The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	1910177	1917317	5040163		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1910177_1910816_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1910812_1912075_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1912071_1912980_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1913175_1913943_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1913993_1914650_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272881.1|1914755_1917317_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	3.0e-30
>prophage 2
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	2496184	2610792	5040163	tail,holin,lysis,tRNA,head,integrase,capsid,terminase,portal	Enterobacteria_phage(42.42%)	114	2512967:2512987	2562534:2562554
WP_000968208.1|2496184_2496880_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|2496876_2497275_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_001264869.1|2497513_2498461_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|2498833_2498917_-	protein YohP	NA	NA	NA	NA	NA
WP_001078114.1|2499140_2500577_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079524.1|2500629_2501391_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|2501520_2502099_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|2502268_2502856_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001295432.1|2503029_2503962_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097369.1|2503999_2505715_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000871512.1|2505910_2508208_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001130307.1|2508418_2509336_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221820.1|2509342_2510500_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569327.1|2510492_2511419_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|2511423_2512155_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|2512135_2512243_-	protein YohO	NA	NA	NA	NA	NA
WP_042101647.1|2512302_2512989_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
2512967:2512987	attL	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000063646.1|2513024_2514311_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
WP_001193437.1|2514344_2514599_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001373430.1|2514790_2515162_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	4.7e-62
WP_000720075.1|2515202_2516030_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.9	4.8e-131
WP_032253186.1|2516399_2516972_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	70.7	1.0e-76
WP_000553978.1|2516977_2517160_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.1e-08
WP_000147360.1|2517357_2517558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387834.1|2517563_2518256_-	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.0e-38
WP_000800143.1|2518403_2519093_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
WP_000944728.1|2519249_2519483_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_001090267.1|2519564_2520272_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	81.6	3.8e-105
WP_040077782.1|2520291_2520471_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	86.4	1.7e-25
WP_024173711.1|2520448_2521312_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	82.5	8.8e-128
WP_000618002.1|2521308_2521533_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_000095568.1|2521529_2522456_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	93.2	2.5e-157
WP_000988196.1|2522466_2523345_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_000203853.1|2523341_2524742_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	4.1e-244
WP_001065352.1|2524738_2524996_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_001202274.1|2525048_2526038_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	2.0e-192
WP_001204795.1|2526055_2526448_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
WP_021293442.1|2526514_2527132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917741.1|2527366_2527564_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_000935527.1|2527714_2528773_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.6	1.9e-193
WP_001365055.1|2529155_2530115_+	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000738071.1|2530126_2530396_+	Shiga toxin Stx2 subunit B	NA	Q6DWN4	Enterobacteria_phage	98.9	1.6e-43
WP_021293268.1|2530693_2531017_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	98.1	1.0e-60
WP_106914255.1|2531260_2533225_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.1	1.7e-296
WP_000284490.1|2533719_2533935_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001041949.1|2533938_2534730_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_024199769.1|2534818_2535106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092876.1|2535240_2535774_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	6.9e-99
WP_001056888.1|2536048_2536621_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_000443009.1|2536620_2536770_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.6	6.7e-12
WP_032209690.1|2536772_2537210_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_106914256.1|2537412_2537943_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	98.3	1.6e-95
WP_001102148.1|2538617_2539166_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	1.0e-57
WP_096780415.1|2539095_2541066_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.4	3.1e-261
WP_000259002.1|2541049_2541256_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021293160.1|2541252_2542845_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	3.4e-186
WP_047082299.1|2542834_2544340_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	5.1e-99
WP_000256800.1|2544375_2544723_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522634.1|2544780_2545809_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.3e-114
WP_001373367.1|2545860_2546244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106914257.1|2546236_2546590_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	4.8e-40
WP_000974994.1|2546605_2547181_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_000683074.1|2547177_2547573_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_000235126.1|2547580_2548330_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_001299690.1|2548345_2548777_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_071532372.1|2548803_2549217_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	2.3e-41
WP_106914258.1|2549197_2551771_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.1	0.0e+00
WP_000847280.1|2551767_2552097_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_106901605.1|2552096_2552795_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	1.2e-132
