	1612806	5401672		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|1611948_1612806_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 96
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1616875	1620661	5401672		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489247.1|1616875_1618867_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425428.1|1618898_1619735_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|1619992_1620661_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 97
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1624355	1625876	5401672		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255042.1|1624355_1625876_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 98
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1646209	1655648	5401672		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569311.1|1646209_1647136_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	1.3e-23
WP_000783120.1|1647140_1647872_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|1647852_1647960_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1648019_1648751_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1648972_1650658_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1650654_1651374_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|1651420_1651891_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_001345236.1|1651930_1652392_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	7.1e-76
WP_001292774.1|1654511_1655648_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 99
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1668214	1670248	5401672	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|1668214_1670248_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 100
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1680894	1684451	5401672		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001345241.1|1680894_1681713_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	5.0e-24
WP_000434038.1|1681764_1682511_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|1682484_1683450_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|1683446_1684451_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
>prophage 101
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1693673	1700547	5401672	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000807362.1|1693673_1694573_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|1694987_1695305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476011.1|1695634_1696996_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001220181.1|1697098_1697395_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|1697396_1697693_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|1697901_1698234_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|1698424_1699147_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675146.1|1699143_1700547_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 102
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1713972	1715325	5401672		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469743.1|1713972_1715325_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	1.9e-07
>prophage 103
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1720050	1721365	5401672		Catovirus(50.0%)	2	NA	NA
WP_001345247.1|1720050_1720692_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234777.1|1720783_1721365_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
>prophage 104
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1727345	1730911	5401672		Streptococcus_phage(50.0%)	3	NA	NA
WP_000137212.1|1727345_1729508_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	31.2	4.9e-18
WP_000206145.1|1729580_1730423_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_000888711.1|1730425_1730911_+	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	41.0	7.1e-10
>prophage 105
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1736584	1754502	5401672	transposase	Bacillus_phage(20.0%)	15	NA	NA
WP_085948267.1|1736584_1737857_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.7e-175
WP_000609087.1|1737963_1738857_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	4.3e-45
WP_000923030.1|1739322_1740516_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001044796.1|1740566_1741685_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	65.7	5.6e-135
WP_000471008.1|1741780_1742230_+	GDP-sugar hydrolase WbdI	NA	NA	NA	NA	NA
WP_000076061.1|1742263_1743715_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	1.2e-52
WP_001033923.1|1743720_1745091_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	25.8	1.6e-27
WP_000866332.1|1745127_1746051_+	NAD-dependent epimerase/dehydratase family protein	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	40.4	1.4e-62
WP_000634187.1|1746047_1747214_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES46	Bathycoccus_sp._RCC1105_virus	34.3	7.9e-47
WP_106914122.1|1747252_1748518_+	O111 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001300154.1|1748507_1749560_+	O111 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_000365650.1|1749537_1750431_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.3	4.2e-08
WP_000707062.1|1750427_1751552_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000043516.1|1751730_1753137_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.0	2.6e-36
WP_000704787.1|1753335_1754502_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.7e-113
>prophage 106
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1763143	1764043	5401672		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1763143_1764043_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 107
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1771688	1772855	5401672		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001369224.1|1771688_1772855_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	7.2e-226
>prophage 108
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1777193	1779358	5401672		Klebsiella_phage(33.33%)	4	NA	NA
WP_000692345.1|1777193_1777415_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186773.1|1777483_1777960_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|1777975_1778455_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001234505.1|1778536_1779358_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.0e-45
>prophage 109
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1797124	1856378	5401672	terminase,capsid,portal,tail,integrase,holin,head,transposase	Escherichia_phage(35.59%)	74	1798368:1798392	1828480:1828504
WP_085948178.1|1797124_1798338_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
1798368:1798392	attL	TCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
WP_071526359.1|1798492_1799692_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_157847362.1|1799802_1800075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157847361.1|1800052_1800436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089719.1|1800446_1800719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246637.1|1800722_1801718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042272.1|1802420_1802672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345280.1|1802741_1804016_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
WP_106914160.1|1804371_1805169_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000048405.1|1805404_1807792_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
WP_001090200.1|1807884_1808076_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1808072_1808261_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1808831_1809041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|1809041_1809680_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|1809691_1809844_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|1810109_1810529_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|1810628_1810910_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|1810893_1811319_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262366.1|1811390_1812461_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|1812467_1813214_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_000450617.1|1813235_1813952_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.1e-71
WP_000603384.1|1813984_1814266_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|1814262_1814490_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|1814482_1814794_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|1814921_1815140_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1815141_1815699_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1815932_1816145_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1816264_1816609_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1816730_1817003_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1817004_1818054_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|1818066_1818426_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640033.1|1818434_1818989_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_000917764.1|1819212_1819410_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000301789.1|1819544_1820258_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000080194.1|1820743_1822357_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000624722.1|1822387_1822738_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|1822734_1823160_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000466957.1|1823247_1823679_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|1824028_1824172_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_024222300.1|1824157_1826095_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.4	0.0e+00
WP_000143458.1|1826232_1826412_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1826452_1826725_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284516.1|1826801_1827017_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_106914124.1|1827248_1828461_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	3.8e-169
WP_000638258.1|1828445_1828850_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	8.2e-52
1828480:1828504	attR	TCTCCAGGAAACCCGGGGCGGTTCA	NA	NA	NA	NA
WP_001092858.1|1828892_1829426_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_012817896.1|1829943_1830129_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
WP_001302717.1|1830655_1830970_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444498.1|1831051_1831276_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001426432.1|1831702_1832209_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.3	7.4e-34
WP_001426431.1|1832180_1834109_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_000259002.1|1834092_1834299_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001369121.1|1834295_1835888_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_001253979.1|1835877_1837383_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256823.1|1837419_1837767_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|1837824_1838853_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|1838904_1839288_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|1839280_1839634_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|1839649_1840183_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1840179_1840575_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235098.1|1840582_1841335_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|1841348_1841771_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1841797_1842211_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081781.1|1842191_1844804_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|1844800_1845130_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001152113.1|1845129_1845828_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_001369128.1|1845833_1846577_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_122996286.1|1846522_1847155_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|1847401_1850878_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|1850945_1851545_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279057.1|1851609_1852923_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|1852924_1853194_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_122993429.1|1853599_1854613_+	peptidase M85	NA	NA	NA	NA	NA
WP_001079074.1|1855847_1856378_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 110
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1859922	1872393	5401672		Bacillus_phage(33.33%)	12	NA	NA
WP_001339045.1|1859922_1860594_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826738.1|1860593_1861952_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218214.1|1862059_1862911_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824375.1|1863501_1864665_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_001313057.1|1865231_1865597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365565.1|1865636_1866332_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001157238.1|1866398_1867817_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000786004.1|1867797_1868268_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001210913.1|1868256_1869177_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|1869349_1870267_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009309.1|1870345_1870528_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001377491.1|1870698_1872393_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 111
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1889599	1891519	5401672	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000826461.1|1889599_1890808_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	4.9e-209
WP_000334609.1|1890847_1891519_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
>prophage 112
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1903334	1904087	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_001272994.1|1903334_1904087_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
>prophage 113
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1916078	1917593	5401672		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|1916078_1917593_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 114
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1927680	1933327	5401672		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001342228.1|1927680_1929342_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483235.1|1929387_1930992_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_000204335.1|1931010_1931871_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|1931873_1932923_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|1932937_1933327_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 115
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1938579	1940313	5401672	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025336.1|1938579_1940313_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
>prophage 116
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1946929	1948980	5401672		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|1946929_1947673_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|1947713_1948109_-	membrane protein	NA	NA	NA	NA	NA
WP_000639271.1|1948161_1948980_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
>prophage 117
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1952998	1960062	5401672		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|1952998_1953520_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024917.1|1953521_1954124_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|1954194_1954260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580328.1|1954398_1955010_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|1955018_1956029_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571465.1|1956175_1956961_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|1956957_1957713_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001344710.1|1957791_1958724_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|1958739_1960062_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 118
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1967525	1968653	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741721.1|1967525_1968653_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 119
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1982231	1983707	5401672		Cyanophage(100.0%)	1	NA	NA
WP_000301731.1|1982231_1983707_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	9.9e-79
>prophage 120
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	1991763	1996233	5401672		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|1991763_1992426_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011658.1|1992449_1993106_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|1993207_1993438_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|1993576_1993951_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879274.1|1993954_1994827_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|1994839_1995181_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|1995576_1996233_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 121
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2003729	2005778	5401672		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|2003729_2005778_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 122
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2011108	2011318	5401672		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2011108_2011318_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 123
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2016958	2018515	5401672		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2016958_2018515_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 124
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2022377	2030484	5401672	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|2022377_2023739_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|2023812_2023992_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2024111_2024471_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2024833_2025178_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2025309_2027220_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220987.1|2027277_2027973_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|2028012_2028594_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001344701.1|2028798_2030484_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.4e-35
>prophage 125
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2038857	2042525	5401672	transposase	Escherichia_phage(66.67%)	3	NA	NA
WP_001349736.1|2038857_2039820_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
WP_000826412.1|2039827_2041036_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_085948178.1|2041311_2042525_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 126
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2048300	2052877	5401672		Bacillus_phage(100.0%)	3	NA	NA
WP_001369308.1|2048300_2049791_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	4.9e-09
WP_000616411.1|2049971_2051447_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|2051593_2052877_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 127
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2056195	2057050	5401672		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|2056195_2057050_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 128
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2060293	2060935	5401672		Tupanvirus(100.0%)	1	NA	NA
WP_001120531.1|2060293_2060935_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 129
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2065861	2067823	5401672		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235820.1|2065861_2067823_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 130
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2073421	2074075	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882826.1|2073421_2074075_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
>prophage 131
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2080839	2082060	5401672		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|2080839_2082060_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 132
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2089536	2090364	5401672		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|2089536_2090364_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 133
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2096703	2098965	5401672		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|2096703_2098965_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 134
