The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	150937	204716	5438694	portal,lysis,transposase,head,protease,terminase,tail,holin,integrase	Enterobacteria_phage(46.48%)	75	145530:145546	193411:193427
145530:145546	attL	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_000533654.1|150937_152008_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|151985_152204_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|152310_152655_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|152683_152851_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|152923_153208_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|153200_153503_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|153499_154117_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_000034231.1|154118_154676_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|154672_155230_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|155226_155391_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|155401_155695_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|155718_156102_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|156101_156707_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_001243354.1|156963_157116_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|157100_157232_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001341800.1|157256_158117_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_032345386.1|158480_159020_+	hypothetical protein	NA	A0A192Y7Z0	Salmonella_phage	44.9	6.2e-39
WP_000088201.1|159043_159316_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000193240.1|159922_160285_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000428099.1|160553_161258_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000064150.1|161371_161605_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000438538.1|161743_162043_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_106913188.1|162075_162621_+	replication protein	NA	O48421	Enterobacteria_phage	96.2	1.2e-85
WP_000381416.1|162624_164196_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.2	1.5e-170
WP_000624618.1|164215_164563_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000993931.1|164562_165213_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	44.9	1.8e-16
WP_000788880.1|165722_166424_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|166420_166711_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|167007_167364_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|167335_167746_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|167742_167919_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|167921_168323_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001341811.1|168282_168492_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|168484_169207_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|169206_169497_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|169493_169856_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|169852_170041_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|170252_171212_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|171550_171673_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|171687_172377_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|172562_173306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|173391_173550_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000411802.1|176145_176352_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|176351_176849_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024219992.1|176845_177283_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	99.3	7.7e-72
WP_000881326.1|177432_178050_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|178237_178432_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|178827_179337_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_009442816.1|179308_181237_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|181220_181427_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001432013.1|181423_183016_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_001254029.1|183005_183182_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_000839179.1|183259_183664_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612622.1|183660_184008_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000099160.1|184056_185595_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|185591_185960_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_061330486.1|185967_186720_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	4.5e-128
WP_000479086.1|186733_187165_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_072164884.1|187191_187605_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_100787812.1|187585_190165_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000847298.1|190161_190491_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001152226.1|190490_191189_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	97.4	6.8e-131
WP_106913189.1|191199_191943_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.7	6.1e-146
WP_072141513.1|191888_192521_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_106913190.1|192767_196241_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.1	0.0e+00
193411:193427	attR	CGGCCATTGTGGGGCTG	NA	NA	NA	NA
WP_001230435.1|196308_196908_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	8.2e-109
WP_000279023.1|196972_198187_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|198188_198458_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|198563_199445_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001428038.1|199661_200495_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	9.3e-151
WP_021351651.1|200618_200990_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381372.1|201464_203036_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|203055_203403_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|203402_204080_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|204140_204716_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
>prophage 2
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	440853	483006	5438694	transposase,protease,terminase,tail,holin,integrase	Escherichia_phage(44.0%)	58	441715:441774	483083:483147
WP_000375138.1|440853_441513_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
441715:441774	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_001299351.1|441920_442940_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|442917_443160_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048499.1|443227_445678_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|445772_445961_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|445957_446146_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|446546_446711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|446714_446933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|447025_447226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|447639_447942_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|447944_448304_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|448350_448743_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|448869_449130_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|449126_449564_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|449650_450661_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|450572_451115_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|451148_451874_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|451889_452282_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|452278_452575_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|452571_453033_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|453010_453367_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|453417_453630_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|453663_453846_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|454011_454647_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|454734_454953_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_032345470.1|454954_455320_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	5.6e-68
WP_032345469.1|455316_455661_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.2e-57
WP_000220601.1|455865_456165_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|456170_456428_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|456563_456836_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_032345468.1|456837_457884_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|457896_458256_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|458264_458795_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|459037_459235_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|459369_460083_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|460532_460964_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_061301711.1|461441_463379_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143463.1|463514_463694_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|463734_463980_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|464057_464273_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|464277_464811_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|465085_465655_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|465654_465804_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|466031_466217_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|466742_467057_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|467138_467363_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_000279796.1|467404_467770_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958380.1|468062_468626_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|468622_470284_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_085949589.1|471452_472666_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_106913194.1|472707_475641_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.2	0.0e+00
WP_001230532.1|475707_476307_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_097454813.1|476371_477685_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	1.8e-76
WP_001339397.1|477740_478418_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|478417_478765_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001023483.1|480391_480661_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_032345351.1|481115_482477_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|482853_483006_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
483083:483147	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
>prophage 3
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	625419	706003	5438694	capsid,lysis,transposase,tRNA,head,protease,terminase,tail,holin,integrase	Enterobacteria_phage(30.36%)	94	653506:653565	705295:706060
WP_000074974.1|625419_626538_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|626506_626776_-	excisionase	NA	NA	NA	NA	NA
WP_000048520.1|626837_629309_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001090200.1|629401_629593_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|629589_629778_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|630340_630526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|630712_631102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|631243_631399_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|631675_631963_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|631962_632154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|632181_632583_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|632691_632964_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|632947_633373_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|633578_634034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|634112_635204_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788750.1|635210_635957_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000451007.1|635978_636749_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151233.1|636764_637178_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|637529_638303_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|638668_638806_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013636.1|638850_639063_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|639230_639509_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265140.1|639510_640560_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001217436.1|640572_640944_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|640933_641305_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265267.1|641456_642275_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|642561_642801_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_099368381.1|642895_643609_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874393.1|644376_646227_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_000411814.1|646674_646881_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|647136_647409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003120.1|647568_648102_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	3.6e-100
WP_032140280.1|648656_648743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001427182.1|648744_649239_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.4e-74