WP_047091088.1|2552805_2553549_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	1.1e-147
WP_136757970.1|2553494_2554091_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	72.9	1.0e-79
WP_106914259.1|2555000_2558687_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	86.8	0.0e+00
WP_000078853.1|2558885_2559026_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_000438829.1|2560891_2561104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106914342.1|2561115_2561790_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.7	2.1e-113
WP_001217534.1|2562059_2562308_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	87.8	8.0e-34
WP_001295431.1|2562822_2564508_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
2562534:2562554	attR	CACGCGCGTAACGTGACAGGG	NA	NA	NA	NA
WP_000598641.1|2564504_2565224_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|2565270_2565741_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|2565781_2566243_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001326004.1|2566367_2568368_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001292774.1|2568364_2569501_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001294368.1|2569493_2571773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097473787.1|2571783_2572872_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636926.1|2574054_2574375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356801.1|2574435_2578068_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001215627.1|2578077_2581872_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001295427.1|2582012_2584046_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|2584177_2585287_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001307891.1|2585549_2585831_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|2586123_2586666_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|2586745_2587420_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945466.1|2587435_2589916_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405707.1|2589931_2590966_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|2591047_2591386_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134645.1|2591604_2592429_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|2592548_2592821_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195602.1|2593043_2593832_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822275.1|2593828_2594629_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001307284.1|2594693_2595512_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000434038.1|2595563_2596310_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011976.1|2596283_2597249_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846219.1|2597245_2598250_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.3e-13
WP_000858484.1|2598246_2599524_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|2599780_2600833_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001345895.1|2601140_2601995_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182904.1|2603294_2603747_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|2603777_2604062_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|2604065_2605421_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844200.1|2605467_2606508_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|2606607_2607387_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|2607468_2608368_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001352710.1|2608782_2609100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106914260.1|2609430_2610792_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	5.5e-217
>prophage 3
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	2690873	2726941	5040163	protease,coat,holin,lysis,integrase,terminase,portal	Enterobacteria_phage(64.29%)	58	2685086:2685101	2711186:2711201
2685086:2685101	attL	ATTTGTAATGAACTGG	NA	NA	NA	NA
WP_025404398.1|2690873_2692052_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.7	1.5e-231
WP_106914262.1|2692032_2692224_-	AlpA family transcriptional regulator	NA	A0A0P0ZBL0	Stx2-converting_phage	96.8	1.1e-30
WP_000545733.1|2692254_2692422_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_106914263.1|2692479_2693280_-	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	98.5	2.9e-157
WP_000026225.1|2693338_2693620_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	98.9	1.4e-50
WP_106914264.1|2693822_2694401_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	67.2	5.8e-75
WP_106914265.1|2694397_2695042_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	97.7	5.3e-130
WP_106914266.1|2695038_2695674_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	75.7	1.2e-78
WP_001214452.1|2695670_2695835_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_001111304.1|2695845_2696142_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_021538744.1|2696165_2696549_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	99.2	1.5e-66
WP_000031367.1|2696548_2697154_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	100.0	4.1e-108
WP_001243355.1|2697410_2697563_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|2697547_2697679_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_106914267.1|2697703_2698672_-	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_106914268.1|2698854_2699736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106914269.1|2699732_2700056_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	95.3	2.1e-50
WP_000618034.1|2700359_2700764_-	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
WP_000028392.1|2700760_2701393_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|2701496_2701712_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251073.1|2701831_2702125_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000166207.1|2702157_2702304_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_080189151.1|2702296_2703157_+	replication protein	NA	K7PL20	Enterobacteria_phage	99.0	2.8e-158
WP_106914270.1|2703264_2705145_+	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
WP_000796283.1|2705221_2705548_+	hypothetical protein	NA	I6RSP8	Salmonella_phage	99.1	9.5e-59
WP_063082836.1|2705761_2706202_+	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	99.3	2.2e-79
WP_021560741.1|2706198_2706789_+	hypothetical protein	NA	A0A193GYV6	Enterobacter_phage	76.0	3.3e-86
WP_000679700.1|2706785_2706959_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	91.2	3.9e-27
WP_000113772.1|2706925_2707102_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_021571395.1|2707104_2707464_+	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	94.1	1.0e-61
WP_000950962.1|2707463_2707640_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_021529413.1|2707632_2707902_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	98.9	1.6e-43
