The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	54216	65675	5388260	transposase	Escherichia_phage(50.0%)	17	NA	NA
WP_000394552.1|54216_54624_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_085948186.1|54700_55857_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001171901.1|55913_56132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|56204_56504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|56768_57176_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|57252_57480_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705623.1|57463_58015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|57986_59027_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157830737.1|58938_59481_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|59514_60249_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_122368318.1|60245_60410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|61108_61867_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|62145_62358_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|62578_62836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|62905_63184_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001370670.1|63185_64178_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	47.3	7.3e-78
WP_085947772.1|64462_65675_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 2
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	170601	319924	5388260	integrase,protease,transposase,tail,tRNA,holin,capsid,portal,terminase,head	Escherichia_phage(40.16%)	168	202285:202299	286803:288068
WP_000628065.1|170601_171834_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|172088_173072_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|173346_173520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123758.1|173549_174923_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157421.1|175051_175987_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000040852.1|176038_177274_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|177275_177491_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|177569_177779_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|177771_177966_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000595429.1|178022_178832_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
WP_000102191.1|178824_181494_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	59.6	2.0e-194
WP_001427414.1|181574_181745_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560223.1|181744_181966_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001169149.1|182390_182543_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	57.4	2.1e-08
WP_001253182.1|182923_183388_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_071829568.1|183506_183767_+	transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	65.3	1.1e-20
WP_000702023.1|183750_184173_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000788989.1|185047_185794_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_001370676.1|185815_186577_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	2.0e-120
WP_001151266.1|186592_187009_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.2	1.6e-58
WP_001275735.1|187005_187479_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	2.9e-64
WP_001204666.1|187801_188380_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156213.1|188339_189437_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.7	9.5e-212
WP_085947598.1|189990_191153_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000813257.1|191255_191411_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	4.2e-17
WP_000119356.1|191622_191802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818166.1|191820_192306_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000940340.1|192767_193367_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000228018.1|193366_193657_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000640170.1|193653_194208_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_106875738.1|195749_197696_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.1	0.0e+00
WP_000142777.1|197832_198012_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|198052_198298_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|198374_198590_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|198594_199128_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|199398_199968_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|199967_200114_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|200341_200527_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348566.1|201042_201519_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.2	2.2e-80
WP_086260490.1|201515_202523_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	3.4e-200
202285:202299	attL	GGGAATATTTTCAGC	NA	NA	NA	NA
WP_000114064.1|202684_203923_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
202285:202299	attL	GGGAATATTTTCAGC	NA	NA	NA	NA
WP_000229066.1|203915_204140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038673.1|204199_204778_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	65.4	4.9e-58
WP_000201455.1|204898_205078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176648.1|205272_205470_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|205462_205687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551747.1|205679_206048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204082.1|206040_206274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|206470_206713_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|206709_208524_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|208811_209057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|209053_209476_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000860401.1|210133_212023_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
211388:211402	attR	GGGAATATTTTCAGC	NA	NA	NA	NA
WP_000133409.1|212280_212562_+	hypothetical protein	NA	NA	NA	NA	NA
211388:211402	attR	GGGAATATTTTCAGC	NA	NA	NA	NA
WP_001072975.1|214044_214257_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077633710.1|214184_215765_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	1.1e-288
WP_085948186.1|217625_218781_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_106875739.1|218809_219004_+	hypothetical protein	NA	A5LH30	Enterobacteria_phage	100.0	2.8e-26
WP_001097046.1|219090_219414_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283147.1|219406_219682_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677106.1|219693_220272_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001079398.1|220268_220670_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211089.1|220681_221425_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	4.0e-129
WP_001370402.1|221485_221872_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_001161009.1|221880_222210_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372036.1|222181_225247_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_000447255.1|225246_225576_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	8.6e-60
WP_001152409.1|225585_226284_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000140752.1|226289_227033_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.5e-147
WP_001399694.1|226930_227578_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_000515486.1|227638_231037_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_001230525.1|231103_231703_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	8.8e-111
WP_072004194.1|231767_234722_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	80.7	6.0e-67
WP_001370405.1|234721_235243_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	2.3e-91
WP_085948186.1|235299_236455_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_048258936.1|236448_236712_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.8	5.4e-12
WP_001206148.1|236731_238027_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_120795384.1|238677_238791_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|238859_239093_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086528.1|239409_239997_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	6.1e-24
WP_000102122.1|240268_242731_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
WP_000199475.1|242823_243012_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|243008_243197_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|243761_243971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|243971_244610_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|244621_244774_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|245066_245405_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|245796_246039_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|246022_246448_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262401.1|246516_247584_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	85.3	1.9e-84
WP_000139447.1|247576_248038_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|248071_248788_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|248820_249102_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|249098_249326_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|249318_249630_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|249757_249976_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104475.1|249977_250535_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.3	2.4e-33