WP_000736096.1|649235_649460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|649828_650056_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001427183.1|650097_650463_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	9.9e-65
WP_000958380.1|650755_651319_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_103951664.1|651315_652977_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
653506:653565	attL	GGTAGTGCATCCAATTAGTAGAACATGTGTTTTTCGATAAACGCTCCGATCACTTTTTCG	NA	NA	NA	NA
WP_085949012.1|653519_654214_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_001063025.1|655796_656018_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125988.1|658545_658872_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|658881_659232_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|659228_659675_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|659671_660016_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275483.1|660081_660798_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.6	2.1e-127
WP_000710949.1|660812_661187_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|661282_661492_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212980.1|661539_664782_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.0	0.0e+00
WP_000807940.1|664774_665116_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001327694.1|665115_665814_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_045904127.1|665819_666563_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	3.6e-146
WP_133374445.1|666508_667141_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	94.7	1.8e-98
WP_106913197.1|667386_670863_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.3	0.0e+00
WP_106913259.1|670931_671555_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	5.6e-68
WP_001023435.1|672943_673213_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_001131642.1|673326_673902_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|674192_674774_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|674842_675478_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|675605_676664_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|676738_677389_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|677571_678162_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|678435_679299_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000359438.1|680669_681899_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|682044_683166_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085258.1|683414_684644_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000953272.1|685009_685198_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_032345527.1|685255_686284_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336167.1|686273_686738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204981.1|686730_686964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|686969_687269_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|687265_688666_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_032345515.1|689035_689344_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|689354_689627_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|689753_689978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|690229_690436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|690435_691491_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|691503_691839_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|691851_692265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001432354.1|692470_693013_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000133424.1|693268_693550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|694151_695612_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|695611_696283_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|696450_697821_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|697824_698466_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|698501_699608_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|699661_700123_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_106913198.1|700132_700786_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|700957_702208_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|702310_702634_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|703166_703277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|703329_703734_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|703954_704686_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_085949012.1|705308_706003_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
705295:706060	attR	GGTAGTGCATCCAATTAGTAGAACATGTGTTTTTCGATAAACGCTCCGATCACTTTTTCGTGGATCTCAACTGAGCGTGAGAAGCAGATTGTTTTACGAGCCAACCGCTTAATGCGGGTGCGTAGCGTCAGATTATTACGCTCAATGCGTTGGGTGAATATTTTGCCGGTCAGATGCTTATTCTTCGGCACCTCCCGGCCATAGCTGCCCCAGTCATCGCTGGTCAGCATGCCGATGTTGAAGGGTGTAAGCAGTGCCAGTAGCTCCCGGCACGTTTGATCGGTTCGGGGACCAAAAGTGTAGGCCAGTACACCGCCTGTTTTGGTGTTGTACGCGTACCAGAGCCAGTGTTGCCGGGCTTTACTGCCAACGTAGCTCCATTGCTCATCAAGCTCGCAGATAAGCGCCACATCAGCATGGGCAACAGGCGAAGACGTTATTCGCTTTGGCGCGAGTTTTTTAAAGTCCGGATGACGGTGTTAATACCAATTTTCAGTGTCCTGGCGGTATCGCGAACCCCGGCACCATTAAAGGCCATTTCAGTTATCAGCTCTTTCATACCCGGCTTACGTGCTTGATAAGTATAAGTGAGCTGAAACACACGGTGGCAGTCACGGCAGCGAAATCTGTCACGGCCTTTAGGGTTCTGACCATGGCGGTAAACCTGAGCTGACTGACAACGGGGACAATGAATATTAACGCTGGCCATGAGATAACCTCAAAAGCCCGTATTATACATCAGATTCAACTAATTAGAGGCATCACC	NA	NA	NA	NA
>prophage 4
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	804458	880684	5438694	capsid,transposase,head,protease,terminase,tail,holin,integrase	Stx2-converting_phage(40.0%)	79	804295:804322	866878:866905
804295:804322	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|804458_805589_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|805566_805815_-	excisionase	NA	NA	NA	NA	NA
WP_000048478.1|805879_808351_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|808446_808635_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|808631_808820_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|809219_809387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|809380_809614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|809591_809999_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|810021_810240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|810312_810612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|810876_811284_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|811360_811588_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|811571_812123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|813036_813579_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|814342_814507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|816243_816456_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|816675_816933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|817002_817281_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_032345232.1|817282_818338_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	3.7e-88
WP_000140002.1|818338_818704_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059382.1|818700_819390_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	5.3e-59
WP_000284522.1|822914_823130_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|823134_823479_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|823529_824063_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056806.1|824333_824903_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|824902_825049_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|825276_825483_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|825547_825772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|826128_826269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428130.1|826398_826584_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_061301785.1|826625_826991_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	7.8e-62
WP_000958380.1|827279_827843_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|827839_829501_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_000173079.1|829564_831502_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|831546_831768_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125990.1|834294_834621_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|834630_834981_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|834977_835424_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|835420_835765_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|835831_836548_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030063.1|836553_836928_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|837023_837233_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_106913201.1|837280_840523_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.7	0.0e+00
WP_000807964.1|840515_840857_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_099357755.1|840856_841555_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	8.1e-132
WP_000194723.1|841565_842309_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_050439450.1|842254_842887_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000839179.1|845757_846162_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|846158_846506_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000902073.1|848114_849164_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_106913202.1|849231_849831_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	2.9e-106
WP_099356655.1|849982_851296_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_000381372.1|851328_852900_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|852919_853267_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|853266_853944_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001023357.1|854004_854274_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_106409364.1|858219_858342_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|858448_859360_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|859425_859995_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|861162_861441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|861868_862015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|862151_862799_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|862982_863573_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|866335_866554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079509.1|867056_867563_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
866878:866905	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|867608_868109_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|868194_868374_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|868754_869561_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|869560_870754_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001342102.1|870765_872124_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000763511.1|872127_873723_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|873722_875285_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|875376_875421_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|875558_876440_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|876436_877057_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|877157_878030_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|878069_878660_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|878656_879415_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|879634_880684_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	957225	1060285	5438694	capsid,portal,tRNA,transposase,head,protease,terminase,tail,holin	Escherichia_phage(43.28%)	107	NA	NA
WP_000628065.1|957225_958458_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|958712_959696_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|960173_961547_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157377.1|961675_962611_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000079604.1|963899_964115_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001298826.1|964214_964403_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_021500490.1|964395_964590_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001004423.1|964653_965706_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.3	1.4e-116
WP_001519830.1|968946_969222_-	phage protein	NA	A0A0U2QW85	Escherichia_phage	92.3	4.9e-40
WP_001359121.1|969296_969467_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
WP_000560227.1|969466_969688_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_001133037.1|970257_970467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|970467_971106_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379546.1|971117_971270_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.3e-07