WP_000002244.1|2707901_2708192_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_106914271.1|2708188_2708551_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NRL7	Escherichia_phage	99.2	1.0e-61
WP_000994515.1|2708547_2708736_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001235459.1|2708732_2709356_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_106914343.1|2709496_2709679_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	93.2	2.9e-25
WP_000783734.1|2709789_2710113_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|2710096_2710573_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_106914273.1|2710569_2711037_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.8	1.2e-75
WP_001139680.1|2711024_2711177_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_106914274.1|2711379_2711898_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	98.8	3.6e-92
2711186:2711201	attR	CCAGTTCATTACAAAT	NA	NA	NA	NA
WP_000807788.1|2712192_2712435_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113732.1|2712437_2712878_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_088543483.1|2712874_2714290_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	2.6e-278
WP_106914275.1|2714291_2716490_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.6	0.0e+00
WP_000372575.1|2716580_2717474_+	scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	99.0	4.3e-130
WP_000013272.1|2717492_2718746_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	100.0	2.6e-237
WP_001389518.1|2718787_2718976_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_021538735.1|2718956_2719418_+	phage DNA stabilization protein	NA	A5VW70	Enterobacteria_phage	99.3	1.6e-83
WP_106914276.1|2719427_2720846_+	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	98.9	3.0e-274
WP_106914277.1|2720845_2721694_+	hypothetical protein	NA	Q716G6	Shigella_phage	90.8	1.9e-98
WP_023156188.1|2721693_2722149_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.7	2.6e-86
WP_077695480.1|2722169_2722844_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	92.4	1.4e-80
WP_106914278.1|2722853_2724260_+	acyltransferase	NA	I6RSG0	Salmonella_phage	55.8	2.4e-127
WP_106914279.1|2724259_2726104_+	DNA transfer protein	NA	A0A192Y934	Salmonella_phage	74.2	1.5e-246
WP_000749291.1|2726118_2726604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287055.1|2726674_2726941_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
>prophage 4
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	3022586	3085415	5040163	tail,holin,terminase,tRNA,head,integrase,transposase,capsid,plate,portal	Enterobacteria_phage(75.56%)	70	3044668:3044692	3082989:3083013
WP_000399652.1|3022586_3023567_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000077848.1|3023801_3026063_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
WP_001241561.1|3026245_3026509_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_000493141.1|3026797_3027154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010707.1|3027604_3028996_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_001295408.1|3029128_3029719_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000106834.1|3029881_3030550_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_000222172.1|3030696_3031233_+	membrane protein	NA	NA	NA	NA	NA
WP_000267654.1|3031273_3032134_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000146159.1|3032239_3032530_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000251735.1|3032630_3033560_-	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000771396.1|3033846_3034605_+	YdiY family protein	NA	NA	NA	NA	NA
WP_001144192.1|3037332_3039261_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|3039264_3039807_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|3039903_3040101_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3040153_3040510_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3040632_3040677_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|3040960_3041944_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672356.1|3041958_3044346_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|3044350_3044650_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
3044668:3044692	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|3044956_3045097_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488101.1|3045287_3045548_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024188892.1|3045697_3046201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132830.1|3046557_3047667_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_106914285.1|3047824_3049009_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	3.6e-225
WP_000290450.1|3049008_3049521_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665314.1|3049575_3049941_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000763327.1|3049976_3050105_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_106914286.1|3050091_3052899_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.5	0.0e+00
WP_000979946.1|3052911_3053400_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954202.1|3053556_3054129_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_106914287.1|3054172_3054751_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	5.9e-96
WP_106914288.1|3054759_3055662_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	67.7	1.9e-96
WP_106914289.1|3055658_3057617_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.7	4.9e-110
WP_000071720.1|3057619_3058150_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_106914290.1|3058142_3059039_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	2.3e-155
WP_000213445.1|3059042_3059393_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.7e-59
WP_001271890.1|3059389_3059971_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.4	2.0e-99
WP_000356339.1|3059967_3060603_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000921128.1|3060595_3061063_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	96.1	2.1e-83
WP_106914291.1|3061086_3062967_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	3.2e-300
WP_106914292.1|3063105_3063513_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.9e-64
WP_000072319.1|3063509_3063902_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	3.2e-69
WP_000104351.1|3063898_3064222_-|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	3.6e-50
WP_106914293.1|3064224_3064425_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	97.0	2.5e-30
WP_000063074.1|3064424_3064919_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_000632367.1|3065023_3065824_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	86.8	7.9e-123
WP_001055082.1|3065869_3066922_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	1.9e-188
WP_001262681.1|3066945_3067782_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