WP_000935259.1|250768_250981_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|251100_251445_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|251566_251839_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_106875740.1|251840_252890_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.6e-110
WP_001217447.1|252902_253262_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|253270_253825_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917748.1|254049_254247_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	1.5e-27
WP_000301797.1|254381_255095_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|255545_255977_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000023191.1|256455_258306_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411802.1|258753_258960_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|258964_259309_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|259359_259893_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|260163_260733_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|260732_260879_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|261101_261287_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|261812_262127_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|262208_262433_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|262819_263365_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|263339_265265_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|265261_265468_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|265464_267066_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_032212710.1|267046_268366_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	2.6e-232
WP_001299443.1|268375_268708_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024025845.1|268763_269789_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_000158899.1|269830_270226_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|270237_270591_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000683137.1|271176_271572_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|271579_272332_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|272345_272768_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|272794_273208_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212711.1|273188_275801_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.9	0.0e+00
WP_000847298.1|275797_276127_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212713.1|276126_276825_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_032212700.1|276835_277579_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_136865629.1|277524_278154_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	4.4e-105
WP_106875741.1|278385_281859_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.0	0.0e+00
WP_001230471.1|281926_282526_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_032212629.1|282590_283904_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001023356.1|283905_284175_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_122988840.1|284285_284363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|284577_285591_+	peptidase M85	NA	NA	NA	NA	NA
WP_085948186.1|285639_286796_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001295593.1|287650_288085_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837940.1|288225_289359_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	59.1	6.3e-118
WP_000628168.1|289724_293249_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|293522_293789_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001295716.1|293785_294208_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|294318_295308_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_000900919.1|295515_298155_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698141.1|298151_298337_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001296730.1|298344_298671_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067509.1|298842_299748_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138618.1|299983_301483_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000535469.1|301540_303814_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186507.1|304061_306107_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191073.1|306391_307321_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|307332_307620_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072831.1|307628_308375_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189197.1|308389_308887_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206362.1|308894_309965_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292357.1|309961_310729_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969780.1|310728_311517_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973382.1|311518_312946_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018416.1|312935_313358_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206188.1|313357_314563_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632286.1|314589_315903_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039890.1|316003_316954_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123454.1|316935_317526_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000097838.1|317757_318618_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_085948186.1|318767_319924_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 3
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	476577	556310	5388260	protease,transposase,tail,holin,portal,terminase	Enterobacteria_phage(36.73%)	85	NA	NA
WP_085948186.1|476577_477734_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001022785.1|478846_480520_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|480575_480887_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001370581.1|480914_482237_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|482351_482663_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|482861_483560_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|483604_484504_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054189.1|484698_485886_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|486012_486108_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592837.1|486326_487217_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_000671731.1|487471_487864_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024746.1|488139_488658_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001370614.1|488701_490747_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|490883_491630_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|491718_492405_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|492582_492786_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000347482.1|494371_495655_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|495714_496029_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_122993102.1|496399_497413_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|497627_497705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023386.1|497815_498085_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_032212694.1|498086_499400_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	5.3e-76
WP_001230496.1|499464_500064_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_032212772.1|500130_503607_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.1	0.0e+00
WP_077696211.1|503834_504470_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_001370115.1|504415_505159_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_106875745.1|505164_505863_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847401.1|505862_506192_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_032212771.1|506188_508801_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000533440.1|508781_509195_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|509221_509644_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|509657_510410_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000682719.1|510417_510816_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	2.9e-70
WP_000974955.1|510828_511452_-	hypothetical protein	NA	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_001281345.1|511454_511736_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
WP_024025855.1|511728_512055_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	2.3e-49
WP_001114424.1|512142_514167_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974578.1|514111_515614_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	99.4	4.5e-289
WP_000102415.1|515613_515826_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_106875746.1|515822_517931_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	86.4	0.0e+00