WP_000233319.1|971561_971981_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|972060_972315_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|972311_972734_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|972811_973600_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|973606_974353_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|974375_975137_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|975152_975575_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|975680_975893_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|975978_976143_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|976144_976408_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|976418_976580_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|976658_976904_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|977335_978487_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|978454_979444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|979443_980835_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|981334_981934_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|981933_982224_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|982220_982775_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|983335_983767_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_106904221.1|984337_986188_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|986635_986842_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731241.1|986846_987191_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|987241_987775_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|988045_988615_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|988614_988761_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|988983_989169_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|989694_990009_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|990090_990315_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000453587.1|990703_991249_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027330.1|991223_993149_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|993145_993352_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|993348_994950_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123254.1|994930_996250_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001365129.1|996259_996592_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|996647_997673_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000752994.1|998122_998476_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000683137.1|999061_999457_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000479051.1|1000230_1000653_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|1000679_1001093_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000847298.1|1003683_1004013_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_089577646.1|1004012_1004708_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	9.8e-130
WP_061330346.1|1004713_1005457_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	1.4e-145
WP_072141513.1|1005402_1006035_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.9	1.4e-98
WP_096071078.1|1006271_1009664_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.9	0.0e+00
WP_001230428.1|1009731_1010331_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000268926.1|1010395_1011709_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001023379.1|1011710_1011980_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000491545.1|1012120_1012996_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|1013220_1013871_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000812724.1|1014825_1015482_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|1015482_1015674_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1015778_1016015_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|1016132_1017572_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|1017651_1020285_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|1020253_1021537_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|1021666_1022164_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|1022260_1022959_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|1022978_1025027_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|1025218_1026100_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|1026145_1027519_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|1027695_1028487_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|1028629_1028869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1029027_1029171_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|1029245_1029533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|1030201_1030345_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|1030357_1030567_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001296134.1|1031539_1032106_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_032345543.1|1032534_1032993_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|1033047_1033899_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|1033911_1034712_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|1034774_1035746_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|1036208_1037765_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_032345539.1|1037768_1039367_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|1039497_1040862_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_032345537.1|1041045_1041624_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|1041627_1042989_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1043062_1043242_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|1043361_1043721_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1044083_1044428_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|1044559_1046470_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|1046527_1047223_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|1047262_1047844_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|1048048_1049734_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_001342154.1|1049815_1050931_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001287005.1|1050984_1051950_-	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_000067822.1|1052005_1053130_-	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_032345534.1|1053161_1054772_-	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000978494.1|1055022_1056108_-	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000457202.1|1057259_1057898_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000939317.1|1058070_1058430_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000513743.1|1058433_1058622_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000604932.1|1058637_1059069_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000826412.1|1059076_1060285_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
>prophage 6
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	1257805	1324830	5438694	capsid,portal,transposase,head,protease,terminase,tail,holin,integrase	Enterobacteria_phage(34.55%)	79	1249600:1249615	1289627:1289642
1249600:1249615	attL	GGCTTTACCCATCGTT	NA	NA	NA	NA
WP_001260840.1|1257805_1258627_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1258726_1258810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1258902_1259238_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1259634_1260888_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|1260994_1261888_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1262022_1263243_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_032345260.1|1263367_1264063_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|1264015_1265308_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1265466_1266081_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|1266123_1266978_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1266979_1267597_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|1267607_1270031_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_001307224.1|1272715_1273021_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1273128_1273839_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1273841_1274402_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1274436_1274778_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1274912_1275239_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1275444_1276659_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_032345258.1|1276670_1277690_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001171554.1|1277765_1278146_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001583081.1|1278142_1278490_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	5.3e-60
WP_000998048.1|1278539_1280078_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_072095801.1|1280197_1280308_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|1280327_1281623_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001368608.1|1281642_1281879_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048585.1|1281963_1284435_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
WP_001098307.1|1284528_1284720_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1284716_1284905_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1285472_1285682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1285682_1286321_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380321.1|1286332_1286485_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000379972.1|1286651_1287059_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000920571.1|1287142_1287373_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705368.1|1287356_1287878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|1287858_1288824_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790460.1|1288830_1289571_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000450895.1|1289600_1290362_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
1289627:1289642	attR	AACGATGGGTAAAGCC	NA	NA	NA	NA
WP_000215512.1|1290421_1290607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|1290958_1291510_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882662.1|1291724_1291937_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|1292039_1292357_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|1292349_1292721_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|1292944_1293172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817785.1|1293225_1293495_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001375683.1|1293496_1294546_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_001047111.1|1294559_1295312_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_032316733.1|1296039_1297890_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000411802.1|1298337_1298544_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000193281.1|1298548_1299100_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	2.3e-36
WP_106904156.1|1299172_1300385_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	1.9e-168
WP_000992045.1|1300732_1301266_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_000675931.1|1301486_1301600_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|1301821_1302007_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|1302534_1302849_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|1302930_1303155_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000453587.1|1303551_1304097_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_159031917.1|1304134_1305829_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_159031912.1|1305782_1305998_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	98.5	2.3e-29
WP_000198153.1|1305994_1306201_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|1306197_1307799_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123254.1|1307779_1309099_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001365129.1|1309108_1309441_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1309496_1310522_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_022581670.1|1310563_1310959_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000752994.1|1310970_1311324_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975099.1|1311335_1311914_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683137.1|1311910_1312306_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1312313_1313066_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479045.1|1313079_1313502_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1313528_1313942_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_106913205.1|1313922_1316535_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	90.5	0.0e+00
WP_000847298.1|1316531_1316861_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_060552858.1|1316860_1317559_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	3.1e-131
WP_000194723.1|1317569_1318313_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_129014765.1|1318258_1318891_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.0	1.7e-96
WP_106913206.1|1319137_1322614_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.4	0.0e+00
WP_032325332.1|1322680_1323280_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_106913207.1|1323344_1324559_+|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.3	6.2e-79
WP_001101700.1|1324560_1324830_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
>prophage 7
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	1468701	1580407	5438694	capsid,portal,lysis,transposase,head,terminase,tail,holin,integrase	Escherichia_phage(34.92%)	116	1484957:1484972	1579349:1579364
WP_061301788.1|1468701_1469910_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	2.0e-207