WP_072254074.1|3067936_3069688_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_106914294.1|3069687_3070734_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	1.3e-205
WP_106914295.1|3071227_3073453_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000502619.1|3073476_3074598_-	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_106914296.1|3074778_3077562_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.9	0.0e+00
WP_106914297.1|3077558_3077948_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_122985482.1|3077944_3078562_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000153712.1|3078784_3079051_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.0	4.4e-30
WP_000985156.1|3079047_3079251_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	4.2e-25
WP_000021661.1|3079337_3079451_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|3079447_3079690_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158971.1|3079701_3079989_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000917805.1|3079999_3080338_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	1.4e-52
WP_000163908.1|3080352_3080631_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|3080722_3081034_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_106914298.1|3081122_3082061_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	1.1e-80
WP_023144639.1|3082093_3082426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997174.1|3082533_3082863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956519.1|3083071_3084052_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
3082989:3083013	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154187.1|3084114_3084666_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|3084665_3085415_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 5
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	3204168	3283663	5040163	protease,tail,lysis,head,integrase,capsid,terminase,portal	Enterobacteria_phage(47.27%)	96	3204121:3204138	3214867:3214884
3204121:3204138	attL	CGGTGTAGTCACTGGTGT	NA	NA	NA	NA
WP_106914301.1|3204168_3205398_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	54.9	3.2e-131
WP_000953271.1|3205772_3205961_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000182306.1|3206204_3206408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201456.1|3206465_3206645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|3206839_3207037_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|3207029_3207242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551676.1|3207231_3207462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000549006.1|3207454_3207682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770161.1|3207687_3207987_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761789.1|3207983_3209732_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	7.3e-89
WP_000161635.1|3210078_3210330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126680.1|3210326_3210737_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000796963.1|3210974_3211181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907457.1|3211180_3212236_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.8	5.1e-69
WP_096988193.1|3212563_3212977_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_000835279.1|3213182_3213725_+|terminase	terminase	terminase	O64316	Escherichia_phage	46.0	9.3e-35
WP_000133435.1|3213980_3214262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001364204.1|3214492_3214651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|3215234_3215405_+	hypothetical protein	NA	NA	NA	NA	NA
3214867:3214884	attR	CGGTGTAGTCACTGGTGT	NA	NA	NA	NA
WP_000276149.1|3215511_3215877_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|3215863_3216193_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260842.1|3216231_3217053_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|3217152_3217236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|3217328_3217664_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091819.1|3218060_3219314_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|3219420_3220314_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|3220448_3221669_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|3221793_3222489_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000148710.1|3223891_3224506_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|3224548_3225403_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3225404_3226022_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|3226032_3228456_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041685.1|3228516_3230943_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
WP_001295396.1|3231141_3231447_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3231554_3232265_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3232267_3232828_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705214.1|3232862_3233204_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3233338_3233665_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3233870_3235085_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|3235096_3236116_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|3236173_3236284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876991.1|3236303_3237584_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001296941.1|3237618_3237855_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_106914303.1|3237942_3240414_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296931.1|3240507_3240699_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|3240695_3240884_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|3241370_3241946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3241947_3242103_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000381212.1|3242271_3242679_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000921596.1|3242759_3242987_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705346.1|3242970_3243492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054501.1|3243472_3244438_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_001774502.1|3244478_3244901_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	84.9	3.4e-61
WP_001774471.1|3245138_3246473_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	2.0e-06
WP_122083109.1|3247065_3247173_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000884073.1|3247217_3247430_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_000980999.1|3247646_3247898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309521.1|3247964_3248243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774470.1|3248244_3249294_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	5.7e-113