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2110262	2160059	5401672	tRNA,terminase,capsid,portal,tail,holin,head,transposase,plate	Enterobacteria_phage(77.5%)	55	NA	NA
WP_001144192.1|2110262_2112191_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|2112194_2112737_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2112833_2113031_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2113083_2113440_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2113562_2113607_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018594.1|2113890_2114874_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672378.1|2114888_2117276_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2117280_2117580_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078923.1|2117886_2118027_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_000488103.1|2118217_2118478_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001035742.1|2118721_2120224_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000132811.1|2120449_2121559_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_000005431.1|2121716_2122901_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290445.1|2122900_2123413_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000651581.1|2123468_2123843_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000333503.1|2123851_2124007_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853433.1|2123993_2126801_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000979957.1|2126813_2127302_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000954196.1|2127458_2128031_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144026.1|2128074_2128653_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000108519.1|2128652_2130785_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000071739.1|2130787_2131318_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111942.1|2131310_2132207_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_000213447.1|2132210_2132561_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271894.1|2132557_2133139_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000356341.1|2133135_2133771_-|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920593.1|2133763_2134231_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000780569.1|2134368_2134776_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000072327.1|2134772_2135165_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|2135161_2135485_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2135487_2135688_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|2135687_2136182_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632344.1|2136284_2137085_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055104.1|2137130_2138183_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262673.1|2138206_2139043_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613748.1|2139197_2140949_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_000087824.1|2140948_2141995_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000236489.1|2142009_2142534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211267.1|2143730_2144042_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000686506.1|2144046_2145006_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000165075.1|2146578_2147460_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
WP_000514277.1|2147524_2147767_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159459.1|2147778_2148057_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_100206497.1|2148067_2148346_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
WP_000416308.1|2149056_2149452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956529.1|2149641_2150622_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|2150684_2151236_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029479.1|2151235_2151985_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001209780.1|2152062_2152527_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001326034.1|2152772_2153486_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175600.1|2153548_2154985_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270809.1|2154988_2155180_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|2155311_2156358_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|2156514_2157348_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|2157680_2160059_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
>prophage 135
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2180406	2185490	5401672		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|2180406_2180775_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_001297388.1|2180783_2182271_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948855.1|2182280_2183027_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_000908012.1|2183001_2184273_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144575.1|2184269_2185490_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 136
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2193780	2196048	5401672		Escherichia_phage(50.0%)	3	NA	NA
WP_023982239.1|2193780_2194449_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.5	1.3e-22
WP_001344652.1|2194445_2195201_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587564.1|2195235_2196048_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 137
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2201552	2210356	5401672		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|2201552_2202194_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098896.1|2202233_2203382_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_001182363.1|2203672_2204884_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|2204996_2205929_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|2205925_2206951_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|2207249_2207339_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|2207504_2208674_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|2208819_2209401_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101183.1|2209528_2210356_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 138
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2219159	2220658	5401672		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|2219159_2220056_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|2220136_2220658_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 139
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2227569	2228844	5401672	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2227569_2228844_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 140
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2248718	2250530	5401672		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945880.1|2248718_2250530_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 141
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2260425	2261727	5401672		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|2260425_2261727_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 142
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2271827	2375314	5401672	lysis,terminase,capsid,portal,tail,integrase,protease,holin,head,transposase	Stx2-converting_phage(33.8%)	115	2299629:2299658	2356651:2356680
WP_106914125.1|2271827_2272649_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2272748_2272832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2272924_2273260_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2273656_2274910_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|2275016_2275910_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2276044_2277265_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2277389_2278085_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071526378.1|2278037_2279330_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2279488_2280103_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2280145_2281000_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2281001_2281619_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|2281629_2284053_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041554.1|2284113_2286540_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001307224.1|2286738_2287044_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2287151_2287862_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2287864_2288425_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2288459_2288801_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2288935_2289262_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2289467_2290682_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2290693_2291713_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|2291770_2291881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876990.1|2291900_2293181_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_106914126.1|2293435_2294113_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	45.2	4.7e-20
WP_000624622.1|2294112_2294460_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_021572172.1|2294479_2296051_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
WP_000048302.1|2296246_2298718_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|2298811_2299003_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2298999_2299188_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|2299603_2299891_+	hypothetical protein	NA	NA	NA	NA	NA
2299629:2299658	attL	TTTTAACCACGTCAGGCGAGGTGGTATCCT	NA	NA	NA	NA
WP_001344637.1|2299859_2300225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|2300236_2300389_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|2300581_2300989_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2301066_2301294_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705364.1|2301277_2301799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054483.1|2301779_2302745_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_085948952.1|2303083_2304296_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.0	4.2e-168
WP_085948953.1|2304262_2304343_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.2e-06
WP_001064906.1|2304427_2305117_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_085948178.1|2305383_2306597_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001344632.1|2306856_2306988_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000143036.1|2307435_2309286_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_000411811.1|2309731_2309938_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|2309942_2310287_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|2310337_2310871_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_012578895.1|2311388_2311574_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736096.1|2311659_2311884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|2312252_2312480_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|2312521_2312887_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000958415.1|2313176_2313740_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|2313736_2315398_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000173011.1|2315461_2317399_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063099.1|2317443_2317665_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_012817878.1|2317610_2320190_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
WP_000125990.1|2320192_2320519_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2320528_2320879_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2320875_2321322_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|2321318_2321663_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_024222395.1|2321729_2322446_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	95.8	1.3e-124
WP_001030041.1|2322451_2322826_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_001453698.1|2322921_2323131_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000937595.1|2325239_2326427_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|2326426_2326792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001369428.1|2326810_2328253_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	5.1e-229
WP_000807940.1|2328245_2328587_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369426.1|2328586_2329285_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_001369422.1|2329290_2330034_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_096860308.1|2329979_2330612_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_000514718.1|2330954_2334428_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.1	0.0e+00
WP_001228290.1|2334495_2335095_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000216548.1|2335246_2336551_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
WP_001023476.1|2336552_2336822_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106409364.1|2337936_2338059_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2338165_2339077_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_085948178.1|2339623_2340837_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303943.1|2341863_2342142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2342569_2342716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2342852_2343500_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144879.1|2343683_2344274_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001261191.1|2346779_2347133_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000171274.1|2347223_2347943_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|2347982_2348381_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|2348485_2349025_-	septation protein A	NA	NA	NA	NA	NA
WP_000028550.1|2349054_2349798_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|2350154_2350793_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|2350838_2351969_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2351946_2352195_-	excisionase	NA	NA	NA	NA	NA
WP_000048484.1|2352259_2354731_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000199480.1|2354826_2355015_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|2355011_2355200_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|2355599_2355767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2355760_2355994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2355971_2356379_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|2356401_2356620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2356692_2356992_-	hypothetical protein	NA	NA	NA	NA	NA
2356651:2356680	attR	TTTTAACCACGTCAGGCGAGGTGGTATCCT	NA	NA	NA	NA
WP_000787428.1|2357256_2357664_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|2357950_2358502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2358473_2359514_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2359425_2359968_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|2360001_2360736_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|2360732_2360897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2361595_2362354_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2362632_2362845_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|2363065_2363323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178572.1|2363392_2363671_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001265289.1|2363672_2364728_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|2364728_2365094_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|2365090_2365780_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_106914127.1|2367305_2369111_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_001023452.1|2369112_2369382_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2369522_2370398_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121225.1|2370622_2371273_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_096245710.1|2371868_2372183_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|2372242_2373526_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|2373614_2375075_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|2375110_2375314_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 143
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2380681	2381572	5401672		Bacillus_phage(100.0%)	1	NA	NA
WP_000592835.1|2380681_2381572_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 144
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2389076	2391206	5401672		Pandoravirus(50.0%)	3	NA	NA
WP_000012625.1|2389076_2390516_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	3.1e-29
WP_000803659.1|2390572_2390791_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|2390822_2391206_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 145
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2398951	2400370	5401672		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|2398951_2400370_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 146
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2413724	2414938	5401672	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947772.1|2413724_2414938_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 147
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2435629	2442565	5401672		Bacillus_phage(50.0%)	3	NA	NA
WP_000628552.1|2435629_2437315_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
WP_000832502.1|2437352_2439725_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_106914129.1|2439769_2442565_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
>prophage 148
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2447844	2451651	5401672		Bacillus_virus(50.0%)	2	NA	NA
WP_000426272.1|2447844_2449227_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001425964.1|2449251_2451651_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 149
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2455967	2457873	5401672		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193551.1|2455967_2456954_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
WP_001285539.1|2456946_2457873_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
>prophage 150
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2461147	2462589	5401672		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|2461147_2462158_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|2462304_2462589_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 151
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2468601	2468892	5401672		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001345360.1|2468601_2468892_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	64.0	2.3e-24
>prophage 152
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2475777	2477322	5401672		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|2475777_2477322_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 153
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2483728	2490113	5401672		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000014717.1|2483728_2487937_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
WP_000103248.1|2488004_2490113_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-27
>prophage 154
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2495019	2497122	5401672		Salmonella_phage(100.0%)	1	NA	NA
WP_000689391.1|2495019_2497122_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 155
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2501387	2502197	5401672		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|2501387_2502197_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 156
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2505578	2633726	5401672	tRNA,terminase,capsid,tail,integrase,holin,head,transposase	Escherichia_phage(38.96%)	128	2540832:2540848	2632859:2632875
WP_000220396.1|2505578_2506592_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|2506609_2507755_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760637.1|2507999_2509406_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|2509484_2509901_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|2509946_2510123_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|2510344_2510575_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|2510666_2512628_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429155.1|2512700_2513237_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071532666.1|2513289_2514498_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826406.1|2514537_2515746_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001261013.1|2516272_2516941_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|2517243_2517837_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|2517833_2518826_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001315480.1|2519017_2519929_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|2519923_2520460_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2520522_2520747_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2520886_2522542_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013783.1|2522766_2524110_-	VOC family protein	NA	NA	NA	NA	NA