WP_000421825.1|517939_518479_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031431.1|519031_519238_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|519538_519949_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019140.1|520100_520274_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|520445_520601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|520680_520746_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|520748_520937_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|520947_521160_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|521521_522019_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|522015_522549_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_024025755.1|522861_523077_-|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	5.5e-31
WP_000066485.1|523830_524046_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	7.7e-25
WP_000087756.1|524346_524559_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|524613_524703_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000203370.1|525329_525515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047121.1|526675_527428_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	96.8	2.1e-133
WP_001265275.1|527441_528491_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
WP_012775982.1|528492_528771_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_096910863.1|529043_530256_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_001296941.1|531530_531767_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000997984.1|531924_533463_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_000612591.1|533512_533860_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001066422.1|534041_535598_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|535617_535965_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|535961_536636_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000836078.1|536877_537444_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	30.2	1.5e-11
WP_001370501.1|537455_538670_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|538875_539202_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_000705196.1|539336_539678_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|539712_540273_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_024025734.1|540275_540986_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|541093_541399_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041709.1|541597_544024_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.0e-214
WP_024025733.1|544084_546508_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	2.9e-205
WP_000213028.1|546518_547136_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|547137_547992_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|548034_548649_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_001315626.1|548807_550100_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|550052_550748_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225276.1|550872_552093_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019555.1|552227_553121_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|553227_554481_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743951.1|554877_555213_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|555305_555389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260840.1|555488_556310_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	843179	913556	5388260	integrase,transposase,tail,tRNA,holin,capsid,portal,plate,terminase,head	Enterobacteria_phage(66.67%)	83	879255:879314	914499:914622
WP_001025305.1|843179_844913_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	5.7e-86
WP_001341423.1|845093_845768_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|845764_846112_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|846131_847688_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_001171554.1|847836_848217_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|848213_848561_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997984.1|848610_850149_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.0e-296
WP_001370468.1|850256_850745_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|850864_851257_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|851256_853335_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278912.1|853327_854476_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983611.1|854677_855322_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763874.1|855332_855722_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	34.6	1.0e-06
WP_000036378.1|855736_856786_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|856788_857649_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483246.1|857667_859269_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.2e-15
WP_001370571.1|859314_860976_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	7.6e-11
WP_000147302.1|861120_861624_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001355823.1|861644_863609_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|863613_864540_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906322.1|864536_865424_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|865550_866129_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|866131_866482_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|867261_867690_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001370485.1|867696_869121_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|869095_869896_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|870062_871049_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187811.1|871063_872578_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|872647_873637_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|874433_874937_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|875015_875267_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|875381_875468_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237866.1|875730_876054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|876224_876722_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|876759_876999_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|877189_878401_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|878462_879128_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
879255:879314	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|879484_880486_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865386.1|880491_880839_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000786769.1|881534_881939_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|882028_882166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|882237_882441_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|882462_882813_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159467.1|882823_883102_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	5.3e-34
WP_000514274.1|883113_883356_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000021655.1|883352_883466_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_029594336.1|883580_883976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985144.1|883999_884203_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000153711.1|884199_884466_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000108347.1|884462_884762_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.9	9.0e-40
WP_122985482.1|884773_885391_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564228.1|885387_885777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000686474.1|888691_889651_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	6.4e-180
WP_000211270.1|889655_889967_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	4.2e-48
WP_001289970.1|890030_890414_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	9.8e-31
WP_000711111.1|890505_891036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087807.1|891565_892612_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	6.3e-205
WP_000613773.1|892611_894363_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262656.1|894517_895354_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.6	1.5e-148
WP_001055112.1|895377_896430_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_000632364.1|896475_897276_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	97.4	3.3e-137
WP_000063078.1|897378_897873_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	2.3e-88
WP_000864901.1|897872_898073_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104342.1|898075_898399_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	100.0	4.2e-51
WP_000072327.1|898395_898788_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|898784_899192_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920594.1|899329_899797_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000356316.1|899789_900425_+|tail	tail protein	tail	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_001271900.1|900421_901003_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.4e-100
WP_000213447.1|900999_901350_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111920.1|901353_902250_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_000071720.1|902242_902773_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_000108489.1|902775_904776_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.6	4.6e-111
WP_000885638.1|904775_905393_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	80.9	1.0e-85
WP_001447286.1|905356_905902_-	transferase	NA	NA	NA	NA	NA