WP_001047131.1|3249307_3250060_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_000066485.1|3250734_3250950_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000839590.1|3251703_3251919_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_097746050.1|3251923_3252235_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	1.0e-25
WP_001092966.1|3252231_3252765_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|3252761_3253259_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|3253623_3253836_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|3253846_3254035_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|3254182_3254338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|3254510_3254684_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|3254979_3255186_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_000421825.1|3255736_3256276_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507029.1|3256284_3258384_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.0	0.0e+00
WP_001072975.1|3258380_3258593_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_053290587.1|3258592_3260101_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.0	6.1e-286
WP_097423632.1|3260045_3262073_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_053290589.1|3262159_3262483_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.9e-51
WP_001283152.1|3262475_3262751_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_000677112.1|3262762_3263341_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	99.5	9.4e-102
WP_023148639.1|3263337_3263739_+|tail	phage tail protein	tail	K7PJP5	Enterobacteria_phage	100.0	1.1e-72
WP_053290591.1|3263749_3264493_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	1.7e-132
WP_001372042.1|3264553_3264940_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_001161009.1|3264948_3265278_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372047.1|3265249_3268315_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.4	0.0e+00
WP_000447251.1|3268314_3268644_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_001152368.1|3268653_3269352_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_032160992.1|3269357_3270101_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	8.0e-146
WP_106914304.1|3269998_3270646_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_000515472.1|3270706_3274102_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.8	0.0e+00
WP_001233167.1|3274171_3274771_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	1.7e-109
WP_074168271.1|3274835_3278234_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_106914305.1|3278233_3278809_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	2.5e-102
WP_000086522.1|3278906_3279497_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|3279813_3280047_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|3280115_3280229_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347483.1|3280830_3282114_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527797.1|3282202_3283663_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
>prophage 6
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	3571936	3641053	5040163	protease,tail,holin,lysis,head,integrase,capsid,terminase	Escherichia_phage(33.33%)	75	3585718:3585742	3641193:3641217
WP_000422045.1|3571936_3572986_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559280.1|3573205_3573964_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_001278904.1|3573960_3574551_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291210.1|3574590_3575463_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|3575563_3576184_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|3576180_3577062_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3577199_3577244_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|3577335_3578898_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|3578897_3580493_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001297118.1|3580496_3581855_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|3581866_3583060_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|3583059_3583866_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3584246_3584426_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3584511_3585012_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|3585057_3585564_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3585718:3585742	attL	GTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000211405.1|3586210_3586771_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
WP_001049904.1|3587178_3587850_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.4	9.6e-106
WP_106914313.1|3587918_3589187_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.2	3.2e-54
WP_000078853.1|3589331_3589472_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106914314.1|3589670_3593357_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.7	0.0e+00
WP_000246330.1|3594266_3594911_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	73.9	3.9e-88
WP_050878055.1|3594808_3595552_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	3.7e-143
WP_001365876.1|3595562_3596261_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000738904.1|3596471_3597635_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_047083319.1|3598166_3601409_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.4	0.0e+00
WP_122993267.1|3601457_3601667_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710936.1|3601762_3602137_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_047083318.1|3602151_3602868_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	98.3	1.2e-125
WP_000133378.1|3602933_3603278_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	3.2e-57
WP_000573391.1|3603274_3603721_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3603717_3604068_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|3604077_3604404_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_016238136.1|3606930_3607152_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	1.7e-35
WP_047083315.1|3607196_3609134_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.2	0.0e+00
WP_047083314.1|3609197_3610859_-|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.6	0.0e+00
WP_000958387.1|3610855_3611419_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_047083313.1|3611708_3612074_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	5.1e-61
WP_000095744.1|3612115_3612316_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|3612447_3612774_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000881332.1|3613110_3613725_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	1.1e-63
WP_024210595.1|3613836_3614304_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	3.6e-67