WP_001261013.1|1470436_1471105_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|1471407_1472001_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|1471997_1472990_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234051.1|1473113_1474094_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|1474088_1474625_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1474687_1474912_-	YdcH family protein	NA	NA	NA	NA	NA
WP_061301787.1|1475051_1476707_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013783.1|1476931_1478275_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|1478491_1479415_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098531.1|1479452_1481093_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1481491_1481641_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1481712_1481886_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|1482130_1482661_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048647.1|1482849_1483851_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115913.1|1483892_1485332_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
1484957:1484972	attL	TCTCGCCCTCGTAACG	NA	NA	NA	NA
WP_001027942.1|1485528_1486329_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139556.1|1486600_1490503_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048959.1|1490703_1491309_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|1491359_1492676_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431817.1|1492665_1494423_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|1494438_1495335_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|1495334_1495940_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_032345339.1|1496110_1498417_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|1498480_1499341_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123454.1|1499571_1500162_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|1500143_1501094_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|1501194_1502508_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206179.1|1502534_1503740_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|1503739_1504162_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|1504151_1505579_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|1505580_1506369_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|1506368_1507136_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|1507132_1508203_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|1508210_1508708_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|1508722_1509469_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1509477_1509765_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|1509776_1510706_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|1510990_1513036_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_032346749.1|1513283_1515557_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|1515614_1517114_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001067509.1|1517349_1518255_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001341369.1|1518426_1518753_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|1518760_1518946_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900974.1|1518942_1521582_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1521789_1522779_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|1522889_1523312_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1523308_1523575_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628170.1|1523848_1527373_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|1527739_1528873_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|1529013_1529448_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_122988840.1|1531484_1531562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101700.1|1531672_1531942_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
WP_106913215.1|1531943_1533257_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	1.5e-78
WP_001408020.1|1533321_1533945_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_106913216.1|1534013_1537490_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.5	0.0e+00
WP_129014765.1|1537736_1538369_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	91.0	1.7e-96
WP_000194723.1|1538314_1539058_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_060552858.1|1539068_1539767_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	3.1e-131
WP_000847298.1|1539766_1540096_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|1542685_1543099_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|1543125_1543548_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235101.1|1543561_1544314_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	3.2e-134
WP_000683137.1|1544321_1544717_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975099.1|1544713_1545292_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752994.1|1545303_1545657_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1545668_1546064_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1546105_1547131_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001295978.1|1547186_1547519_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|1547528_1548848_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_024026143.1|1548828_1550430_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000198153.1|1550426_1550633_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_159031912.1|1550629_1550845_-|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	98.5	2.3e-29
WP_159031917.1|1550798_1552493_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000453587.1|1552530_1553076_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001082545.1|1553517_1553985_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.3	2.9e-77
WP_000992167.1|1554283_1554817_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_047086596.1|1554867_1555212_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.1e-57
WP_000284518.1|1555216_1555432_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001339397.1|1555504_1556182_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1556181_1556529_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1556548_1558120_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_089577656.1|1558326_1559220_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001023445.1|1559345_1559615_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_000762928.1|1561514_1562336_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1562332_1562707_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|1562719_1563769_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1563770_1564043_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1564164_1564509_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1564628_1564841_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1565074_1565632_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1565633_1565852_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|1565979_1566291_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|1566283_1566511_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1566507_1566789_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|1566821_1567583_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|1568356_1569319_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|1569341_1569767_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1569763_1570066_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|1570163_1570535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1570555_1570747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050439653.1|1570748_1570988_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|1571313_1571466_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|1571886_1572108_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427414.1|1572107_1572278_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_001307773.1|1572351_1572627_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_032346644.1|1572725_1575377_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.7	0.0e+00
WP_000166317.1|1575369_1576179_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_050439817.1|1576235_1576430_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	3.8e-31
WP_001356607.1|1576422_1576611_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|1576717_1576999_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189091.1|1576964_1578041_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976492.1|1578433_1578775_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1578787_1579660_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
1579349:1579364	attR	CGTTACGAGGGCGAGA	NA	NA	NA	NA
WP_000204699.1|1579663_1580038_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1580176_1580407_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
>prophage 8
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	1771716	1779899	5438694	transposase	Stx2-converting_phage(100.0%)	7	NA	NA
WP_106913218.1|1771716_1773255_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	9.3e-298
WP_072278756.1|1773251_1773566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|1776209_1777781_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1777800_1778148_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1778147_1778825_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000612591.1|1779174_1779522_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1779518_1779899_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 9
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	1788942	1796669	5438694	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_000099160.1|1788942_1790481_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|1790529_1790877_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1790873_1791278_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000378676.1|1791276_1791708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|1791786_1792020_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001243195.1|1793009_1794788_+	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	29.2	3.1e-26
WP_000849582.1|1795401_1795887_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001186725.1|1795902_1796379_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|1796447_1796669_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 10
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	1830304	1836606	5438694		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100797.1|1830304_1830847_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
WP_000857547.1|1830851_1831730_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001023633.1|1831787_1832687_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000699427.1|1832686_1833772_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_000183038.1|1834143_1835037_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001116073.1|1835211_1836606_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
>prophage 11
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	1928046	1937487	5438694		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|1928046_1929183_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_032345200.1|1929179_1931180_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|1931304_1931766_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950404.1|1931805_1932276_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|1932322_1933042_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1933038_1934724_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1934945_1935677_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|1935736_1935844_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1935824_1936556_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|1936560_1937487_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 12
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	2006428	2120643	5438694	portal,transposase,head,protease,terminase,tail,holin,integrase	Enterobacteria_phage(29.82%)	103	2043646:2043664	2109174:2109192