WP_000853431.1|906580_909388_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_000333494.1|909374_909530_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665308.1|909538_909904_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|909958_910471_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005425.1|910470_911655_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000132830.1|911812_912922_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488108.1|912964_913225_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|913415_913556_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
914499:914622	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 5
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	1060253	1068543	5388260		Moumouvirus(14.29%)	7	NA	NA
WP_000414659.1|1060253_1061357_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	32.1	2.7e-28
WP_086163603.1|1061356_1062256_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.7	1.8e-107
WP_000697837.1|1062222_1063311_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.3	2.5e-95
WP_000875590.1|1063313_1064342_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	E3T4Y8	Cafeteria_roenbergensis_virus	45.1	4.5e-70
WP_000009507.1|1064378_1065659_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A0A218MKK1	uncultured_virus	24.7	2.1e-08
WP_000183035.1|1066080_1066974_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001115962.1|1067148_1068543_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 6
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	1160340	1169782	5388260		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001370574.1|1160340_1161477_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001370558.1|1161473_1163474_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|1163598_1164060_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001370504.1|1164100_1164571_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_000598641.1|1164617_1165337_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1165333_1167019_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1167240_1167972_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1168031_1168139_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1168119_1168851_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|1168855_1169782_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 7
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	1411103	1479557	5388260	protease,integrase,transposase,tail,holin,capsid	Escherichia_phage(58.33%)	84	1412111:1412135	1479752:1479776
WP_000368131.1|1411103_1412036_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1412111:1412135	attL	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000885695.1|1412258_1420634_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	97.0	0.0e+00
WP_001370495.1|1420702_1421695_-	hypothetical protein	NA	A0A2L1IV65	Escherichia_phage	90.0	3.3e-163
WP_085948186.1|1421767_1422924_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000540396.1|1423245_1423497_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	97.4	5.1e-12
WP_000455646.1|1423506_1423953_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	97.3	1.3e-74
WP_000509480.1|1423955_1424609_-	hypothetical protein	NA	Q08J74	Stx2-converting_phage	96.8	1.1e-109
WP_000035554.1|1424702_1425104_-	hypothetical protein	NA	A0A2L1IV61	Escherichia_phage	97.0	3.9e-70
WP_000682942.1|1425533_1426256_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	76.7	9.0e-102
WP_001399382.1|1426402_1426960_-	hypothetical protein	NA	Q08J77	Stx2-converting_phage	98.9	5.5e-107
WP_001369201.1|1426965_1427247_-	hypothetical protein	NA	Q08J78	Stx2-converting_phage	100.0	3.1e-50
WP_000162956.1|1427261_1428530_-	host specificity protein J	NA	Q08J79	Stx2-converting_phage	100.0	9.9e-221
WP_001146329.1|1428526_1430152_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	99.8	0.0e+00
WP_001370566.1|1430455_1430635_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	2.8e-28
WP_001023433.1|1430772_1431042_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_000117996.1|1431043_1432882_-|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_000207919.1|1432878_1433529_-	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	99.5	3.9e-120
WP_000829203.1|1433528_1434092_-	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	99.5	7.0e-102
WP_001370499.1|1434075_1434537_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	94.8	3.3e-73
WP_001140444.1|1434587_1434977_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214470.1|1435031_1436246_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.5	1.1e-232
WP_000345010.1|1436269_1437277_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000787524.1|1437434_1439579_-	hypothetical protein	NA	A0A2R2Z346	Escherichia_phage	99.9	0.0e+00
WP_000143998.1|1439578_1441285_-	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	99.1	0.0e+00
WP_001086087.1|1441265_1442072_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	99.3	1.1e-132
WP_001109019.1|1443676_1444228_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_012816791.1|1444455_1444641_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000455406.1|1444868_1445018_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056887.1|1445017_1445587_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	2.6e-104
WP_000087714.1|1445861_1446395_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_000284510.1|1446399_1446615_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290216.1|1446691_1446964_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	3.1e-23
WP_000143462.1|1447004_1447184_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_000874429.1|1447319_1449257_-	SASA family carbohydrate esterase	NA	G9L6J1	Escherichia_phage	99.7	0.0e+00
WP_000738068.1|1449743_1450013_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|1450024_1450984_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|1451366_1451519_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204859.1|1451767_1452202_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|1452194_1452389_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001108009.1|1452385_1452991_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	98.0	2.4e-95
WP_001004008.1|1452990_1453713_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_000178727.1|1453787_1454462_-	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.8	6.2e-113
WP_000201604.1|1454727_1455093_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	96.7	3.7e-43
WP_001254258.1|1455349_1455544_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000153293.1|1455540_1456068_-	phage N-6-adenine-methyltransferase	NA	G9L688	Escherichia_phage	100.0	9.5e-101
WP_000573864.1|1456064_1456667_-	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_001229012.1|1456659_1457076_-	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000103680.1|1457249_1457465_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_000818843.1|1457609_1457816_-	hypothetical protein	NA	G9L683	Escherichia_phage	100.0	2.7e-27
WP_001036028.1|1457888_1458158_-	hypothetical protein	NA	G9L682	Escherichia_phage	100.0	2.9e-45
WP_001248397.1|1458154_1460548_-	DNA helicase	NA	G9L681	Escherichia_phage	99.7	0.0e+00
WP_000431329.1|1460544_1461432_-	hypothetical protein	NA	G9L680	Escherichia_phage	99.7	2.8e-145
WP_001244621.1|1461494_1461767_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000438537.1|1461789_1462089_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	100.0	1.3e-49
WP_001180318.1|1462195_1462423_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250472.1|1462501_1463209_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	99.6	1.5e-133
WP_000885926.1|1463269_1463611_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001189994.1|1463797_1464616_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001370067.1|1465064_1465406_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_096910863.1|1465566_1466780_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_157910050.1|1466817_1467354_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	94.8	1.1e-88
WP_000065353.1|1467534_1467903_+	DUF2528 family protein	NA	A0A1U9AJB3	Stx1_converting_phage	99.2	2.6e-65
WP_001198858.1|1467975_1468116_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361831.1|1468108_1468222_+	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_000613346.1|1468218_1468407_+	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000536228.1|1468415_1469096_+	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000073097.1|1469092_1469680_+	hypothetical protein	NA	G9L666	Escherichia_phage	100.0	9.9e-107
WP_001111288.1|1469703_1470000_+	DUF2856 family protein	NA	G9L665	Escherichia_phage	100.0	9.5e-50
WP_001370500.1|1470010_1470175_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	9.3e-23
WP_000812196.1|1470171_1470780_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	93.6	1.0e-82
WP_000034212.1|1470776_1471184_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_001014298.1|1471185_1471377_+	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000206781.1|1471379_1471829_+	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.0e-20