WP_072024677.1|3614452_3614635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092875.1|3614791_3615325_-	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.1e-99
WP_001041949.1|3615836_3616628_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284490.1|3616631_3616847_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290208.1|3616924_3617170_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000143459.1|3617210_3617390_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_000874445.1|3617524_3619489_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.2	5.9e-297
WP_000382065.1|3621351_3622077_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000271629.1|3622773_3623202_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_032308170.1|3623681_3624740_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000917733.1|3624891_3625089_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000342738.1|3625262_3625976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064918.1|3626229_3626895_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000904136.1|3626887_3627250_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001265189.1|3627262_3628312_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_032347855.1|3628313_3628583_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.6e-11
WP_052327139.1|3628636_3628864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042395.1|3629452_3629770_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|3629872_3630085_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|3630299_3630851_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|3631202_3631388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096936637.1|3631447_3632209_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	61.9	2.9e-74
WP_047083545.1|3632238_3632979_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.3	1.2e-112
WP_047083544.1|3632985_3633987_-	phage O protein family	NA	U5P0A0	Shigella_phage	61.2	3.9e-55
WP_000705131.1|3633967_3634489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476991.1|3634472_3634700_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003380.1|3634777_3635185_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000380317.1|3635374_3635527_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001365839.1|3635538_3635907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|3636691_3636880_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|3636876_3637065_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_096936638.1|3637160_3639632_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	7.5e-55
WP_000113183.1|3639696_3639945_+	excisionase	NA	NA	NA	NA	NA
WP_024199680.1|3639922_3641053_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.7	1.8e-104
3641193:3641217	attR	GTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 7
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	3902516	3959425	5040163	protease,tail,holin,lysis,head,integrase,capsid,terminase	Escherichia_phage(42.11%)	68	3907190:3907249	3958500:3958561
WP_000003663.1|3902516_3903104_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3903100_3903808_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3903826_3905620_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3905616_3906735_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3907190:3907249	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_022581964.1|3907389_3907719_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_064506743.1|3907882_3908557_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	9.6e-114
WP_000438829.1|3908568_3908781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264410.1|3908790_3910503_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.0	1.2e-67
WP_000078853.1|3910647_3910788_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106914318.1|3910986_3914673_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.7	0.0e+00
WP_141068677.1|3915582_3916215_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	5.1e-101
WP_106914319.1|3916160_3916904_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	2.7e-149
WP_001499019.1|3916914_3917613_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_000343411.1|3917612_3917954_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_039264405.1|3917946_3921189_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.7	0.0e+00
WP_122993267.1|3921236_3921446_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710934.1|3921541_3921916_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_039264404.1|3921930_3922647_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	8.9e-126
WP_000133383.1|3922713_3923058_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573391.1|3923054_3923501_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001029274.1|3923497_3923848_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000125990.1|3923857_3924184_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|3926548_3926770_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|3926814_3928752_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_106914320.1|3928815_3930477_-|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.6	0.0e+00
WP_000958387.1|3930473_3931037_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000829191.1|3931326_3931692_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000095744.1|3931733_3931934_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|3932065_3932392_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_106914321.1|3932728_3933361_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	62.8	7.7e-57
WP_024210595.1|3933472_3933940_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	3.6e-67
WP_001280928.1|3933942_3934074_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	95.3	4.5e-12
WP_000661712.1|3934168_3934864_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001092873.1|3935137_3935671_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	92.1	1.3e-94
WP_159031397.1|3935801_3935999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064506983.1|3936183_3936975_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284506.1|3936978_3937194_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290214.1|3937271_3937517_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000143458.1|3937557_3937737_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_064506982.1|3937887_3939825_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.8	0.0e+00
WP_047090759.1|3940068_3940392_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	98.1	6.5e-60
WP_000738072.1|3940689_3940959_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_047090830.1|3940970_3941930_-	Shiga toxin Stx2a subunit A	NA	Q776Q3	Enterobacteria_phage	99.4	1.1e-174