WP_000101718.1|2006428_2007670_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|2008166_2008373_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000130015.1|2008521_2008695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201456.1|2008752_2008932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342316.1|2009674_2009917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|2009889_2010111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204968.1|2010112_2010346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2010351_2010651_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2010647_2012048_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|2012249_2012495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|2012625_2012820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2012823_2012985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|2013112_2013601_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000624042.1|2013763_2014687_+	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|2018065_2018713_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|2018747_2019800_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|2019796_2020354_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_032345429.1|2020350_2022294_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|2022290_2022770_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2022766_2022976_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2022972_2023710_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|2023751_2024414_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|2024410_2025028_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|2025046_2025649_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_001405442.1|2025658_2026108_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|2026104_2026968_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2026954_2027650_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2027656_2030143_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2030139_2030403_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|2030392_2030887_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001298786.1|2030995_2031160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849214.1|2031295_2031784_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|2031932_2033579_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422230.1|2033796_2035440_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2035515_2036166_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2036165_2037230_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2037303_2038359_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2038470_2039562_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|2040300_2042973_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2042989_2043640_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2043646:2043664	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876014.1|2043725_2046575_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2046849_2047626_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2047630_2049280_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|2049280_2053675_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|2054476_2055799_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_000381395.1|2056969_2058541_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2058560_2058908_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2058907_2059585_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_085949012.1|2059739_2060434_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_001023380.1|2060830_2061100_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_000279018.1|2061101_2062415_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001228241.1|2062479_2063079_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_159031914.1|2066675_2067308_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	6.1e-94
WP_000194778.1|2067244_2067988_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_001152619.1|2067993_2068692_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|2068691_2069021_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_099356650.1|2069017_2071579_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.8	0.0e+00
WP_000533403.1|2071559_2071973_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|2071999_2072431_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|2072444_2073197_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|2073204_2073600_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|2073596_2074172_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|2074186_2074540_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|2074532_2074907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|2074958_2075843_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|2075900_2076248_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|2076284_2077790_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|2077779_2079372_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|2079368_2079575_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_106913224.1|2080805_2081489_-|terminase	phage terminase large subunit family protein	terminase	K7P6G6	Enterobacteria_phage	70.4	9.5e-93
WP_000235436.1|2081460_2081970_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|2082364_2082559_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|2082918_2083212_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_000075153.1|2083700_2084198_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|2084197_2084413_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2084555_2084954_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2085034_2085193_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2085278_2086022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|2086275_2086899_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2086895_2087561_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2087557_2088160_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2088134_2088701_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|2089224_2091060_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|2091563_2091746_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_032345630.1|2091911_2092277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|2092276_2093464_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000533670.1|2093804_2094875_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215757.1|2094869_2095496_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2097330_2099958_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|2100104_2100827_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001427555.1|2100954_2104689_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_001075177.1|2105384_2107670_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|2107758_2108889_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|2108888_2109143_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|2109196_2109847_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
2109174:2109192	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_000612626.1|2111869_2112217_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2112213_2112618_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_032345245.1|2112770_2113847_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000948732.1|2113851_2115210_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000857257.1|2115482_2117111_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_001209922.1|2117100_2118360_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_001000358.1|2118356_2119547_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_000140570.1|2119740_2120643_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 13
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	2191095	2313296	5438694	bacteriocin,capsid,portal,transposase,tRNA,head,protease,terminase,tail,holin,integrase	Stx2-converting_phage(36.54%)	133	2266251:2266273	2294206:2294228
WP_001283576.1|2191095_2191908_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2191907_2192921_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|2192986_2194123_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|2194221_2195217_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|2195213_2196392_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2196675_2197896_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683823.1|2198054_2200061_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|2200181_2200460_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|2200493_2201042_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|2201041_2201851_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|2201850_2202675_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|2202678_2203764_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|2203798_2204731_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2204896_2205448_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001315753.1|2205520_2206372_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|2206373_2206913_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|2206909_2207398_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|2207394_2207904_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482751.1|2207919_2208672_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032345241.1|2208691_2211337_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|2211418_2211982_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_085949012.1|2212039_2212734_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_001195819.1|2213439_2213925_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_032345239.1|2214127_2216272_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|2216271_2217582_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|2217761_2218046_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|2218417_2219758_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937833.1|2220123_2221182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2221363_2222119_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000331702.1|2223568_2231920_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	100.0	0.0e+00
WP_000012437.1|2231989_2233255_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000540391.1|2233265_2233517_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455645.1|2233527_2233974_-	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000509019.1|2233976_2234630_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000035555.1|2234723_2235125_-	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_001135718.1|2235180_2235321_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	97.8	2.0e-18
WP_000835365.1|2235554_2236289_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q08J76	Stx2-converting_phage	100.0	5.7e-136
WP_001447645.1|2236379_2236997_-	hypothetical protein	NA	Q08J77	Stx2-converting_phage	100.0	8.8e-122
WP_001369201.1|2237002_2237284_-	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_000839179.1|2237476_2237881_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2237877_2238225_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|2238273_2239812_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001146318.1|2241025_2242651_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	100.0	0.0e+00
WP_000276175.1|2242973_2243201_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	100.0	1.2e-39
WP_000537687.1|2243213_2243759_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	100.0	6.8e-94
WP_100699673.1|2244580_2245737_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.0e-67
WP_000207915.1|2247119_2247770_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	100.0	7.8e-121
WP_000829199.1|2247769_2248333_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	98.9	3.5e-101
WP_001447720.1|2248316_2248778_-	hypothetical protein	NA	Q08J87	Stx2-converting_phage	100.0	6.6e-74
WP_001140444.1|2248827_2249217_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|2249271_2250486_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345014.1|2250509_2251517_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	100.0	1.8e-180
WP_000787036.1|2251674_2253819_-|portal	portal protein	portal	V5URY3	Shigella_phage	100.0	0.0e+00
WP_000143988.1|2253818_2255525_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_001086073.1|2255505_2256312_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000738505.1|2256720_2257014_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_012817863.1|2257104_2257290_-	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	100.0	2.2e-28
WP_001092858.1|2257807_2258341_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_021351773.1|2258383_2258788_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	84.3	3.7e-52
WP_000284516.1|2258904_2259120_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|2259196_2259469_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2259509_2259689_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106913227.1|2259826_2261764_-	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.2	0.0e+00
WP_000738068.1|2262249_2262519_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|2262530_2263490_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001304085.1|2263870_2264023_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_001204880.1|2264271_2264706_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000144764.1|2264698_2264893_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107963.1|2264889_2265495_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004009.1|2265494_2266217_-	DNA-binding protein	NA	A0A0P0ZBS6	Stx2-converting_phage	100.0	1.3e-129
2266251:2266273	attL	AAAAAACCCAGCCGAAGCTGGGT	NA	NA	NA	NA
WP_000290549.1|2266291_2266969_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	100.0	4.3e-130
WP_001254256.1|2267243_2267426_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|2267422_2267950_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|2267946_2268393_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|2268349_2268586_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|2268596_2268812_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001036036.1|2268897_2269167_-	hypothetical protein	NA	A0A0P0ZCF7	Stx2-converting_phage	100.0	4.9e-45
WP_001444365.1|2269167_2272074_-	replication protein P	NA	A0A0P0ZC72	Stx2-converting_phage	100.0	0.0e+00