WP_001345051.1|2524326_2525250_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098530.1|2525287_2526928_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2527326_2527476_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2527547_2527721_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|2527965_2528496_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|2528684_2529686_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2531226_2532027_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139621.1|2532298_2536201_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2536401_2537007_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|2537057_2538374_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431813.1|2538363_2540121_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|2540136_2541033_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
2540832:2540848	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177525.1|2541032_2541638_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000477179.1|2541808_2544115_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|2544178_2545039_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123455.1|2545269_2545860_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|2545841_2546792_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|2546892_2548206_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2548232_2549438_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2549437_2549860_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|2549849_2551277_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|2551278_2552067_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2552066_2552834_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|2552830_2553901_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|2553908_2554406_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|2554420_2555167_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2555175_2555463_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|2555474_2556404_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|2556688_2558734_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535449.1|2558981_2561255_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001067510.1|2563034_2563940_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001341369.1|2564111_2564438_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|2564445_2564631_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900925.1|2564627_2567267_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2567474_2568464_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|2568574_2568997_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2568993_2569260_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628171.1|2569533_2573058_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837930.1|2573424_2574558_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
WP_001295593.1|2574698_2575133_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|2575713_2576355_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|2576436_2577066_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|2577138_2577714_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|2577826_2578096_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268965.1|2578097_2579411_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	7.9e-80
WP_001230550.1|2579475_2580075_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|2580145_2583643_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|2583776_2584304_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|2584494_2585127_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|2585072_2585816_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|2585826_2586525_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|2586524_2586866_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_106914130.1|2586858_2590101_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	98.9	0.0e+00
WP_001453698.1|2590152_2590362_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2590457_2590832_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275480.1|2590837_2591554_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.9	1.4e-126
WP_000133393.1|2591622_2591967_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2591963_2592410_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2592406_2592757_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125972.1|2592766_2593093_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.3e-52
WP_001063025.1|2595457_2595679_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|2595723_2597661_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|2597724_2599386_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|2599382_2599946_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2600234_2600600_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2600641_2600842_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|2600973_2601300_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|2601700_2601886_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|2602108_2602240_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000285960.1|2602334_2602511_-	phage antirepressor	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_085948178.1|2602587_2603800_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001344811.1|2603803_2604343_-	ant domain protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
WP_000992086.1|2604616_2605150_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|2605200_2605545_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|2605549_2605765_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_106914131.1|2605914_2607768_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000466957.1|2608338_2608770_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|2609331_2609886_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|2609882_2610173_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|2610172_2610772_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000016656.1|2612663_2613653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|2613620_2614772_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|2615203_2615449_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|2615527_2615689_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|2615699_2615963_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|2615964_2616129_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|2616214_2616427_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|2616532_2616955_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|2616970_2617732_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|2617754_2618501_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|2618507_2619296_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|2619373_2619796_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|2619792_2620047_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|2620126_2620546_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|2620788_2620968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|2620978_2621134_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2621130_2621619_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2622060_2622282_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2622281_2622452_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|2622526_2622802_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_000105140.1|2622903_2625504_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|2625496_2626306_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|2626361_2626511_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|2626548_2626737_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2626836_2627052_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|2627053_2628289_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|2628340_2629276_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|2629404_2630778_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2631255_2632239_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_097601872.1|2632493_2633726_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2632859:2632875	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 157
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2640054	2640570	5401672		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945026.1|2640054_2640570_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
>prophage 158
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2658750	2659833	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_000068004.1|2658750_2659833_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	8.1e-22
>prophage 159
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2673836	2675102	5401672		Klosneuvirus(100.0%)	1	NA	NA
WP_000069227.1|2673836_2675102_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.7e-24
>prophage 160
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2687633	2765443	5401672	terminase,portal,tail,protease,holin,transposase	Enterobacteria_phage(41.51%)	84	NA	NA
WP_000573407.1|2687633_2688440_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968850.1|2688507_2688861_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|2689228_2690017_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000437858.1|2690161_2691289_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|2691356_2693291_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000221855.1|2693368_2693473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|2693728_2694941_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153244795.1|2694907_2695054_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	80.0	4.9e-07
WP_001288368.1|2696972_2697146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088625.1|2697235_2697985_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|2698253_2698472_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001295580.1|2698597_2698924_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176278.1|2698923_2699661_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|2699852_2701022_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876286.1|2701028_2701337_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256539.1|2701485_2702250_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|2702419_2703010_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099519.1|2703073_2705749_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|2705912_2706008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297116.1|2706121_2706289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295577.1|2706291_2706420_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|2706750_2707725_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001297122.1|2707934_2710532_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|2710911_2711163_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|2711198_2712248_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|2712467_2713226_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|2713222_2713813_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2713852_2714725_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|2714825_2715446_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|2715442_2716324_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2716461_2716506_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|2716597_2718160_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2718159_2719755_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001344826.1|2719758_2721117_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|2721128_2722322_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2722321_2723128_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2723508_2723688_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2723773_2724274_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|2724319_2724826_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000692020.1|2725862_2726453_-	protein kinase	NA	NA	NA	NA	NA
WP_001023476.1|2727589_2727859_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106914133.1|2727860_2729183_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.1	1.3e-74
WP_001230455.1|2729247_2729847_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_106895295.1|2729914_2733391_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
WP_122996286.1|2733627_2734260_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001344666.1|2734205_2734949_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_000847298.1|2735656_2735986_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918237.1|2735982_2738628_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.4	0.0e+00
WP_000532073.1|2738671_2738980_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2739006_2739429_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2739442_2740195_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2740202_2740601_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2740613_2741237_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2741239_2741521_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2741513_2741840_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2741927_2743952_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2743896_2745399_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|2745398_2745611_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|2745607_2747731_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|2747727_2748204_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012578895.1|2748680_2748866_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992150.1|2749384_2749918_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	2.1e-100
WP_085948178.1|2750340_2751554_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001344902.1|2751579_2751825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072901.1|2751828_2752044_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290214.1|2752121_2752367_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000143458.1|2752407_2752587_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142980.1|2752724_2754671_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000483498.1|2755265_2756324_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000917735.1|2756474_2756672_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|2756898_2757720_-	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904137.1|2757716_2758091_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001344904.1|2758103_2759153_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_001447497.1|2759154_2759433_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001260976.1|2759568_2759826_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_000220602.1|2759831_2760131_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_000610381.1|2760336_2760690_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000137950.1|2760686_2761058_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_000403788.1|2761153_2761510_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	6.7e-58
WP_001209477.1|2761487_2761949_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	95.2	6.9e-39
WP_001444682.1|2761945_2762242_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	4.4e-47
WP_072127369.1|2762238_2762520_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.8	1.6e-30
WP_000075578.1|2762552_2763089_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.9	4.1e-59
WP_000268365.1|2764894_2765443_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
>prophage 161
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2770334	2772349	5401672		Planktothrix_phage(100.0%)	2	NA	NA
WP_000994905.1|2770334_2771339_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
WP_000110945.1|2771335_2772349_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 162
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2781759	2791948	5401672		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|2781759_2782377_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287380.1|2782981_2783395_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|2783538_2784447_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193437.1|2784648_2785662_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|2785753_2786659_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|2786771_2787230_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|2787279_2788122_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|2789025_2789703_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571701.1|2789702_2790413_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|2790409_2791948_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 163
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2797932	2803431	5401672		Feldmannia_irregularis_virus(50.0%)	5	NA	NA
WP_001344908.1|2797932_2800371_+	nitrate/nitrite two-component system sensor histidine kinase NarX	NA	Q6XM27	Feldmannia_irregularis_virus	23.0	1.4e-05
WP_000086212.1|2800371_2801766_-	inverse autotransporter invasin YchO	NA	NA	NA	NA	NA
WP_001169669.1|2801950_2802304_+	DsrE/F sulfur relay family protein YchN	NA	NA	NA	NA	NA
WP_001297117.1|2802347_2803043_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001146442.1|2803200_2803431_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 164
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2806532	2810540	5401672		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|2806532_2807387_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257045.1|2807422_2808232_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|2808235_2808628_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|2808624_2809458_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|2809457_2810540_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 165
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2813676	2816428	5401672		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|2813676_2814624_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|2814748_2816428_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 166
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2844455	2844875	5401672		Morganella_phage(100.0%)	1	NA	NA
WP_000897379.1|2844455_2844875_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	61.3	5.9e-37
>prophage 167
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2861581	2931376	5401672	tRNA,capsid,terminase,tail,integrase,holin,head,transposase	Stx2-converting_phage(37.74%)	77	2874950:2874964	2931478:2931492
WP_000332303.1|2861581_2862313_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2862533_2862938_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|2862990_2863101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000871285.1|2863633_2863957_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	1.8e-41
WP_000444487.1|2864059_2865310_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248691.1|2865481_2866135_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2866144_2866606_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2866659_2867766_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2867801_2868443_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2868446_2869817_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|2869984_2870656_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2870655_2872116_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2872191_2873313_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359442.1|2873458_2874688_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2874937_2876074_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
2874950:2874964	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799400.1|2876057_2876921_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938117.1|2877284_2878646_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_001303921.1|2878706_2878982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|2879061_2879187_-	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_000145590.1|2879209_2879788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001369471.1|2879956_2883358_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_001301673.1|2883948_2886297_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2886316_2886406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|2886512_2886782_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_000268887.1|2886783_2888106_-|tail	tail fiber protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001230459.1|2888170_2888770_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000514853.1|2888836_2892316_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.4	0.0e+00