WP_000483497.1|3942312_3943371_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|3943521_3943719_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_001204806.1|3943934_3944315_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_064506981.1|3944332_3945382_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.6e-115
WP_044527401.1|3945383_3945656_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	2.1e-11
WP_000967410.1|3945824_3946037_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_000206823.1|3946270_3946615_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	93.0	3.3e-54
WP_044527399.1|3947128_3947554_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	85.1	1.2e-16
WP_106914322.1|3947651_3948254_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	49.5	5.3e-39
WP_064506980.1|3948240_3948546_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	4.4e-50
WP_074398695.1|3948542_3948824_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.2	7.2e-31
WP_044527395.1|3948856_3949573_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	5.1e-73
WP_072130322.1|3949606_3950149_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_039264394.1|3950060_3951092_-	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	70.4	6.9e-87
WP_000693925.1|3951160_3951586_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000712070.1|3951569_3951893_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.4e-09
WP_000948456.1|3952017_3952494_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000380319.1|3952805_3952958_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_077632757.1|3953113_3953329_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	5.3e-10
WP_000450222.1|3954183_3954372_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|3954368_3954557_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_039264392.1|3954649_3957052_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.1	3.7e-176
WP_000273163.1|3957118_3957370_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001367167.1|3957338_3958358_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
WP_000375136.1|3958765_3959425_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3958500:3958561	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAA	NA	NA	NA	NA
>prophage 8
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	4404142	4470326	5040163	protease,tail,lysis,tRNA,head,integrase,transposase,capsid,terminase,portal	Enterobacteria_phage(49.02%)	71	4412623:4412669	4460119:4460165
WP_000420935.1|4404142_4405279_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383951.1|4405547_4407785_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662364.1|4407771_4410744_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224602.1|4410744_4411635_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|4411817_4412579_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4412623:4412669	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201826.1|4413091_4414045_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001391142.1|4415898_4416204_-|tail	caudovirales tail fiber assembly family protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_122985279.1|4416260_4416929_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|4417426_4417609_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|4417687_4418188_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|4418224_4418731_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488338.1|4418749_4419640_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_085452876.1|4419759_4420341_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	1.1e-102
WP_106914331.1|4420340_4423256_-	hypothetical protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_063119967.1|4423320_4423920_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	2.6e-110
WP_105453697.1|4423986_4427385_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.5	0.0e+00
WP_122992541.1|4427445_4428078_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	4.6e-94
WP_001152535.1|4428762_4429461_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.8e-131
WP_021520659.1|4429460_4429790_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_097746356.1|4429786_4432348_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.6	0.0e+00
WP_000459458.1|4432340_4432775_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_001445547.1|4433194_4433935_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.3	4.4e-128
WP_053903854.1|4433942_4434338_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	3.8e-70
WP_032171200.1|4434334_4434913_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	2.3e-79
WP_074494825.1|4434924_4435278_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_089592771.1|4435289_4435685_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	7.4e-58
WP_000063254.1|4435726_4436752_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001299443.1|4436807_4437140_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123287.1|4437149_4438469_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	4.0e-233
WP_063119960.1|4438449_4440051_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.6e-308
WP_000198149.1|4440047_4440254_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_063119959.1|4440250_4442176_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453611.1|4442150_4442696_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001300120.1|4443084_4443279_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|4443443_4443650_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298896.1|4443935_4444346_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738500.1|4444636_4444930_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|4445020_4445203_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|4445419_4445917_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|4445916_4446132_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|4446720_4447818_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|4448007_4448391_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001360050.1|4448408_4449398_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061438.1|4449405_4450215_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|4450234_4450624_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|4450620_4450947_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|4450943_4451597_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001300314.1|4451596_4452091_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	3.6e-86