WP_085948186.1|1471869_1473026_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000224734.1|1473110_1473308_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000628763.1|1473821_1474697_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	86.1	5.4e-141
WP_000969524.1|1474693_1474954_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
WP_000002101.1|1474953_1475238_+	ASCH domain-containing protein	NA	A0A0P0ZDM1	Stx2-converting_phage	97.9	7.7e-49
WP_106875748.1|1475286_1475949_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	95.1	3.7e-102
WP_087661054.1|1475954_1477167_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_001291844.1|1477508_1477721_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000994804.1|1477756_1478143_+	DUF1627 domain-containing protein	NA	A0A2L1IV77	Escherichia_phage	100.0	4.6e-52
WP_000453637.1|1478221_1478404_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_001218308.1|1478387_1479557_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
1479752:1479776	attR	TGTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 8
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	1701770	1831611	5388260	integrase,transposase,tail,tRNA,holin,capsid,terminase,head	Stx2-converting_phage(38.33%)	112	1806149:1806166	1815647:1815664
WP_001370572.1|1701770_1702508_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1702639_1703974_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001370459.1|1704182_1705064_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1705166_1705754_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1705809_1706193_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1706497_1707187_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|1707234_1708272_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1708478_1708898_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001370531.1|1708966_1709665_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082964.1|1709696_1712357_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1712470_1713826_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|1713871_1714195_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|1714191_1715490_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|1721263_1723837_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040122.1|1723966_1724698_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079092.1|1724694_1725675_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197674.1|1725809_1726547_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1726817_1727159_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|1727262_1727310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|1727407_1728568_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|1728610_1729732_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|1729742_1730813_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001370532.1|1731021_1731387_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|1731536_1732055_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000589828.1|1733286_1733769_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1733845_1734193_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1734234_1735002_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1735032_1735581_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1735599_1735848_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1735985_1737347_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1737513_1738305_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_024026167.1|1738325_1739612_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001307957.1|1739666_1740260_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|1740382_1741261_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|1741346_1743008_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1743156_1743498_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|1743559_1743850_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|1743839_1744316_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1744447_1744930_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938111.1|1746683_1748045_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001370486.1|1748421_1751823_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001370516.1|1752414_1754763_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|1754782_1754872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023386.1|1754978_1755248_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	95.5	6.0e-43
WP_101329724.1|1755249_1756464_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.3	9.6e-80
WP_032212696.1|1756528_1757128_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	98.5	1.4e-108
WP_032212697.1|1757194_1760668_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.3	0.0e+00
WP_000649829.1|1760801_1761329_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_122994351.1|1761516_1762149_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.3	1.2e-97
WP_032212700.1|1762094_1762838_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.0	2.3e-148
WP_032212666.1|1762848_1763547_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000807954.1|1763546_1763888_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212947.1|1763880_1767123_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|1767174_1767384_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710949.1|1767479_1767854_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275482.1|1767868_1768585_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	6.2e-127
WP_000133388.1|1768650_1768995_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|1768991_1769438_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|1769434_1769785_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|1769795_1770122_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|1772648_1772870_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173032.1|1772914_1774852_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001399696.1|1774915_1776577_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000958402.1|1776573_1777137_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_000095749.1|1777822_1778050_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000736096.1|1778418_1778643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|1778728_1778914_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|1779431_1779965_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|1780015_1780360_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411795.1|1780364_1780571_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	2.0e-30
WP_000143014.1|1780863_1782717_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	95.9	0.0e+00
WP_001344632.1|1783159_1783291_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000101315.1|1783921_1785325_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_101329723.1|1785371_1786262_-	DNA methyltransferase	NA	A0A0P0YLW3	Yellowstone_lake_mimivirus	29.0	4.9e-17
WP_001205467.1|1786313_1786664_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	89.1	6.8e-55
WP_001399360.1|1786663_1786906_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.1e-34
WP_001258395.1|1787147_1788008_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	97.2	8.6e-160
WP_000844622.1|1788007_1788976_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	98.8	2.3e-185
WP_000424040.1|1788977_1790636_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	98.7	0.0e+00
WP_096910863.1|1791485_1792698_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_159027386.1|1793143_1794451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413407.1|1794846_1795260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174260.1|1795374_1795770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|1796853_1798009_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001370696.1|1798950_1800084_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000998846.1|1800092_1800314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234104.1|1800306_1801518_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001071601.1|1801852_1802059_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000800613.1|1802158_1803010_-	hypothetical protein	NA	NA	NA	NA	NA
1806149:1806166	attL	CCTTGCATGATGTCCTGA	NA	NA	NA	NA
WP_000927517.1|1806763_1806883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071532609.1|1807037_1807256_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	2.7e-09
WP_000149518.1|1809607_1809892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290297.1|1810086_1811403_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.8	6.6e-34
WP_000268401.1|1811532_1812129_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
WP_000248065.1|1812221_1813835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270113.1|1814564_1814792_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000335713.1|1814887_1816321_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
1815647:1815664	attR	TCAGGACATCATGCAAGG	NA	NA	NA	NA
WP_000282106.1|1817333_1817897_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233443.1|1818051_1820412_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	31.8	2.6e-33
WP_000035067.1|1820429_1820618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997983.1|1820684_1822223_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	3.9e-296