WP_122996286.1|2892552_2893185_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000967279.1|2893130_2893868_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_106914134.1|2894915_2895119_-	toxin-antitoxin system HicB family antitoxin	NA	A0A0P0ZC65	Stx2-converting_phage	74.6	2.8e-16
WP_001302649.1|2895226_2895547_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_097601926.1|2895563_2896262_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	1.7e-129
WP_000807928.1|2896261_2896603_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	95.6	5.3e-60
WP_106914135.1|2896595_2899838_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	98.4	0.0e+00
WP_001453698.1|2899889_2900099_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106914136.1|2900194_2900569_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	97.6	5.6e-63
WP_001275472.1|2900574_2901291_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|2901357_2901702_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2901698_2902145_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2902141_2902492_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2902501_2902828_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063099.1|2905516_2905738_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172984.1|2905782_2907720_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.7	0.0e+00
WP_001369319.1|2907783_2909445_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000958415.1|2909441_2910005_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_000279788.1|2910295_2910661_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	2.0e-65
WP_000095736.1|2910702_2910930_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2911354_2911540_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2911767_2911914_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2911913_2912483_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|2912753_2913287_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000731236.1|2913337_2913682_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411802.1|2913686_2913893_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000874287.1|2914340_2916191_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000935544.1|2916987_2918046_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000917750.1|2918196_2918394_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2918635_2919166_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000140024.1|2919174_2919540_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_001369253.1|2919540_2920596_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_012817871.1|2920597_2920870_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_072058819.1|2921037_2921178_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_085948178.1|2921215_2922428_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_023981635.1|2922468_2922885_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.6e-63
WP_000095671.1|2922925_2923888_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693943.1|2923910_2924336_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444689.1|2924332_2924635_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_001169687.1|2924732_2925104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|2925124_2925316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2925317_2925596_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001447517.1|2925891_2926281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2926321_2926540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993436.1|2926543_2926684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2927023_2927212_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2927208_2927400_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048442.1|2927492_2929958_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
WP_000003742.1|2930019_2930289_+	excisionase	NA	NA	NA	NA	NA
WP_000074981.1|2930257_2931376_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
2931478:2931492	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 168
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2934822	2938545	5401672		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|2934822_2935644_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|2935659_2936571_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001251348.1|2936599_2937844_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033694.1|2937843_2938545_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
>prophage 169
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2945834	2946092	5401672		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2945834_2946092_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 170
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2958415	2960058	5401672		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267931.1|2958415_2959420_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|2959416_2960058_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 171
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2963330	2964512	5401672		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|2963330_2963567_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008538.1|2963777_2964512_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
>prophage 172
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2976869	2977811	5401672		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001345393.1|2976869_2977811_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 173
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2993656	2993902	5401672		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2993656_2993902_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 174
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	2998563	2999484	5401672		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|2998563_2999484_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 175
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3008792	3009326	5401672		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|3008792_3009326_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 176
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3013460	3014294	5401672		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|3013460_3014294_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 177
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3020311	3092499	5401672	protease,transposase	Escherichia_phage(28.57%)	62	NA	NA
WP_001220314.1|3020311_3020533_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001345397.1|3020595_3021072_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214398.1|3021087_3021573_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001234682.1|3021663_3022482_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
WP_000149392.1|3022821_3023142_-	phospholipase	NA	NA	NA	NA	NA
WP_085948274.1|3023208_3024421_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.4e-168
WP_001432292.1|3024679_3026875_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750137.1|3026880_3028218_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015709.1|3028214_3029957_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_106914137.1|3029956_3030904_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_085948178.1|3032167_3033380_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000502842.1|3033444_3034083_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.9e-55
WP_001304205.1|3035800_3037969_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|3038722_3039769_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001287881.1|3040443_3040635_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|3040687_3040921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|3041016_3041640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|3041728_3042238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|3042695_3043154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|3044507_3045632_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|3046361_3046559_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001340489.1|3046624_3046840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303898.1|3047124_3047397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001377350.1|3047485_3047659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|3047710_3047905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|3048685_3049021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|3049654_3049873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|3051325_3053416_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|3053929_3054316_-	protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|3054738_3055314_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3055382_3055961_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3056009_3057050_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3057072_3057528_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3057550_3058708_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|3058707_3059289_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001280118.1|3060677_3061820_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3061812_3062586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3062587_3063667_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3063666_3064623_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3064633_3065842_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3065859_3066327_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3066587_3066917_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957251.1|3066903_3067245_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3068187_3069801_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3069831_3070182_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3070178_3070604_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_085948178.1|3070972_3072186_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001135715.1|3075798_3075939_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3076240_3076504_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021388.1|3077715_3078333_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142973.1|3078344_3079019_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3079019_3079484_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3079493_3081197_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3081189_3081510_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3081518_3081821_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_042352357.1|3081911_3082610_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3082990_3083266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591991.1|3083490_3085110_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3085202_3085562_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_085948178.1|3086418_3087632_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000998045.1|3087843_3089382_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
WP_000233452.1|3090138_3092499_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
>prophage 178
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3099525	3103542	5401672	integrase	Pseudomonas_phage(50.0%)	3	3087748:3087760	3100994:3101006
3087748:3087760	attL	ACTGGCGACAGCC	NA	NA	NA	NA
WP_000279869.1|3099525_3100728_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_001297190.1|3101351_3101807_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
3100994:3101006	attR	ACTGGCGACAGCC	NA	NA	NA	NA
WP_001307105.1|3102618_3103542_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 179
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3118442	3120542	5401672		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|3118442_3118937_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|3118957_3120286_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|3120368_3120542_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 180
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3124847	3137102	5401672		Klosneuvirus(20.0%)	13	NA	NA
WP_000420629.1|3124847_3125768_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|3125767_3126073_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|3126165_3126765_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|3126761_3129308_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|3129307_3130480_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3130609_3131302_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|3131274_3132303_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001444559.1|3132385_3135130_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|3135201_3136275_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3136322_3136496_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|3136485_3136716_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3136690_3136879_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3136889_3137102_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 181
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3151428	3197511	5401672	holin,protease,transposase	Escherichia_phage(34.62%)	57	NA	NA
WP_000003671.1|3151428_3152016_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|3152012_3152720_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3152738_3154532_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3154528_3155647_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001443410.1|3156264_3156648_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_012817858.1|3157093_3157987_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_085948178.1|3158073_3159286_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303940.1|3159336_3159561_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001303878.1|3159642_3159957_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3160483_3160669_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675929.1|3160890_3161004_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_001003118.1|3161224_3161758_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3161917_3162190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3162445_3162652_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874357.1|3163099_3164950_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000261909.1|3165717_3166431_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|3166568_3166766_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|3167052_3167871_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|3168022_3168394_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|3168383_3168755_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|3168767_3169817_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_032280206.1|3169836_3170097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|3170264_3170477_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|3170665_3170770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|3170885_3171755_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|3171765_3172029_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|3172030_3172195_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|3172280_3172493_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|3172543_3172900_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209481.1|3172877_3173339_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266135.1|3173335_3173632_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001151153.1|3173628_3174051_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001262389.1|3174091_3175162_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693949.1|3175233_3175659_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|3175655_3175871_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103686.1|3175920_3176637_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000379580.1|3176909_3177062_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000394557.1|3177073_3177448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3177979_3178168_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3178164_3178356_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000273151.1|3180988_3181231_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375138.1|3182631_3183291_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_000904442.1|3183381_3183711_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000048244.1|3183707_3183986_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000116302.1|3184080_3185271_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_001295356.1|3185328_3185646_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000665217.1|3185690_3186104_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847791.1|3186276_3186939_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424181.1|3187034_3187493_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_001297106.1|3187524_3189579_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_001261235.1|3189701_3190148_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000875023.1|3190157_3192320_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001444487.1|3192282_3192858_-	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000288710.1|3193130_3193640_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000750416.1|3193996_3195037_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877161.1|3195112_3195565_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156528.1|3195750_3197511_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 182
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3202178	3204086	5401672		Tupanvirus(100.0%)	1	NA	NA
WP_000053122.1|3202178_3204086_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 183
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3220008	3231141	5401672	tRNA	Bacillus_virus(20.0%)	8	NA	NA
WP_001090514.1|3220008_3220776_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193859.1|3220982_3223595_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001297200.1|3223860_3225063_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|3225231_3226632_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|3227233_3228322_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|3228506_3229697_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109487.1|3229918_3230566_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3230592_3231141_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 184
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3245846	3250387	5401672		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|3245846_3247595_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705695.1|3247631_3249896_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3250102_3250387_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 185
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3255473	3256562	5401672		Streptococcus_phage(100.0%)	1	NA	NA
WP_106914138.1|3255473_3256562_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 186
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3260660	3263875	5401672		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292822.1|3260660_3262943_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000111043.1|3263134_3263875_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 187
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3270183	3293980	5401672	tRNA,protease	Escherichia_phage(16.67%)	16	NA	NA
WP_000213098.1|3270183_3270801_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|3270811_3273256_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|3273494_3274787_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067740.1|3274877_3276221_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_001295343.1|3276231_3276843_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077080.1|3276997_3281104_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3281238_3281733_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3282276_3283242_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043619.1|3283364_3285131_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|3285131_3286853_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|3286894_3287599_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3287883_3288102_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3288786_3291063_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3291093_3291414_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3291736_3291961_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3292033_3293980_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