WP_000062360.1|2272184_2272961_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	100.0	1.9e-137
WP_000438537.1|2273123_2273423_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_000064148.1|2273561_2273795_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000428098.1|2273908_2274613_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000885202.1|2274673_2275015_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_001221211.1|2275082_2275544_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|2275537_2276584_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001479835.1|2277213_2277597_+	hypothetical protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
WP_000167595.1|2277655_2278126_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001198861.1|2278316_2278481_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|2278449_2278593_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|2278668_2278965_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|2278970_2279756_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186866.1|2279752_2280433_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682304.1|2280429_2280612_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548528.1|2280584_2280776_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001447688.1|2280786_2281068_+	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000763383.1|2281166_2281388_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_032345492.1|2281384_2282332_+	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	99.7	1.0e-182
WP_001301469.1|2282333_2282840_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_032206820.1|2282799_2283015_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	97.2	8.7e-37
WP_032345493.1|2283016_2283235_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	98.6	5.0e-32
WP_000212746.1|2283236_2283524_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206752.1|2283527_2284151_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_032345494.1|2284244_2284973_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	99.6	1.0e-129
WP_024226604.1|2285296_2285920_+	antirepressor	NA	A0A0P0ZDY7	Stx2-converting_phage	95.2	1.0e-106
WP_032204557.1|2285962_2286130_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	98.2	1.8e-26
WP_106898674.1|2286996_2287155_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	98.1	1.1e-20
WP_000994801.1|2287190_2287559_+	DUF1627 domain-containing protein	NA	A0A0P0ZCA9	Stx2-converting_phage	100.0	8.8e-53
WP_000453637.1|2287637_2287820_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|2287803_2288973_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000958687.1|2289404_2290562_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
WP_000440209.1|2290806_2291949_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_032345496.1|2292019_2294146_-|tail	tailspike protein	tail	Q9AYY6	Salmonella_phage	92.7	3.3e-59
WP_001084297.1|2294268_2295204_-	hypothetical protein	NA	A0A2H4FRZ6	Salmonella_phage	88.7	1.6e-103
2294206:2294228	attR	AAAAAACCCAGCCGAAGCTGGGT	NA	NA	NA	NA
WP_001161120.1|2295272_2295434_-	Arc family DNA-binding protein	NA	B9UDL5	Salmonella_phage	94.3	3.8e-21
WP_000113457.1|2295527_2295767_+	Arc family DNA-binding protein	NA	I6R0M0	Salmonella_phage	76.6	5.9e-26
WP_024203682.1|2295766_2296114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024222613.1|2296106_2296607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000275950.1|2296687_2297008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868972.1|2297016_2299020_-	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.9	2.6e-98
WP_061301792.1|2299019_2300426_-	DNA transfer protein	NA	I6RSG0	Salmonella_phage	56.1	3.8e-128
WP_000964882.1|2300435_2301128_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000614047.1|2301130_2301586_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000785546.1|2301585_2302434_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_001122374.1|2302433_2303852_-	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000246750.1|2303860_2304343_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_000375639.1|2304317_2304503_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_001133481.1|2304545_2305817_-|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
WP_000426733.1|2305828_2306713_-	hypothetical protein	NA	Q716H1	Shigella_phage	99.0	4.0e-144
WP_000200776.1|2308853_2310266_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000179910.1|2310262_2310688_-	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000807788.1|2310767_2311010_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999682.1|2311113_2311485_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_106904156.1|2312082_2313296_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	1.9e-168
>prophage 14
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	2582603	2597503	5438694	integrase	Enterobacteria_phage(63.64%)	15	2582998:2583012	2608731:2608745
WP_001392502.1|2582603_2583791_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	1.5e-106
2582998:2583012	attL	GCTCGCTGGAAAAAG	NA	NA	NA	NA
WP_001696664.1|2583830_2584757_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001696665.1|2584753_2586148_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000446137.1|2586501_2587074_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	3.8e-95
WP_000638634.1|2587147_2587648_-	transactivation protein	NA	NA	NA	NA	NA
WP_032345358.1|2587644_2588379_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	1.1e-128
WP_050439664.1|2588931_2589198_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	7.0e-44
WP_032345359.1|2589194_2589794_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	5.1e-50
WP_001244669.1|2589786_2590074_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	1.5e-47
WP_001357995.1|2590066_2590522_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|2590657_2590978_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032345363.1|2590992_2593326_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
WP_001341819.1|2593998_2595228_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2595266_2595683_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214985.1|2595754_2597503_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
2608731:2608745	attR	GCTCGCTGGAAAAAG	NA	NA	NA	NA
>prophage 15
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	2672017	2679157	5438694		Escherichia_phage(83.33%)	6	NA	NA
WP_106913229.1|2672017_2674579_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
WP_001141347.1|2674684_2675341_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|2675391_2676159_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2676354_2677263_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2677259_2678522_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2678518_2679157_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 16
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	3057257	3124403	5438694	transposase,protease,tRNA	Stx2-converting_phage(33.33%)	61	NA	NA
WP_001264365.1|3057257_3058271_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3058508_3058724_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918826.1|3058834_3060580_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3060774_3062616_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3062694_3063201_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000772026.1|3064429_3064627_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001054228.1|3064646_3065135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854687.1|3065131_3065512_-	toxin	NA	NA	NA	NA	NA
WP_001443392.1|3065600_3065969_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692312.1|3066044_3066266_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_001186728.1|3066328_3066805_-	RadC family protein	NA	NA	NA	NA	NA
WP_001444656.1|3066820_3067294_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	1.5e-12
WP_000680587.1|3067387_3067633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100699673.1|3068451_3069607_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.0e-67
WP_000848829.1|3072349_3072760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348967.1|3072775_3073018_-	DNA polymerase III subunit gamma/tau	NA	NA	NA	NA	NA
WP_077252115.1|3073027_3073258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102649.1|3073588_3074659_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203527.1|3074655_3075561_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_032345170.1|3075557_3077954_-	dGTPase	NA	NA	NA	NA	NA
WP_032346681.1|3078171_3079044_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282124.1|3079374_3079557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053347.1|3080419_3081661_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|3082092_3082668_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3082736_3083315_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3083363_3084404_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3084426_3084882_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|3084904_3086062_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|3086061_3086643_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|3086965_3088024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|3088033_3089176_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3089168_3089942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3089943_3091023_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3091022_3091979_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_032345167.1|3091989_3093198_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3093215_3093683_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3093943_3094273_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|3094259_3094640_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000355324.1|3094682_3096224_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.6	1.5e-77
WP_001443493.1|3097606_3098278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|3099143_3099284_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_000803992.1|3099585_3099849_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000024297.1|3101844_3102204_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591998.1|3102296_3103916_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134819.1|3104140_3104416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424145.1|3105586_3105889_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|3105897_3106218_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065689.1|3106210_3107914_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966484.1|3107923_3108388_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|3108388_3109063_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|3109074_3109692_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001034023.1|3112346_3116438_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_000381395.1|3116761_3118333_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3118352_3118700_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3118699_3119377_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_106904176.1|3119516_3121130_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	6.1e-183
WP_000624722.1|3121160_3121511_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3121507_3121933_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001171554.1|3122090_3122471_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3122467_3122815_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997983.1|3122864_3124403_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
>prophage 17
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	4299260	4373554	5438694	transposase,integrase,tRNA	Stx2-converting_phage(57.14%)	59	4343520:4343534	4376301:4376315
WP_001295074.1|4299260_4300778_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856834.1|4301014_4302472_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
WP_001295383.1|4302530_4304678_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|4304757_4306092_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|4306457_4307996_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_071527582.1|4308744_4308894_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000491535.1|4309472_4310051_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	78.1	8.6e-79
WP_000821600.1|4310256_4311075_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000606968.1|4311221_4312367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001365456.1|4313574_4313946_+	type III secretion system LEE master regulator Ler	NA	NA	NA	NA	NA
WP_000628726.1|4313960_4314179_+	type III secretion system LEE co-chaperone EscE	NA	NA	NA	NA	NA
WP_000084152.1|4314191_4314506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000153999.1|4314502_4315102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000780744.1|4315088_4315742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299990.1|4315746_4316400_+	type III secretion system LEE export apparatus protein EscR	NA	NA	NA	NA	NA
WP_000447503.1|4316399_4316669_+	type III secretion system LEE export apparatus protein EscS	NA	NA	NA	NA	NA