WP_000612591.1|1822272_1822620_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001066419.1|1822878_1824435_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000631725.1|1824454_1824802_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|1824798_1825473_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_087661054.1|1825577_1826791_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_000301248.1|1827061_1827637_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|1827705_1828284_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|1828332_1829373_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|1829395_1829851_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_044782296.1|1829873_1831055_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254140.1|1831029_1831611_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
>prophage 9
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	1834911	1865906	5388260	protease,transposase	Stx2-converting_phage(44.44%)	25	NA	NA
WP_001182418.1|1834911_1835991_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|1835990_1836947_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506894.1|1836957_1838166_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|1838183_1838651_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|1838911_1839241_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957247.1|1839227_1839608_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001370715.1|1839650_1841192_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.8	3.9e-78
WP_106875750.1|1842724_1843396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135714.1|1844262_1844403_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	3.1e-11
WP_000803992.1|1844704_1844968_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000024297.1|1846963_1847323_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000591998.1|1847415_1849035_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000134819.1|1849259_1849535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|1849673_1850829_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000424145.1|1851972_1852275_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_000612150.1|1852283_1852604_+	urease subunit beta	NA	NA	NA	NA	NA
WP_000065690.1|1852596_1854300_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_000966484.1|1854309_1854774_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_001142971.1|1854774_1855449_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_001021388.1|1855460_1856078_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001034023.1|1858732_1862824_+|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_077633724.1|1863049_1863298_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	80.2	1.3e-28
WP_001341423.1|1863311_1863986_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|1863982_1864330_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|1864349_1865906_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
>prophage 10
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	1954486	1961626	5388260		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|1954486_1957048_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141315.1|1957153_1957810_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.8	4.3e-50
WP_001297141.1|1957860_1958628_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|1958823_1959732_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590409.1|1959728_1960991_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_001278994.1|1960987_1961626_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	2185461	2227425	5388260	protease,tRNA,integrase,transposase	Stx2-converting_phage(66.67%)	44	2189382:2189397	2225706:2225721
WP_001370180.1|2185461_2185959_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|2186053_2186761_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|2186840_2187572_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|2187584_2188535_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|2188643_2189207_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017112.1|2189206_2189653_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
2189382:2189397	attL	TCGGTTTGCCGCTGAA	NA	NA	NA	NA
WP_101329719.1|2189861_2190836_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2190808_2191513_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2191530_2192097_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|2192093_2192384_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174739.1|2192391_2192985_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239917.1|2192977_2194114_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|2194429_2195416_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|2195460_2195964_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378942.1|2195963_2197265_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745214.1|2197320_2198328_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394120.1|2198444_2199491_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2199666_2200386_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|2200569_2200896_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2200895_2201615_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001298922.1|2201775_2202828_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2202855_2203131_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|2203195_2204275_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|2204476_2205733_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001370231.1|2205781_2207917_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234502.1|2208314_2209022_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218841.1|2209400_2210666_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000997985.1|2210782_2212321_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	8.7e-296
WP_001341423.1|2212429_2213104_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|2213100_2213448_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|2213467_2215024_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_096855415.1|2215052_2215295_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	8.6e-41
WP_000422707.1|2216799_2217225_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	97.9	2.9e-47
WP_000624681.1|2217221_2217572_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_077633701.1|2218854_2219022_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000692312.1|2219090_2219312_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_024174207.1|2219474_2219849_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854916.1|2219895_2220273_+	toxin	NA	NA	NA	NA	NA
WP_000777666.1|2220269_2220758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839246.1|2220769_2220967_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000631725.1|2224116_2224464_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|2224460_2225135_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_024174206.1|2225231_2225924_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
2225706:2225721	attR	TTCAGCGGCAAACCGA	NA	NA	NA	NA
WP_096910863.1|2226212_2227425_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
>prophage 12
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	3439713	3492479	5388260	integrase,transposase,tail,tRNA,holin,capsid,portal,terminase,head	Enterobacteria_phage(37.29%)	62	3451907:3451921	3493081:3493095
WP_001093921.1|3439713_3439995_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
WP_001061339.1|3440031_3440604_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001094871.1|3440603_3441338_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001014294.1|3441340_3441532_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_000829413.1|3441533_3442001_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_000145671.1|3442147_3442621_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|3442617_3442968_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000543621.1|3442958_3443294_-	hypothetical protein	NA	U5P0T3	Shigella_phage	97.3	5.7e-59
WP_096910863.1|3443384_3444598_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000081294.1|3444936_3445761_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000135680.1|3445826_3446189_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000981537.1|3446646_3447300_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|3447395_3447593_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514175.1|3447620_3448205_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	2.1e-56
WP_001087349.1|3448201_3449368_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	61.1	3.6e-116
WP_000626861.1|3449364_3449559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000061545.1|3449776_3450601_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	78.4	1.2e-89
WP_000988265.1|3450611_3451511_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	8.8e-139
WP_000203855.1|3451507_3452908_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	6.4e-245
3451907:3451921	attL	CTGAAGGATGCGCAG	NA	NA	NA	NA
WP_001370224.1|3452904_3453162_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	9.5e-22