>prophage 188
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3303277	3304996	5401672		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815379.1|3303277_3304996_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.8	1.2e-30
>prophage 189
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3308583	3311321	5401672		Roseobacter_phage(50.0%)	4	NA	NA
WP_106914139.1|3308583_3309414_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001160723.1|3309410_3309734_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3309859_3310375_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3310592_3311321_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 190
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3314659	3323809	5401672		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149732.1|3314659_3315787_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3315827_3316316_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3316375_3317221_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093858.1|3317217_3318171_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|3318180_3319314_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126054.1|3319408_3320521_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001345433.1|3320871_3321348_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3321435_3322338_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3322398_3323121_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3323104_3323392_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3323551_3323809_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 191
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3332375	3333578	5401672		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3332375_3333578_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 192
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3344922	3346794	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|3344922_3346794_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 193
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3350009	3359881	5401672		Synechococcus_phage(25.0%)	7	NA	NA
WP_000424890.1|3350009_3350672_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_001295295.1|3350802_3351702_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209359.1|3351707_3354140_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114244.1|3354285_3355101_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000168797.1|3355252_3356518_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000923072.1|3356754_3358347_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	3.1e-62
WP_000812326.1|3358381_3359881_+	recombinase family protein	NA	A0A288WFZ3	Bacillus_phage	25.4	4.6e-15
>prophage 194
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3363009	3365192	5401672		Escherichia_phage(50.0%)	2	NA	NA
WP_000219416.1|3363009_3363651_-	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	31.0	2.7e-09
WP_000190482.1|3363875_3365192_+	restriction endonuclease subunit M	NA	A0A222ZMD5	Mycobacterium_phage	38.0	1.2e-48
>prophage 195
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3372163	3377388	5401672		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|3372163_3372679_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3372731_3372797_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|3373031_3373919_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3374217_3374721_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3375124_3375871_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159066.1|3376009_3376669_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3376665_3377388_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 196
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3380928	3395741	5401672		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|3380928_3381189_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_106914141.1|3381452_3383735_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|3383776_3384454_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|3384527_3384794_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3385058_3385319_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443534.1|3385548_3386634_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|3386774_3387737_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001345442.1|3387764_3389915_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	2.8e-42
WP_001145128.1|3390034_3390517_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007090.1|3390749_3392114_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	9.5e-52
WP_001296991.1|3392342_3393014_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|3393016_3394012_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|3394004_3395741_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
>prophage 197
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3406338	3407247	5401672		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3406338_3407247_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 198
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3413728	3415018	5401672		Klosneuvirus(100.0%)	1	NA	NA
WP_001307065.1|3413728_3415018_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 199
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3418626	3450070	5401672	capsid,tail,integrase,holin,head	Enterobacteria_phage(58.33%)	41	3426296:3426312	3455462:3455478
WP_021351651.1|3418626_3418998_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_001369236.1|3419121_3419952_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	97.8	7.6e-153
WP_000950982.1|3420175_3421057_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|3421162_3421432_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000268900.1|3421433_3422747_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001230465.1|3422811_3423411_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000514984.1|3423478_3426955_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
3426296:3426312	attL	CAGCCCCACAATGGCCG	NA	NA	NA	NA
WP_072147834.1|3427195_3427825_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|3427770_3428514_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_000847298.1|3429221_3429551_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082365.1|3429547_3432127_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.4	0.0e+00
WP_000533403.1|3432107_3432521_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479083.1|3432547_3432979_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_001143011.1|3432992_3433745_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000683071.1|3433752_3434148_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|3434144_3434720_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|3434734_3435088_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|3435080_3435455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|3435506_3436535_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256792.1|3436592_3436940_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001254039.1|3436976_3438482_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000145948.1|3439096_3439387_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_000818841.1|3439459_3439666_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000344554.1|3439683_3440046_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000814614.1|3440017_3440428_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_001254255.1|3440424_3440601_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386661.1|3440603_3440963_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_000950962.1|3440962_3441139_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001286917.1|3441131_3441344_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000002251.1|3441336_3441627_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001008192.1|3441623_3441986_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000994516.1|3441982_3442171_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|3442382_3443342_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032178163.1|3443681_3443804_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|3443818_3444508_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|3444692_3445436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|3445521_3445680_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023272.1|3445978_3447829_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000411800.1|3448276_3448483_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000075132.1|3448482_3448980_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000263438.1|3448993_3450070_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
3455462:3455478	attR	CAGCCCCACAATGGCCG	NA	NA	NA	NA
>prophage 200
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3459872	3466445	5401672		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891685.1|3459872_3460931_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|3460933_3461623_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113002.1|3461622_3462396_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|3462561_3462711_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|3462839_3463628_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|3463695_3465168_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|3465428_3466445_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 201
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3470800	3474320	5401672		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109199.1|3470800_3471853_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
WP_000784351.1|3472168_3472549_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951293.1|3472662_3473604_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345401.1|3473600_3474320_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	3.2e-22
>prophage 202
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3510412	3511204	5401672		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114037.1|3510412_3511204_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	3.7e-08
>prophage 203
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3514582	3517524	5401672		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|3514582_3516064_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207146.1|3516105_3517524_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	5.2e-61
>prophage 204
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3521607	3534324	5401672		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_000015219.1|3521607_3525789_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	7.2e-26
WP_000424924.1|3526039_3526246_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|3526558_3526648_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000730091.1|3526647_3528321_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_000087956.1|3528343_3530392_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	1.6e-26
WP_001297248.1|3530400_3530973_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_001344792.1|3530965_3533650_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186103.1|3533646_3534324_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 205
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3540979	3541744	5401672		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|3540979_3541744_+	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 206
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3545894	3549708	5401672	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|3545894_3547559_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|3547761_3549708_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 207
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3554334	3555999	5401672		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000337071.1|3554334_3555999_+	asparagine synthase B	NA	E5EQ62	Micromonas_sp._RCC1109_virus	38.5	1.0e-84
>prophage 208
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3560095	3561175	5401672		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490847.1|3560095_3561175_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 209
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3569071	3572604	5401672		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|3569071_3569797_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|3569914_3570850_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000367891.1|3570933_3572604_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	1.8e-76
>prophage 210
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3579542	3582125	5401672	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|3579542_3582125_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 211
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3589135	3591575	5401672		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231415.1|3589135_3590224_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|3590363_3591575_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 212
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3596390	3597037	5401672		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|3596390_3596774_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|3596827_3597037_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 213
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3612462	3614577	5401672		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|3612462_3612891_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|3613011_3614577_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 214
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3617686	3618907	5401672		Streptococcus_phage(100.0%)	1	NA	NA
WP_106914142.1|3617686_3618907_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	1.0e-57
>prophage 215
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3634048	3640091	5401672		Klosneuvirus(50.0%)	3	NA	NA
WP_001005919.1|3634048_3634864_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096713.1|3634860_3635994_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077704.1|3636209_3640091_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
>prophage 216
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3651521	3654665	5401672		Leptospira_phage(100.0%)	1	NA	NA
WP_000573931.1|3651521_3654665_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	3.2e-58
>prophage 217
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3657935	3749498	5401672	tRNA,capsid,tail,protease,head,transposase	Escherichia_phage(30.77%)	77	NA	NA
WP_000770957.1|3657935_3658619_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	3.9e-30
WP_000253805.1|3658608_3660057_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000103161.1|3660793_3662695_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.9e-27
WP_001160811.1|3662722_3663184_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_106914143.1|3663203_3668003_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.9	1.9e-17
WP_000092528.1|3668004_3668370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333355.1|3668674_3669112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344803.1|3669155_3669479_+	sugar-binding protein	NA	NA	NA	NA	NA
WP_000420935.1|3669605_3670742_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383942.1|3671010_3673248_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001345000.1|3673234_3676207_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001177454.1|3677281_3678043_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201824.1|3678555_3679509_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|3679695_3681180_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|3681363_3681669_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|3681725_3682394_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_153244794.1|3682351_3682498_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.4e-06
WP_085948178.1|3682463_3683677_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000840226.1|3683682_3685863_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_000459457.1|3685855_3686290_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|3686271_3686694_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|3686709_3687450_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683103.1|3687457_3687853_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_000985132.1|3687849_3688428_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_085948269.1|3688520_3689734_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
WP_000752958.1|3689754_3690054_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_000158868.1|3690065_3690461_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063245.1|3690502_3691528_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_001345004.1|3691583_3691916_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000805428.1|3693126_3693759_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001255226.1|3693761_3694277_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001345007.1|3695328_3697938_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988363.1|3697968_3698661_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3698880_3699423_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|3699903_3700770_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3700771_3700984_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143540.1|3701091_3701613_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912342.1|3701648_3703034_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_000256002.1|3703207_3703702_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212252.1|3703704_3704427_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_001295318.1|3704544_3705054_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815554.1|3705050_3706118_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855355.1|3706254_3707148_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000152513.1|3707144_3707960_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000495365.1|3707970_3709230_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000580836.1|3709239_3710907_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000703909.1|3711223_3712273_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001301144.1|3712294_3713530_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_000540946.1|3713540_3714326_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001315307.1|3714454_3715600_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_001298987.1|3715621_3716923_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000006887.1|3716979_3718341_-	allantoinase AllB	NA	NA	NA	NA	NA
WP_000401100.1|3718400_3719855_-	putative allantoin permease	NA	NA	NA	NA	NA
WP_000765839.1|3720023_3720902_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000943558.1|3721001_3721778_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001342079.1|3721790_3723572_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000141275.1|3723661_3724477_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|3724554_3725037_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460145.1|3725266_3726193_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001158001.1|3726261_3727356_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_001320180.1|3728587_3728848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106914144.1|3733469_3735884_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|3735880_3736567_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001295836.1|3736537_3737161_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_000148941.1|3737150_3737960_+	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295322.1|3738020_3738875_+	chaperedoxin	NA	NA	NA	NA	NA
WP_001345010.1|3738937_3739720_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001157532.1|3739706_3740384_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_000904502.1|3740529_3741447_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000970323.1|3741443_3741902_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001026747.1|3741902_3742310_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000982172.1|3742434_3743727_-	amino acid permease	NA	NA	NA	NA	NA
WP_000883048.1|3743729_3744662_-	glutaminase A	NA	NA	NA	NA	NA
WP_000078269.1|3744923_3747428_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_001342071.1|3747541_3747883_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000365177.1|3748020_3748815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186631.1|3749018_3749498_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