WP_001002808.1|4316668_4317445_+	type III secretion system LEE export apparatus protein EscT	NA	NA	NA	NA	NA
WP_032345484.1|4318472_4318931_-	type III secretion system LEE muramidase EtgA	NA	NA	NA	NA	NA
WP_000605356.1|4319127_4319484_+	nucleoside transporter	NA	NA	NA	NA	NA
WP_000534969.1|4319558_4319972_+	type III secretion system LEE transcriptional regulator GrlA	NA	NA	NA	NA	NA
WP_000087469.1|4320357_4320813_-	type III secretion system LEE chaperone CesD	NA	NA	NA	NA	NA
WP_000723928.1|4320826_4322365_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
WP_001063688.1|4322364_4322820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233824.1|4322825_4323398_-	type III secretion system LEE inner membrane ring protein EscJ	NA	NA	NA	NA	NA
WP_001059795.1|4323399_4323777_-	EscI/YscI/HrpB family type III secretion system inner rod protein	NA	NA	NA	NA	NA
WP_032345482.1|4323860_4324163_-	type III secretion system protein SepZ	NA	NA	NA	NA	NA
WP_032345480.1|4324697_4326725_+	type III secretion system LEE export apparatus protein EscV	NA	NA	NA	NA	NA
WP_000599711.1|4326708_4328049_+	type III secretion system LEE ATPase EscN	NA	NA	NA	NA	NA
WP_001062953.1|4328108_4328429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001443671.1|4328421_4328838_+	DUF1106 domain-containing protein	NA	NA	NA	NA	NA
WP_001050796.1|4328800_4329718_+	type III secretion system protein SepQ	NA	NA	NA	NA	NA
WP_001360071.1|4329748_4330264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005230.1|4330482_4330842_-	Tir chaperone family protein	NA	NA	NA	NA	NA
WP_000492643.1|4331092_4331704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121330.1|4332150_4333767_+	type III secretion system LEE translocated intimin receptor Tir	NA	NA	NA	NA	NA
WP_000098786.1|4333899_4334370_+	type III secretion system LEE chaperone CesT	NA	NA	NA	NA	NA
WP_032345478.1|4334430_4337250_+	intimin	NA	NA	NA	NA	NA
WP_000953242.1|4337464_4338685_-	type III secretion system LEE inner membrane ring protein EscD	NA	NA	NA	NA	NA
WP_001273459.1|4338827_4339883_+	type III secretion system LEE gatekeeper SepL	NA	NA	NA	NA	NA
WP_000381555.1|4339940_4340519_+	type III secretion system LEE translocon filament protein EspA	NA	NA	NA	NA	NA
WP_000935768.1|4340531_4341674_+	YopB/SseC family type III secretion system translocon subunit	NA	NA	NA	NA	NA
WP_001092012.1|4341694_4342639_+	type III secretion system LEE translocon pore-forming subunit EspB	NA	NA	NA	NA	NA
WP_000228587.1|4342645_4343053_+	type III secretion system LEE chaperone CesD2	NA	NA	NA	NA	NA
WP_001053840.1|4343089_4343311_+	type III secretion system LEE needle major subunit EscF	NA	NA	NA	NA	NA
WP_000245867.1|4343316_4343595_+	EscG/YscG/SsaH family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
4343520:4343534	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_032345477.1|4343810_4344434_+	type III secretion system LEE effector EspF	NA	NA	NA	NA	NA
WP_000381372.1|4345247_4346819_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|4346838_4347186_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4347185_4347863_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_100699673.1|4348922_4350079_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.0e-67
WP_106913241.1|4350130_4350673_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_000998048.1|4350721_4352260_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001583081.1|4352309_4352657_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	5.3e-60
WP_001171554.1|4352653_4353034_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000609742.1|4363348_4364023_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953025.1|4364071_4365061_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
WP_001375513.1|4368983_4370603_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|4370599_4372171_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|4372288_4373554_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
4376301:4376315	attR	TATGGATGATGAGAC	NA	NA	NA	NA
>prophage 18
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	4472909	4543707	5438694	protease,integrase,tRNA,transposase	Stx2-converting_phage(40.0%)	61	4495490:4495505	4531937:4531952
WP_001162171.1|4472909_4474262_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000099160.1|4474566_4476105_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|4476153_4476501_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|4476497_4476902_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001106238.1|4477337_4477802_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|4477960_4480099_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001341327.1|4480492_4482148_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001297258.1|4482197_4483619_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181312.1|4483737_4484685_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4484869_4484923_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|4485063_4487760_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|4487966_4488353_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4488425_4488887_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4488899_4489835_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4489838_4489973_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|4490253_4490649_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500687.1|4490779_4491493_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|4491563_4492157_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|4492301_4492754_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_032345294.1|4492876_4494286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012897.1|4494549_4495563_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
4495490:4495505	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000002953.1|4495724_4496141_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|4496186_4496690_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000416407.1|4498132_4500988_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|4500987_4501431_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4501784_4503296_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|4503562_4504663_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4504662_4505745_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|4505863_4507366_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|4507495_4508515_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000772685.1|4508958_4510221_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000091133.1|4511442_4513029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|4513318_4513996_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4513995_4514343_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4514362_4515934_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|4516243_4516516_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|4516517_4517072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|4517068_4517821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032345556.1|4518735_4518996_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	66.2	1.3e-23
WP_032345558.1|4518992_4519541_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	63.9	2.9e-28
WP_001014979.1|4519540_4519765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|4519761_4520085_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|4520099_4522433_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|4523338_4524163_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4524211_4524784_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000177060.1|4526137_4526395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4526952_4527720_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4527720_4528677_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|4528673_4529672_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|4529668_4530571_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|4530615_4532940_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
4531937:4531952	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|4533026_4533980_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4533976_4534498_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|4536248_4536506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159031915.1|4537238_4538597_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000381416.1|4538807_4540379_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.2	1.5e-170
WP_000624618.1|4540398_4540746_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000993931.1|4540745_4541396_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	44.9	1.8e-16
WP_000998019.1|4541547_4542933_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|4542982_4543330_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|4543326_4543707_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 19
NZ_CP027331	Escherichia coli strain 2013C-3277 chromosome, complete genome	5438694	5294940	5370043	5438694	capsid,portal,lysis,transposase,tRNA,head,protease,tail,integrase	Enterobacteria_phage(55.74%)	82	5305102:5305148	5361515:5361561
WP_000912342.1|5294940_5296326_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|5296361_5296883_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|5296990_5297203_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|5297204_5298071_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|5298551_5299094_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|5299313_5300006_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_106913252.1|5300036_5302646_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|5302624_5303665_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|5303675_5304191_+	fimbria assembly protein	NA	NA	NA	NA	NA
5305102:5305148	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001171554.1|5305997_5306378_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5306374_5306722_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_106913253.1|5306771_5308331_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	5.5e-298
WP_106904156.1|5308333_5309547_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	1.9e-168
WP_072164889.1|5309656_5309980_-|integrase	integrase	integrase	A0A0M4R586	Salmonella_phage	78.5	5.9e-45
WP_000446905.1|5309943_5310315_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|5310286_5310565_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|5310612_5310831_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|5310929_5311211_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_032345550.1|5311221_5311413_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000149544.1|5311385_5311568_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|5311564_5312245_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_106913254.1|5312863_5314402_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_000612622.1|5314450_5314798_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000839179.1|5314794_5315199_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000995439.1|5315494_5315791_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|5315866_5316157_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|5316623_5316944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|5317079_5317343_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|5317424_5318114_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|5318218_5318449_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|5318518_5319058_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001342088.1|5319144_5320074_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_000788789.1|5320070_5320772_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|5320976_5321324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|5322076_5322685_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|5322984_5323401_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|5323379_5323781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|5323904_5324006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|5324002_5324458_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|5324457_5324628_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|5324620_5324911_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|5324907_5325270_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|5325266_5325407_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|5325492_5325876_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|5326064_5327147_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|5327735_5327951_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_061301746.1|5327950_5328448_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_001228695.1|5328664_5328847_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|5328937_5329231_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_157825797.1|5329438_5329606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|5329571_5330785_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001427981.1|5330902_5331097_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_099368336.1|5331485_5332031_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	4.4e-93
WP_000198149.1|5333928_5334135_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032257875.1|5334131_5335733_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	4.2e-309