WP_001356227.1|4452087_4453029_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001250269.1|4453018_4453198_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|4453373_4453931_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|4453974_4454175_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|4454265_4454940_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000559922.1|4455154_4455670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|4456140_4456503_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|4456568_4457393_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|4457520_4458057_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|4458047_4458410_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206813.1|4458409_4458715_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_012599996.1|4458630_4459086_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
WP_001298992.1|4458941_4460105_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805435.1|4460439_4461072_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4460119:4460165	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|4461074_4461590_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691049.1|4461600_4462608_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001345706.1|4462620_4465230_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988366.1|4465260_4465953_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|4466172_4466715_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|4467195_4468062_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|4468063_4468276_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143549.1|4468383_4468905_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|4468940_4470326_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 9
NZ_CP027342	Escherichia coli strain 2014C-4587 chromosome, complete genome	5040163	4772825	4834991	5040163	plate,protease,tRNA,transposase	Cronobacter_phage(12.5%)	52	NA	NA
WP_000611738.1|4772825_4773239_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_047081324.1|4773242_4775093_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|4775056_4776139_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_097473885.1|4776163_4777444_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4777440_4777965_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_097473884.1|4777967_4779299_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_097473883.1|4779303_4780065_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_097473882.1|4780073_4782812_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.1	2.5e-83
WP_000088863.1|4782808_4783552_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_097473881.1|4783556_4784969_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_097473880.1|4785047_4788512_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377959.1|4788522_4789875_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|4789898_4790381_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_077788309.1|4790597_4791338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|4791347_4791827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|4791963_4792749_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|4793284_4794016_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|4794080_4794548_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|4794544_4795267_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|4795300_4796056_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|4796127_4797486_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211726.1|4797533_4798304_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4798381_4799182_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648576.1|4799422_4800337_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997049.1|4800333_4801137_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_001140175.1|4806896_4807472_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4807659_4808691_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|4808683_4809337_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|4809376_4810192_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|4810309_4810714_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|4810710_4811418_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_097473899.1|4811528_4813247_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_097473900.1|4813300_4814125_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_004022510.1|4814327_4815308_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|4815557_4816268_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|4816281_4816704_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185293.1|4816700_4817246_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4817411_4817612_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4817598_4817859_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176573.1|4817907_4819206_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4819270_4819660_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021030.1|4819716_4821858_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4821956_4822916_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_106914337.1|4822928_4826411_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	6.3e-209
WP_000569430.1|4826447_4827044_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139659.1|4827040_4828189_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|4828188_4828977_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4828980_4829436_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|4829540_4830566_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4830569_4831055_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4831176_4833609_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4833638_4834991_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP027343	Escherichia coli strain 2014C-4587 plasmid unnamed, complete sequence	131410	37232	46206	131410	integrase	Cronobacter_phage(25.0%)	12	42571:42583	48168:48180
WP_000125552.1|37232_38933_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.4	1.1e-171
WP_032236829.1|39162_39468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106914347.1|39500_40427_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|40791_41040_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_000109074.1|41036_41474_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
WP_072122683.1|41473_42466_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	2.8e-101
WP_001365560.1|42495_42744_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.0	1.5e-19
42571:42583	attL	CCCCGTAAAAACA	NA	NA	NA	NA
WP_000340836.1|42748_43141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103695.1|43145_44117_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633912.1|44345_44990_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	1.9e-39
WP_000239527.1|44983_45259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016958.1|45396_46206_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
48168:48180	attR	CCCCGTAAAAACA	NA	NA	NA	NA