>prophage 218
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3756127	3768342	5401672	transposase	Acanthamoeba_polyphaga_moumouvirus(20.0%)	12	NA	NA
WP_000801832.1|3756127_3757087_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250125.1|3757083_3758046_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|3758281_3758926_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678194.1|3759106_3760981_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|3761090_3761696_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|3761695_3762025_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|3762077_3764009_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|3764137_3764689_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_001188905.1|3764841_3765219_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_000844848.1|3765288_3765816_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_000051146.1|3765829_3765991_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_085948259.1|3767128_3768342_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	2.4e-99
>prophage 219
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3774237	3777387	5401672		Leptospira_phage(100.0%)	1	NA	NA
WP_001132475.1|3774237_3777387_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 220
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3786222	3789769	5401672		Bacillus_phage(100.0%)	2	NA	NA
WP_001256174.1|3786222_3788004_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
WP_001235583.1|3787996_3789769_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.4e-49
>prophage 221
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3793092	3793788	5401672		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|3793092_3793788_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 222
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3796916	3801963	5401672	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|3796916_3797189_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|3797397_3799752_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|3799939_3801214_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|3801339_3801963_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 223
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3825793	3834774	5401672	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|3825793_3826264_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_097601857.1|3826352_3827456_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	9.1e-53
WP_000543535.1|3827459_3827909_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|3828059_3828599_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|3828897_3829782_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974809.1|3829958_3830306_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|3830434_3831406_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|3831416_3833264_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|3833291_3833624_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|3833646_3834774_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 224
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3841726	3851699	5401672		Bacillus_phage(60.0%)	7	NA	NA
WP_000893632.1|3841726_3843022_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
WP_000113933.1|3843079_3843769_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221319.1|3843958_3845161_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000698931.1|3845157_3848301_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001345020.1|3848426_3849611_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219321.1|3849754_3850663_-	fructokinase	NA	NA	NA	NA	NA
WP_001345021.1|3850787_3851699_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.3	1.8e-102
>prophage 225
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3855988	3857104	5401672		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|3855988_3857104_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 226
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3864519	3865677	5401672		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830745.1|3864519_3865677_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 227
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3871866	3872634	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939373.1|3871866_3872634_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 228
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3877930	3879040	5401672		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3877930_3879040_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 229
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3882217	3884178	5401672		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|3882217_3883231_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|3883227_3884178_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 230
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3889588	3893868	5401672		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805913.1|3889588_3890671_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	1.8e-191
WP_000177886.1|3890793_3893868_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
>prophage 231
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3897708	3903405	5401672		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952485.1|3897708_3898608_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
WP_001299008.1|3898647_3899931_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|3899920_3901180_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010284.1|3901518_3903405_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 232
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3911781	3916319	5401672		Tupanvirus(50.0%)	4	NA	NA
WP_000692745.1|3911781_3912831_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	8.3e-72
WP_000750340.1|3912917_3913874_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|3913870_3914842_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447335.1|3914834_3916319_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 233
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3928313	3938789	5401672	holin	Escherichia_phage(33.33%)	5	NA	NA
WP_001341217.1|3928313_3932297_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	2.5e-124
WP_000131044.1|3932869_3934903_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|3935031_3935619_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089070.1|3935632_3937105_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159100.1|3937118_3938789_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
>prophage 234
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3944364	3955386	5401672	integrase,transposase	Escherichia_phage(22.22%)	11	3937243:3937257	3951778:3951792
3937243:3937257	attL	ACTTCCGCACCCAGA	NA	NA	NA	NA
WP_001046293.1|3944364_3945690_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_097601866.1|3945798_3946059_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|3946061_3947275_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001019379.1|3947408_3948242_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_001035842.1|3948254_3948686_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_000083330.1|3948685_3948883_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_000251023.1|3949080_3949962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772642.1|3950104_3951319_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000893251.1|3951674_3952928_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3951778:3951792	attR	ACTTCCGCACCCAGA	NA	NA	NA	NA
WP_001285288.1|3952939_3954043_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3954330_3955386_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 235
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3960063	3961230	5401672		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001399806.1|3960063_3961230_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
>prophage 236
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	3984513	3987471	5401672		Catovirus(50.0%)	2	NA	NA
WP_001143093.1|3984513_3986958_+	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
WP_000859525.1|3987075_3987471_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
>prophage 237
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4001339	4005258	5401672		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543898.1|4001339_4002113_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|4002298_4002559_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|4002561_4002840_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4002995_4003736_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|4003706_4004474_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4004679_4005258_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 238
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4012615	4019071	5401672		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000509076.1|4012615_4016854_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
WP_000103324.1|4016929_4019071_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
>prophage 239
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4030034	4032842	5401672		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614352.1|4030034_4032842_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.1	2.6e-80
>prophage 240
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4043271	4051124	5401672		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_001297205.1|4043271_4044003_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4044067_4044535_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001326291.1|4044531_4045254_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|4045287_4046043_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644694.1|4046114_4047473_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000155276.1|4047520_4048291_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230966.1|4048368_4049169_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648609.1|4049409_4050324_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997040.1|4050320_4051124_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
>prophage 241
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4057783	4058815	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4057783_4058815_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 242
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4071775	4075891	5401672		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|4071775_4075258_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|4075294_4075891_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 243
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4098075	4099500	5401672	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753948.1|4098075_4099500_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 244
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4103429	4103774	5401672		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_097601799.1|4103429_4103774_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	5.9e-27
>prophage 245
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4109685	4110483	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4109685_4110483_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 246
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4115662	4122468	5401672	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001369168.1|4115662_4118092_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
WP_001294700.1|4118165_4118696_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|4118710_4119415_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|4119592_4120048_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|4120084_4121011_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174639.1|4121049_4122468_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 247
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4132374	4133277	5401672		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|4132374_4133277_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 248
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4136539	4143007	5401672		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|4136539_4137466_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|4137574_4138237_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|4138277_4138814_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001341254.1|4139019_4141410_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_001189601.1|4141456_4143007_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 249
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4150752	4152177	5401672		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4150752_4152177_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 250
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4160804	4161356	5401672		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|4160804_4161356_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 251
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4165601	4166645	5401672		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4165601_4166645_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 252
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4192619	4194344	5401672		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|4192619_4194344_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 253
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4207045	4207744	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|4207045_4207744_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 254
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4214076	4219499	5401672		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035661.1|4214076_4216428_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	7.9e-38
WP_001117018.1|4216592_4219499_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 255
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4227243	4229997	5401672		Microcystis_phage(50.0%)	5	NA	NA
WP_000257163.1|4227243_4228092_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
WP_000796358.1|4228116_4228716_+	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_001248979.1|4228751_4229219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998542.1|4229317_4229497_-	antitoxin	NA	NA	NA	NA	NA
WP_000624375.1|4229517_4229997_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 256
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4237892	4243553	5401672		Vibrio_phage(50.0%)	4	NA	NA
WP_106914147.1|4237892_4239407_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	20.7	7.9e-07
WP_000347117.1|4239437_4240580_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349932.1|4240708_4241926_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000351348.1|4241999_4243553_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
>prophage 257
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4249023	4250172	5401672		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4249023_4250172_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 258
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4254578	4257395	5401672	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286861.1|4254578_4257395_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.0	4.6e-77
>prophage 259
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4264436	4273490	5401672		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_097601810.1|4264436_4265603_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.0	1.7e-89
WP_000935262.1|4266131_4266341_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118450.1|4266444_4267560_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	5.4e-29
WP_000516135.1|4267648_4269565_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|4269941_4270346_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|4270371_4271085_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|4271233_4271800_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|4271834_4272422_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|4272536_4273490_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
>prophage 260
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4285258	4287372	5401672		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219604.1|4285258_4286683_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|4286682_4287372_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 261
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4290656	4296011	5401672		Bacillus_phage(33.33%)	3	NA	NA
WP_000409451.1|4290656_4292594_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4292804_4294472_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|4294778_4296011_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 262
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4302754	4304077	5401672		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|4302754_4304077_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 263
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4309712	4312588	5401672		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|4309712_4309874_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4310000_4310606_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175954.1|4310998_4312588_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	9.1e-30
>prophage 264
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4320484	4321764	5401672		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|4320484_4321024_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|4321026_4321764_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 265
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4324991	4330356	5401672		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|4324991_4326014_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091571.1|4326152_4327067_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410131.1|4327281_4328643_+	MFS transporter	NA	NA	NA	NA	NA
WP_000919575.1|4328691_4330356_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 266
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4347363	4348577	5401672	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948178.1|4347363_4348577_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 267
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4351590	4352547	5401672	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181112.1|4351590_4352547_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.7e-60
>prophage 268
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4360048	4360603	5401672		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|4360048_4360603_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 269
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4367171	4368632	5401672		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208201.1|4367171_4368632_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
>prophage 270
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4373984	4375197	5401672	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948178.1|4373984_4375197_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 271
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4380219	4381896	5401672		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|4380219_4380816_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790592.1|4381293_4381896_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	1.5e-54
>prophage 272
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4385258	4386239	5401672		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991446.1|4385258_4386239_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
>prophage 273
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4407080	4409291	5401672	integrase	Enterobacteria_phage(50.0%)	2	4391055:4391069	4413175:4413189
4391055:4391069	attL	CCAGCTGGCTTTTGA	NA	NA	NA	NA
WP_001219055.1|4407080_4407791_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.8e-41
WP_001345322.1|4408271_4409291_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	3.5e-43
4413175:4413189	attR	CCAGCTGGCTTTTGA	NA	NA	NA	NA
>prophage 274
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4413489	4418432	5401672	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
WP_000397144.1|4413489_4415001_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_001188289.1|4415094_4415577_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416419.1|4415576_4418432_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.6	3.0e-140
>prophage 275