WP_000381372.1|5336205_5337777_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000624622.1|5337796_5338144_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000088640.1|5338862_5339741_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_099368269.1|5340139_5341165_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	9.0e-188
WP_000158868.1|5341206_5341602_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|5341613_5341988_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000683110.1|5342552_5342948_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|5342955_5343696_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|5343711_5344134_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|5344115_5344550_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|5344542_5347104_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000847347.1|5347100_5347430_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152558.1|5347429_5348128_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	8.9e-131
WP_000090884.1|5348813_5349446_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_099373617.1|5349506_5352920_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_061330376.1|5352990_5353590_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	5.9e-107
WP_089577623.1|5353654_5356615_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885569.1|5356614_5357199_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|5357253_5357922_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|5357978_5358284_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_032345248.1|5358467_5359952_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|5360138_5361092_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_032345247.1|5361604_5362366_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
5361515:5361561	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|5362548_5363439_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_106913256.1|5366231_5366414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383941.1|5366400_5368638_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|5368906_5370043_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP027334	Escherichia coli strain 2013C-3277 plasmid unnamed3	181066	8906	155471	181066	transposase,protease,integrase	Stx2-converting_phage(52.27%)	112	8452:8511	72296:74126
8452:8511	attL	CTCGAGTAGGCAGCCTGGCGGCTGCGGCTTGTCATGGCCTGAAATTACCGTTATAAAAAC	NA	NA	NA	NA
WP_000937595.1|8906_10094_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032345630.1|10369_10735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|10734_11922_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032345630.1|12198_12564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|12563_13751_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032345404.1|14206_14794_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000578011.1|15093_15435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|15630_15912_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_032209716.1|15908_16178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032345402.1|17090_17948_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001370046.1|17940_18015_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083830.1|18250_18505_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766812.1|18745_19336_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001302200.1|19373_19583_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233850.1|19628_20090_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_032345400.1|20333_20546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000840464.1|20676_21237_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_032345399.1|21339_22200_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_032345398.1|22258_23005_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.5	1.1e-09
WP_061301763.1|23924_24548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032345632.1|24635_25091_+	DUF2569 family protein	NA	NA	NA	NA	NA
WP_000839950.1|26791_27307_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_106913265.1|27308_30359_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_072164929.1|30355_32476_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_001164190.1|34848_35631_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465041.1|35632_36046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|36606_36837_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|36833_37250_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_072279305.1|37411_37912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100699708.1|40507_41185_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_000624622.1|41184_41532_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_106904239.1|41551_43123_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.1	2.0e-170
WP_000612591.1|43295_43643_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_106904156.1|43886_45100_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	1.9e-168
WP_001299377.1|45162_45525_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	100.0	5.6e-36
WP_000624722.1|45521_45872_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000993931.1|47140_47791_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_000624618.1|47790_48138_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381416.1|48157_49729_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.2	1.5e-170
WP_077850519.1|50769_51768_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|51841_53563_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_064764374.1|53652_54759_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|54758_55580_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_106913266.1|57037_58251_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	6.5e-169
WP_159031919.1|66819_67311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106879220.1|69451_69505_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000937595.1|70712_71900_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032345630.1|71899_72265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032345409.1|73169_74132_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	3.1e-113
72296:74126	attR	GTTTTTATAACGGTAATTTCAGGCCATGACAAGCCGCAGCCGCCAGGCTGCCTACTCGAGCGAAAACCTACTGTACCGCCATCGAAACGGGCACATACAGGCAGAGTGGCCGTGAAAGAAAGCAATCAGCGATGGTGCTCTGACGGGTTCGAGTTCTGCTGTGATAACGGAGAGAGACTGCGTGTCACGTTCGCGCTGGACTGCTGTGATCGTGAGGCACTGCACTGGGCGGTGACTACCGGCGGCTTCAACAGTGAAACAGTACAGGACGTCATGCTGGGAGCGGTGGAACGCCGCTTCGGCAACGATCTTCCGTCGTCTCCAGTGGAGTGGCTGACGGATAATGGTTCATGCTACCGGGCTAATGAAACACGCCAGTTCGCCCGGATGTTGGGACTTGAACCGAAGAACACGGCGGTGCGGAGTCCGGAGAGTAACGGAATAGCAGAGAGCTTCGTGAAAACGATAAAGCGTGACTACATCAGTATCATGCCCAAACCAGACGGGTTAACGGCAGCAAAGAACCTTGCAGAGGCGTTCGAGCATTATAACGAATGGCATCCGCATAGTGCGCTGGGTTATCGCTCGCCACGGGAATATCTGCGGCAGTGGGCCAGTGATGGGTTAAGTGATAACAGGTGTCTGGAAATATAGGGGCAAATCCATAAGAGAAGATCAACGGGTGAAGAAAAAGTTCAAAAAATCGCTGCCGAGGAGGAAGGAAACTACCGGATTGAAAGAGTCCCCCCTAAAGCAGACTGACTGACATCACAAATCCCCGGGTGGGGATTTGTGTATAAGAGACAGTGCCTAGCTGGGGGTTCTGTGCACAAAAAGGATGCCATTTGGCATCCTGATATTAACCCGCCATACCCTATTCAGGCAGTTTTCTTAGAATGTTTTTTATAGCCTCATCGATTTCTAACTGCACCTCATTAGATATGCGGGAGAACTCATAAACAACAAGACGCTTTCTGGGGTCAGTCTTCTTTCTGGCAAATTGGTTACGATCAGAAAACTCTTTCAACTTCTCAGTTTCAACTGTTTTTACAGGCCGGTCTGTAAGCAATTTTCCTTCAGACCTGAAGACCGCCAGAATTTTGCTTTTCTCAATTGTTGGATAGTCAGGTAAAGCCATCAGTTTTTTGCGAACTCTATCCATAAACTCTTCCACTGACATTTTTTTGTTGGTTACCTTTTCAGACAGTTTCAACAAAAATTGATAGTCCGACAGCGAAATATCATTGATTACCGGAAATACAGAGATCATTTCATCCGGTACTGATGCCGCCTGAAATGCGCGTGTTACTTTTGCCGGAGAGATGCTTTCAGCCTGAGCGATCTCTTCTTTTGTCATACTTACCCCATAAGTAACTTCAAGGCGTTTTCCTAGTTCTCGGAGGCTATGCTCTCTGGCTGTCTGTATATCTTTTGCAAGTTGTCTCGCGTCGGCAATATCAATACTGTCTTTTGTAACCAGTATTTCGAATTTTACGTTGTTATAGATACAGGCAGCGCGACGACGCGTACCGTCTAATACTTCAATTCGTCCATCTACTTCCCGACCAATAGCCGGAAAAAATTGCTGAAGTTTAATCGTGCGAGTTATGTCACTAACTGACTCACGCGAAAGCATAGTCTGATCACGTCCATTAACAGATGCATCAACGAACGTTTTAGATTCTATATCTCCGCTTAATACAACCGTTTTAATGAATTTTGCTTGTTTCCCAGACTTAAGAGTAAACGTTTTGATCTCTCCGTCACCTTCAAGCATGCGAGCGAACTCTGAATTGCTATTGCCGAGAACTCGCCCTCGAGCTAAAACCTT	NA	NA	NA	NA
WP_000817635.1|74128_75334_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.6e-204
WP_001132895.1|76049_76301_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001270417.1|76297_76585_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	2.2e-19
WP_000993931.1|78313_78964_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	43.1	1.4e-16
WP_000624618.1|78963_79311_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
WP_000381416.1|79330_80902_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.2	1.5e-170
WP_001171554.1|83281_83662_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001312861.1|83952_84111_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001336239.1|84190_84379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032345718.1|84390_85110_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032345719.1|85106_85541_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_032345720.1|87353_87680_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	90.3	2.4e-25
WP_100699673.1|88022_89179_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.0e-67
WP_106904156.1|101690_102903_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.0	1.9e-168
WP_000466318.1|103034_103472_-	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	34.7	9.5e-14
WP_000833470.1|103496_103679_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_001481829.1|104236_104419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681608.1|104525_104792_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.4	8.9e-15
WP_000545937.1|105211_105490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132407.1|106039_106291_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000702245.1|106280_106541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000814381.1|106592_106817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000866036.1|106913_107123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427403.1|107163_107487_-	hypothetical protein	NA	A0A0F6WCW0	Sinorhizobium_phage	46.5	4.6e-13
WP_021500037.1|108016_108391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032345630.1|108750_109116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|109115_110303_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000839179.1|110540_110945_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|110941_111289_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|111337_112876_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032345689.1|115430_116048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032345688.1|116008_117214_+	conjugal transfer protein TraW	NA	NA	NA	NA	NA
WP_001204060.1|117210_117780_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_001597018.1|117852_120018_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_032345686.1|120088_120736_+	plasmid IncI1-type surface exclusion protein ExcA	NA	NA	NA	NA	NA
WP_085949012.1|121373_122067_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_040116980.1|122529_123153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040116981.1|123312_123816_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	32.7	5.3e-16
WP_032345671.1|124195_128095_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.7	6.5e-239
WP_001171554.1|128370_128751_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001583081.1|128747_129095_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	5.3e-60
WP_000381395.1|130809_132381_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|132400_132748_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|132747_133425_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000997721.1|133758_134121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000264906.1|134133_134325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029365223.1|134352_134664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106913268.1|137625_138039_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000937595.1|137989_139177_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032345662.1|139640_141944_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_000381335.1|142134_143706_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.3	2.0e-170
WP_000624622.1|143725_144073_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032327097.1|144072_144750_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_050439663.1|144742_145057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106913269.1|145132_146346_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
WP_047082780.1|146405_146594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097949.1|146691_147123_-	tolA family protein	NA	NA	NA	NA	NA
WP_032345612.1|147190_149902_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001291058.1|149913_150246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148285.1|152326_152578_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077791233.1|152608_152854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032345630.1|153918_154284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|154283_155471_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