WP_001370152.1|3453213_3454203_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_085947772.1|3454641_3455854_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001339373.1|3456539_3456692_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_000143128.1|3457514_3459377_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.5	0.0e+00
WP_000284522.1|3459526_3459742_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|3459746_3460091_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|3460141_3460675_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056806.1|3460945_3461515_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|3461514_3461661_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|3461883_3462069_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|3462594_3462909_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|3462990_3463215_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|3463601_3464147_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_106875761.1|3464121_3466047_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000198153.1|3466043_3466250_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|3466246_3467848_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_032282457.1|3467828_3469148_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	2.4e-233
WP_001299443.1|3469157_3469490_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_024025845.1|3469545_3470571_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.8	9.9e-187
WP_000158899.1|3470612_3471008_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|3471019_3471373_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000683137.1|3471958_3472354_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|3472361_3473114_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|3473127_3473550_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|3473576_3473990_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_032212771.1|3473970_3476583_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	87.8	0.0e+00
WP_000847401.1|3476579_3476909_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_001299882.1|3476908_3477607_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_001370115.1|3477612_3478356_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	5.0e-148
WP_077696211.1|3478301_3478937_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	1.5e-97
WP_106875762.1|3479172_3482565_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	87.6	0.0e+00
WP_001230379.1|3482631_3483231_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_032212803.1|3483295_3484609_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_024174195.1|3484610_3484874_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.2	2.5e-33
WP_087661054.1|3484879_3486092_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_077633690.1|3486058_3486193_+|tail	phage tail protein	tail	A0A0N7BTS3	Escherichia_phage	100.0	2.6e-07
WP_001370116.1|3486604_3487210_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|3487434_3488085_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_085948186.1|3488341_3489498_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001217539.1|3489945_3490194_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|3490255_3491353_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_000543822.1|3491441_3492479_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3493081:3493095	attR	CTGCGCATCCTTCAG	NA	NA	NA	NA
>prophage 13
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	3854298	3890128	5388260	integrase,transposase,tail,holin,terminase	Enterobacteria_phage(40.0%)	44	3851266:3851279	3861162:3861175
3851266:3851279	attL	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001218283.1|3854298_3855516_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	99.5	1.7e-238
WP_000206721.1|3858082_3858703_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	92.7	3.6e-115
WP_001242716.1|3858702_3859065_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	5.8e-65
WP_000008189.1|3859055_3859592_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.9	4.8e-100
WP_001311077.1|3860512_3861205_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
3861162:3861175	attR	TTCTTCGCCTGGCG	NA	NA	NA	NA
WP_001191671.1|3861302_3861563_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	1.2e-40
WP_000515839.1|3861555_3862107_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	98.9	2.2e-100
WP_001087356.1|3862103_3863252_+	peptidase	NA	K7PLX4	Enterobacteria_phage	86.9	7.2e-178
WP_000620698.1|3863248_3863473_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_024025783.1|3864283_3864778_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
WP_000066917.1|3864777_3865431_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|3865427_3865754_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|3865750_3866140_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|3866159_3866969_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001223334.1|3866984_3867500_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_001299344.1|3867509_3868499_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.2e-194
WP_001205460.1|3868516_3868858_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|3868870_3869419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|3869405_3870332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917724.1|3870596_3870800_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799669.1|3870950_3872009_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	86.7	2.9e-181
WP_001370417.1|3872450_3872882_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	99.3	3.5e-69
WP_000216636.1|3872878_3873046_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	74.5	1.1e-10
WP_032212796.1|3873453_3875304_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_085948186.1|3875426_3876582_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000411802.1|3877017_3877224_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032212794.1|3877223_3877721_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	3.8e-91
WP_001208681.1|3877937_3878123_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|3878650_3878965_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|3879046_3879271_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|3879312_3879678_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_077760350.1|3879969_3880371_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	97.7	5.6e-61
WP_085947772.1|3880363_3881577_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001130973.1|3881602_3882298_+	hypothetical protein	NA	Q6H9T2	Enterobacteria_phage	99.6	8.6e-126
WP_001216289.1|3882365_3882989_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	2.5e-68
WP_032212792.1|3883053_3884244_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	95.5	4.8e-76
WP_001023428.1|3884245_3884515_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	2.4e-44
WP_001118085.1|3884625_3885207_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_077633702.1|3885274_3885904_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	8.7e-77
WP_106875766.1|3885985_3886627_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	98.1	2.0e-105
WP_001217539.1|3886787_3887036_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|3887255_3888842_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3889234_3889840_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3889966_3890128_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 14
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	4449182	4534416	5388260	protease,integrase,transposase,tail,tRNA,capsid,portal,terminase,head	Enterobacteria_phage(48.65%)	75	4493542:4493588	4525890:4525936
WP_001295836.1|4449182_4449806_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|4449776_4450463_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561833.1|4450459_4452874_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014917.1|4453302_4457493_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
WP_000879785.1|4457473_4457965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158006.1|4458966_4460061_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|4460129_4461056_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|4461285_4461768_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|4461845_4462661_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001370296.1|4462750_4464532_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	6.0e-38
WP_000943556.1|4464544_4465321_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|4465420_4466299_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401125.1|4466467_4467922_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|4467981_4469343_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001370313.1|4469399_4470701_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001370319.1|4470722_4471868_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	4.1e-48