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4426710	4432807	5401672		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|4426710_4427646_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|4427658_4428120_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4428192_4428579_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471866.1|4428784_4431481_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4431621_4431675_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181332.1|4431859_4432807_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
>prophage 276
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4436445	4439207	5401672		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|4436445_4438584_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|4438742_4439207_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
>prophage 277
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4443522	4450010	5401672		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|4443522_4444521_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|4444553_4445549_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|4445535_4446558_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205815.1|4446571_4448074_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|4448213_4449170_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4449479_4450010_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 278
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4472011	4535869	5401672	integrase,protease,tRNA,transposase	Morganella_phage(12.5%)	59	4468616:4468645	4494107:4494136
4468616:4468645	attL	TGTAGGCCTGATAAGCGTAGCGCATCAGGC	NA	NA	NA	NA
WP_001254202.1|4472011_4472302_-|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
WP_085948178.1|4472395_4473608_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000603950.1|4475747_4476296_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_000631719.1|4478617_4478965_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001218841.1|4480626_4481892_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|4482271_4482847_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|4482883_4484581_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|4484556_4484895_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|4485010_4486312_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|4486429_4487866_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4488202_4488679_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|4488694_4489951_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4490226_4490520_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4490563_4492210_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|4492347_4492701_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008073.1|4492904_4493774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|4494163_4495192_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
4494107:4494136	attR	TGTAGGCCTGATAAGCGTAGCGCATCAGGC	NA	NA	NA	NA
WP_000257278.1|4495233_4495800_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|4495851_4495977_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4496087_4496234_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|4496415_4496733_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|4496729_4497263_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|4497351_4498485_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|4498547_4498907_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|4498917_4499313_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|4499323_4500058_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192991.1|4500050_4501859_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|4502183_4503161_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|4503379_4504882_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|4504933_4505248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|4505244_4505559_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|4505587_4508911_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|4508932_4509901_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|4509997_4511050_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|4511144_4511690_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|4512548_4512602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294195.1|4512584_4513724_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|4513722_4515270_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4515241_4515703_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|4515721_4517059_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122520.1|4517068_4518916_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|4518908_4519859_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4519944_4520253_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460353.1|4520329_4521610_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4521695_4522955_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4522957_4523962_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4524043_4524241_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4524344_4525643_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4525847_4526273_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076318.1|4526311_4528672_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.2e-67
WP_001293281.1|4528851_4529583_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4529709_4530111_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4530129_4530828_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012546.1|4530878_4531538_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4531555_4531954_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|4531963_4532602_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943991.1|4532604_4533768_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001299838.1|4533851_4535477_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4535593_4535869_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 279
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4547437	4548052	5401672	transposase	Helicobacter_phage(100.0%)	1	NA	NA
WP_072098057.1|4547437_4548052_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	4.7e-43
>prophage 280
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4552077	4553067	5401672		Salmonella_phage(100.0%)	1	NA	NA
WP_000953030.1|4552077_4553067_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	1.1e-97
>prophage 281
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4565704	4566918	5401672	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948178.1|4565704_4566918_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 282
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4588888	4590391	5401672		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|4588888_4590391_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 283
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4595231	4596020	5401672		Planktothrix_phage(100.0%)	1	NA	NA
WP_001193388.1|4595231_4596020_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.6e-27
>prophage 284
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4601624	4603174	5401672		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|4601624_4602383_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611428.1|4602493_4603174_+	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	33.6	1.3e-17
>prophage 285
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4607159	4609145	5401672		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066006.1|4607159_4609145_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 286
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4614390	4616538	5401672		Escherichia_phage(100.0%)	1	NA	NA
WP_012817910.1|4614390_4616538_+	formate dehydrogenase H subunit alpha, selenocysteine-containing	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 287
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4625820	4627779	5401672		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|4625820_4627779_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 288
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4633364	4634714	5401672		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|4633364_4634714_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 289
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4638531	4642144	5401672		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|4638531_4639068_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|4639321_4642144_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 290
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4646351	4695420	5401672	tRNA,terminase,capsid,tail,holin,head	Stx2-converting_phage(33.33%)	51	NA	NA
WP_001147328.1|4646351_4647431_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
WP_000918363.1|4647483_4648899_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235522.1|4648981_4649965_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|4650130_4650373_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543817.1|4650506_4651544_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001217542.1|4652792_4653041_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132154.1|4653542_4654133_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001117798.1|4654315_4654966_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001345294.1|4655044_4656103_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4656232_4656655_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023417.1|4656815_4657085_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000279033.1|4657086_4658400_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001216290.1|4658464_4659088_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106914150.1|4659156_4662633_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.2	0.0e+00
WP_126303346.1|4662868_4663501_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_000194763.1|4663446_4664190_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152209.1|4664200_4664899_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000807964.1|4664898_4665240_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212952.1|4665232_4668475_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_001453698.1|4668526_4668736_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030043.1|4668831_4669206_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275461.1|4669211_4669928_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_000133388.1|4669994_4670339_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|4670335_4670782_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|4670778_4671129_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|4671138_4671465_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|4673828_4674050_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173088.1|4674094_4676032_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_009453642.1|4676095_4677757_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000958398.1|4677753_4678317_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_001303878.1|4679217_4679532_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|4680059_4680245_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|4680461_4680959_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|4680958_4681165_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143076.1|4681613_4683464_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.9	0.0e+00
WP_001339373.1|4684281_4684434_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_001047110.1|4684743_4685496_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_077890163.1|4687008_4687494_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	98.8	1.8e-85
WP_001191679.1|4687553_4687814_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_001345148.1|4687911_4688604_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|4689307_4689670_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081302.1|4689735_4690560_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000008211.1|4690687_4691224_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|4691214_4691565_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145671.1|4691561_4692035_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_000829414.1|4692181_4692598_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	69.9	1.4e-30
WP_001014294.1|4692650_4692842_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001094871.1|4692844_4693579_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001061339.1|4693578_4694151_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093918.1|4694187_4694469_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000956557.1|4694886_4695420_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 291
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4699611	4700220	5401672		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4699611_4700220_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 292
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4709435	4710551	5401672		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4709435_4710551_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 293
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4726556	4727348	5401672		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|4726556_4727348_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 294
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4739232	4742916	5401672		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|4739232_4742916_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 295
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4758290	4759880	5401672		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|4758290_4759880_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 296
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4765248	4767012	5401672		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|4765248_4765521_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940105.1|4765707_4766298_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|4766340_4767012_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 297
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4776226	4784555	5401672		Vibrio_phage(50.0%)	2	NA	NA
WP_000653940.1|4776226_4780450_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	7.2e-66
WP_000263098.1|4780526_4784555_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 298
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4788671	4791724	5401672		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|4788671_4789856_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|4790773_4791724_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 299
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4800230	4802075	5401672		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591365.1|4800230_4802075_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 300
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4819110	4826357	5401672		Serratia_phage(33.33%)	5	NA	NA
WP_000184877.1|4819110_4821408_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4821458_4821779_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004456.1|4821793_4822873_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001174110.1|4823181_4825683_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424845.1|4825694_4826357_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 301
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4839348	4843533	5401672		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106914153.1|4839348_4843533_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.4e-24
>prophage 302
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4849170	4853673	5401672		Erwinia_phage(50.0%)	5	NA	NA
WP_001293341.1|4849170_4850502_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4850568_4851495_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4851587_4852073_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4852157_4852403_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4852827_4853673_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 303
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4865246	4870107	5401672		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|4865246_4865945_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|4865941_4867315_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270270.1|4867420_4868095_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|4868243_4869227_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|4869486_4870107_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 304
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4885930	4888981	5401672		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4885930_4888981_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 305
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4897855	4900635	5401672		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|4897855_4898641_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621651.1|4898674_4899571_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|4899738_4900635_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 306
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4917002	4919473	5401672		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|4917002_4918052_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001345123.1|4918063_4919473_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 307
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4923551	4926338	5401672		uncultured_virus(100.0%)	1	NA	NA
WP_000250055.1|4923551_4926338_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 308
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4940019	4940634	5401672		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|4940019_4940634_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 309
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4949424	4952711	5401672		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|4949424_4950201_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|4950203_4950719_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|4950722_4950992_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|4951070_4952711_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 310
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4965124	4966954	5401672		Catovirus(100.0%)	1	NA	NA
WP_001345114.1|4965124_4966954_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	1.3e-83
>prophage 311
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4974436	4978295	5401672		Bacillus_phage(100.0%)	3	NA	NA
WP_000383411.1|4974436_4976599_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
WP_001213584.1|4976682_4977399_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|4977398_4978295_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 312
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	4981331	4984132	5401672		Salmonella_phage(100.0%)	2	NA	NA
WP_001369782.1|4981331_4982810_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_000678273.1|4982806_4984132_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.3e-07
>prophage 313
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5000429	5006573	5401672		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612044.1|5000429_5001560_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|5001564_5002239_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|5002216_5003098_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226587.1|5003116_5004184_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000006625.1|5004183_5005446_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|5005442_5006573_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 314
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5010615	5016027	5401672		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|5010615_5010945_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047503.1|5011075_5012341_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_001299253.1|5012474_5013959_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|5014005_5016027_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 315
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5024500	5026147	5401672		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012624.1|5024500_5026147_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 316
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5039538	5045391	5401672		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|5039538_5040429_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|5040453_5041419_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387752.1|5041423_5042929_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|5042936_5043356_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|5043522_5045391_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 317
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5048559	5049552	5401672		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|5048559_5049552_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 318
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5063331	5066693	5401672		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|5063331_5064702_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|5064863_5066693_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 319
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5072222	5076063	5401672		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|5072222_5073263_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|5073349_5074309_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|5074308_5075199_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|5075289_5076063_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
>prophage 320
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5087049	5088387	5401672		Moraxella_phage(100.0%)	1	NA	NA
WP_001345100.1|5087049_5088387_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	1.5e-62
>prophage 321
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5098585	5105954	5401672		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|5098585_5098843_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|5098806_5099166_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|5099182_5099323_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|5099552_5099633_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059105.1|5099929_5101333_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|5101337_5102438_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|5102437_5103511_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|5103539_5105954_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 322
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5110661	5111810	5401672		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|5110661_5111810_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 323
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5116237	5117191	5401672		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|5116237_5116651_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|5116762_5117191_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 324
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5123544	5132706	5401672		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|5123544_5125260_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|5125256_5126750_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|5126796_5127246_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|5127355_5127703_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|5127692_5128055_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|5128051_5128549_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|5128556_5129741_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|5130159_5130249_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|5130813_5130912_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|5131017_5132706_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 325
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5139844	5141179	5401672		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|5139844_5141179_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 326
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5153296	5154688	5401672		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|5153296_5154688_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 327
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5159809	5166560	5401672		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|5159809_5161918_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|5161936_5162212_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|5162266_5162890_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001426185.1|5163147_5164830_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	4.3e-22
WP_000924289.1|5164826_5165444_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001297374.1|5165735_5166560_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 328
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5169933	5174496	5401672		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|5169933_5170389_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050144.1|5170369_5171590_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	2.2e-44
WP_001369511.1|5171761_5172430_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|5172646_5172883_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|5172903_5173071_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|5173168_5173978_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|5174016_5174496_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 329
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5186427	5197168	5401672		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|5186427_5187360_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001307464.1|5187648_5188521_+	protein YibB	NA	NA	NA	NA	NA
WP_001214184.1|5188795_5189992_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	6.4e-36
WP_000646014.1|5190001_5191027_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|5191277_5192312_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483854.1|5192298_5193258_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|5193261_5194545_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|5194554_5196099_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|5196343_5196775_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|5196916_5197168_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 330
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5219312	5230784	5401672	tRNA,transposase	uncultured_Caudovirales_phage(50.0%)	8	NA	NA
WP_001346013.1|5219312_5220146_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
WP_000072850.1|5220298_5221141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097601822.1|5221161_5221590_-	protein rhsA	NA	NA	NA	NA	NA
WP_085948178.1|5221627_5222840_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_145985634.1|5222843_5226608_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	7.9e-24
WP_000779792.1|5226836_5227445_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000206271.1|5227542_5228934_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_097601923.1|5228930_5230784_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
>prophage 331
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5254962	5256504	5401672		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|5254962_5256504_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 332
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5261822	5262818	5401672		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|5261822_5262818_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 333
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5267042	5267255	5401672		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|5267042_5267255_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 334
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5270909	5273243	5401672		Escherichia_phage(100.0%)	1	NA	NA
WP_000013916.1|5270909_5273243_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 335
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5289161	5291146	5401672		Planktothrix_phage(100.0%)	2	NA	NA
WP_001196495.1|5289161_5290145_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000107031.1|5290141_5291146_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G9BWD6	Planktothrix_phage	33.7	1.1e-20
>prophage 336
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5337643	5338291	5401672		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|5337643_5338291_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 337
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5341525	5346617	5401672	transposase	uncultured_Caudovirales_phage(75.0%)	6	NA	NA
WP_085948178.1|5341525_5342739_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000100276.1|5342944_5343946_-	permease	NA	NA	NA	NA	NA
WP_001175589.1|5344052_5344349_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000065767.1|5344482_5344908_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	7.3e-51
WP_000922639.1|5344920_5346210_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|5346263_5346617_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 338
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5349731	5351774	5401672		Indivirus(100.0%)	1	NA	NA
WP_001344930.1|5349731_5351774_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.6e-45
>prophage 339
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5365379	5368115	5401672		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149135.1|5365379_5368115_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 340
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5371490	5377142	5401672		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_000015170.1|5371490_5375726_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	2.1e-25
WP_001190062.1|5375928_5376330_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173630.1|5376335_5377142_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
>prophage 341
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5385035	5389167	5401672		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|5385035_5385701_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130624.1|5385921_5386167_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106580.1|5386268_5388467_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000964718.1|5388540_5389167_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 342
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5392173	5394992	5401672		Planktothrix_phage(50.0%)	3	NA	NA
WP_000617723.1|5392173_5392842_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.0	6.1e-28
WP_001041999.1|5392834_5393893_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|5394137_5394992_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 343
NZ_CP027380	Escherichia coli strain 2013C-3250 chromosome, complete genome	5401672	5400725	5401493	5401672		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000082101.1|5400725_5401493_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 1
NZ_CP027382	Escherichia coli strain 2013C-3250 plasmid unnamed2	36491	2289	9280	36491	tail,holin	Escherichia_phage(83.33%)	6	NA	NA
WP_000156173.1|2289_2658_-	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	8.0e-38
WP_000526264.1|5197_5644_-	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_000457140.1|5643_5970_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_000904921.1|6075_6636_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	98.9	4.7e-98
WP_000972092.1|8286_8814_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
WP_106914163.1|8842_9280_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	92.4	4.2e-70
>prophage 2
NZ_CP027382	Escherichia coli strain 2013C-3250 plasmid unnamed2	36491	19384	34407	36491	tail	Escherichia_phage(100.0%)	19	NA	NA
WP_001025044.1|19384_20206_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.3	1.7e-157
WP_001077897.1|20595_21351_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_000021878.1|21732_22440_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_000187856.1|22455_23007_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	98.9	2.3e-97
WP_000012433.1|23061_23553_-	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_001112721.1|23561_24134_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	99.5	1.8e-100
WP_000801017.1|24201_24936_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_001033851.1|24980_26639_-|tail	tail sheath protein	tail	A0A222YWC8	Escherichia_phage	97.8	1.7e-305
WP_001396841.1|26706_26985_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	100.0	3.1e-42
WP_001038834.1|27132_28830_-	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	100.0	0.0e+00
WP_000331486.1|28988_29381_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.2	1.5e-66
WP_000020025.1|29397_29856_+	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
WP_000483458.1|30009_30501_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	100.0	1.2e-62
WP_032275528.1|30540_31344_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	98.1	7.9e-115
WP_001272821.1|31343_31628_-	alanine racemase	NA	A0A222YXW1	Escherichia_phage	83.0	4.0e-37
WP_001217887.1|31889_32846_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	2.2e-180
WP_000076909.1|32859_33198_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	99.1	2.6e-51
WP_000585022.1|33485_34127_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	99.5	6.3e-115
WP_000595051.1|34119_34407_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
>prophage 1
NZ_CP027383	Escherichia coli strain 2013C-3250 plasmid unnamed3	73784	2771	46328	73784	transposase,integrase	Escherichia_phage(33.33%)	41	39023:39037	54648:54662
WP_000844627.1|2771_3014_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000429836.1|4016_4451_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|4522_4873_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|4886_5162_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|5197_5620_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|5671_7366_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|7383_7746_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|7742_7979_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|7975_8683_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|8721_10026_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|10072_10777_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|10966_11782_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|11932_12637_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|12697_13534_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|13533_14337_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|14397_15213_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240537.1|15400_16372_-	replication protein C	NA	NA	NA	NA	NA
WP_001067855.1|17127_17832_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077944971.1|17868_18267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|18416_19277_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|19861_20566_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000517694.1|23914_24517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044162833.1|25168_25465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000222775.1|25723_26011_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.7e-19
WP_032144930.1|27208_28072_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000154143.1|29564_30230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176497.1|30496_31117_+	YqiJ family protein	NA	NA	NA	NA	NA
WP_000482663.1|31143_32838_+	flotillin family protein	NA	NA	NA	NA	NA
WP_001330559.1|32843_33161_+	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_024174020.1|33277_33613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170192.1|33769_34840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000539685.1|34844_35282_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001034998.1|35312_36932_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_001112926.1|38236_38689_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000886638.1|38773_40282_+	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
39023:39037	attL	CCGATACAGCAGAAA	NA	NA	NA	NA
WP_000670135.1|40283_41384_+	type II secretion protein F	NA	NA	NA	NA	NA
WP_001011156.1|41457_41994_+	cleavage protein	NA	NA	NA	NA	NA
WP_000870986.1|42047_42521_+	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	36.3	2.9e-08
WP_000478596.1|42539_43175_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001168072.1|43179_44544_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	K7P7Q7	Enterobacteria_phage	39.6	1.1e-23
WP_000486835.1|45158_46328_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	43.3	5.5e-48
54648:54662	attR	CCGATACAGCAGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP027385	Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence	118259	19369	48649	118259	integrase,transposase	Escherichia_phage(37.5%)	33	28985:29044	47009:48836
WP_001067855.1|19369_20074_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001294663.1|20458_20809_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|20822_21098_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|21133_21556_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|21607_23302_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|23319_23682_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|23678_23915_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000204520.1|23911_24619_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000935452.1|24657_25962_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|26008_26713_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|26834_27740_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
28985:29044	attL	CGAGTAGGCAGCCTGGCGGCTGCGGCTTGTCATGGCCTGAAATTACCGTTATAAAAACAG	NA	NA	NA	NA
WP_000091308.1|29072_29438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|29437_30625_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000376616.1|31264_31468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|31595_32435_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|32428_32776_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|32939_33731_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|33736_34027_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|34138_34636_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|34780_35794_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|36268_36973_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|37205_38066_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_106914168.1|38078_38441_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000091308.1|38522_38888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|40931_41123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|41128_41374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|41424_42561_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|42675_44046_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|44866_45727_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001398199.1|46116_46518_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|46450_46708_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000091308.1|47096_47462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|47461_48649_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
47009:48836	attR	CGAGTAGGCAGCCTGGCGGCTGCGGCTTGTCATGGCCTGAAATTACCGTTATAAAAACAGACAATATCATTGTCTTTCAGGTAGTTATATGTCCCGTTCAGCTAAACCCCGTAAACGAAAACCTGCCCCTCAAAGAAGCAAACTTCCCCGCTATGTCGTGAAGCTTCACGACGATGACTTCTTTGACGAAGAAGACGCAGAAGCTCTGCGCTTTGATAATTTTGACGATGCCGTTGAGTGCTGCGCAGACCTGAATATTCCCTTCTTTGTGGATGCCGGAAACAAAAAGCTGGTCTTCTGGTTTGTACGTGTTGATGACGAAGGGTATCCTGAAATAGCCCGCTGCACGGAGCGGGAGTTTGCGACCATTCTTGCCGGTATCAGCGCCGGCGGCATGTACTGCCCGGAGTGTGGCACGGTTCACTGGCCGGACGGAGTCCCCCCGCCCTTCTGATGCTTCCCCGTTTTGCCGACATTTTTCAGCAGGGAAACCGCTGGCTTAACTGGCTGGAGAAACAACCGGAAGGTTCAGTGCGTCCGGTAGTCATTGAGTCTGTGACAAAAATCATGGCCTGCGGGACCACGCTGATGGGGTACACACAGTGGTGCTGTTCATCTCCGGACTGCAGCCACATAAAAAAGATCTGCTTCCGGTGTAAAAGTCGCTCCTGCCCGCACTGCGGAGTGAAGGCTGGCGCACAGTGGATACAGTATCTGCTGAGTCTGGTTCCCGACTGTCCGTGGCAGCATATTGTGTTCACACTTCCCTGCCAGTACTGGTCCCTGGTGTTCCACAACCGGTGGTTACTGGCAGAGATGAGCCGCATTGCTGCGGATGTGATACAGGAAATCTGCCGCCAGGCAGATGTGGTGCCGGGGATATTCACGGTCATCCACACATGGGGACGTGACCAGCAGTGGCATCCGCACATTCACCTGTCGACAACGACCGGCGGCGTGACATCAGACCACACCTGGAAAAACCTTCATTTTTACGCCCGTAAGGTGATGAGTATGTGGCGTTACCGGATAACGCGGTTACTGTCACGGAAATATCCGGACCTGGTGATACCGGATGCGCTGGCAGCAGAAGGAAGCAGTAAACGGGACTGGAATCGCTTCCTGGACAGTCATTACCGGCGGGGCTGGAATGTCAACGTATCCCGGGTGATGGATAACGCCACACATGTGGCGGTGTACTTCGGCTCTTACCTGAAAAAACCGCCGGTGCCGATGAGCCGTCTGGAGCACTATGCTGGTCAGGATGAAATTGGTCTGCGTTACAACAGTCACCGGACAAAACGGGAAGAATACCTGGTGATGAGTGGTGATGAGTTTATGGAAAGGTTCTCCTGGCATGTGGCGGATAAGGGGTTCCGTATGGTGAGGTACTACGGTTTCCTGAGTCCGGTGAAGCGCCGGTTACTGGAAGATGTTGTGTACGTCATAACGGAGACGGTGAGAAAGACGGCGATGCAAATCAGGTGGAGAGGGATGTATCAGCGGTTACTGAAGGTTGACCCGCTGAAGTGCATCCTGTGCGGAGGTCAGATGCGTTTTACGGGGCTGAAGCGGGGCTACCGTCTGACAGAGCTGGTCCTGATGCATGAGCCACTGGCGCAACAGCGGGTGTGCGGCTGAGAGCCGCATCGGAGAAGTTGCGTCCATTTTCAGGGGAATGGGGTAAAAAACCATCAGTGATATGCAGTATCAATCGATAAGATCCATTTAATTGACGGCGGTGCACTCATGGCACGCAGGCAGTGTTGAATAAACATCCGTTTTTGGGTGTTTTTTTAATCTTTTTGGGATTTAAATTCCTATCGAT	NA	NA	NA	NA