WP_000540996.1|4472095_4472881_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001370308.1|4472891_4474127_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703894.1|4474148_4475198_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580865.1|4475514_4477182_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|4477191_4478451_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001325209.1|4478461_4479277_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855398.1|4479273_4480167_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815538.1|4480305_4481373_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|4481369_4481879_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|4481996_4482719_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|4482721_4483216_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|4483389_4484775_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|4484810_4485332_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4485439_4485652_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|4485653_4486520_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776558.1|4487000_4487543_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_001370299.1|4488484_4491094_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691047.1|4491106_4492114_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001396973.1|4492124_4492640_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805418.1|4492642_4493275_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4493542:4493588	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001370298.1|4493601_4494765_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	9.8e-199
WP_000446905.1|4494620_4494992_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|4494963_4495242_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|4495289_4495508_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|4495606_4495888_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_087661054.1|4495944_4497157_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_029594360.1|4497215_4497740_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.7	2.2e-89
WP_001027188.1|4497714_4499640_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.3	0.0e+00
WP_000198151.1|4499636_4499849_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	95.7	1.6e-27
WP_001370283.1|4499845_4501447_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000123282.1|4501427_4502747_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	95.7	6.3e-226
WP_001358596.1|4502756_4503089_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	1.4e-54
WP_000063297.1|4503143_4504169_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.2e-189
WP_000158902.1|4504210_4504606_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.6e-55
WP_000752996.1|4504617_4504971_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_001121835.1|4504982_4505561_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_024200945.1|4505557_4505953_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_001370356.1|4505960_4506701_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_000479147.1|4506716_4507139_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_000459457.1|4507120_4507555_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840238.1|4507547_4510109_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.7	0.0e+00
WP_000847371.1|4510105_4510435_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_001152565.1|4510434_4511133_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000194780.1|4511138_4511882_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|4511818_4512451_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000515724.1|4512511_4515853_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_085947772.1|4515873_4517086_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001230348.1|4517255_4517855_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_077633707.1|4520018_4520990_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	89.3	2.1e-37
WP_000885574.1|4520989_4521574_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.2e-101
WP_000239881.1|4521628_4522297_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|4522353_4522659_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226375.1|4522842_4524327_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|4524513_4525467_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|4525979_4526741_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4525890:4525936	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|4526923_4527814_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662369.1|4527814_4530787_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383947.1|4530773_4533011_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420919.1|4533279_4534416_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	4873133	4887554	5388260	protease,tRNA,transposase	Stx2-converting_phage(30.0%)	12	NA	NA
WP_000188139.1|4873133_4875080_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4875152_4875377_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4875699_4876020_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4876050_4878327_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001066422.1|4878452_4880009_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|4880028_4880376_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|4880372_4881047_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001040187.1|4881728_4881947_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4882231_4882936_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202187.1|4882977_4884699_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
WP_001043587.1|4884699_4886466_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537420.1|4886588_4887554_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
>prophage 16
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	4972410	5081863	5388260	protease,integrase,tail,holin,capsid,portal,terminase,head	Escherichia_phage(35.58%)	136	4992080:4992098	5037907:5037925
WP_000156526.1|4972410_4974171_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|4974356_4974809_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|4974883_4975936_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|4976292_4976802_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000875061.1|4977611_4979774_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|4979783_4980230_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001295354.1|4980352_4982407_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|4982438_4982897_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|4982992_4983655_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|4983827_4984241_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|4984285_4984603_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|4984660_4985851_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048233.1|4985945_4986224_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|4986220_4986550_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|4986640_4987300_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001370339.1|4987707_4988727_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000273151.1|4988704_4988947_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_032212635.1|4989014_4991450_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	2.7e-57
WP_001098749.1|4991530_4991734_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449182.1|4991736_4991919_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
4992080:4992098	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_000394568.1|4992664_4993054_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	39.3	1.9e-21
WP_000379585.1|4993065_4993218_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000948459.1|4993533_4994010_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|4994133_4994430_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693884.1|4994452_4994878_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262384.1|4994949_4996020_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	62.2	8.2e-59
WP_001151153.1|4996060_4996483_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001266134.1|4996479_4996776_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|4996772_4997234_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|4997211_4997568_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|4997618_4997831_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|4997916_4998081_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|4998082_4998346_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|4998356_4999226_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|4999341_4999446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|4999634_4999847_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|5000014_5000293_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|5000294_5001344_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_000904103.1|5001356_5001716_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|5001724_5002255_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917767.1|5002496_5002694_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000024329.1|5002845_5003922_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	87.1	3.8e-181
WP_001443281.1|5004516_5004843_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_032212642.1|5005142_5007089_+	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	96.9	0.0e+00
WP_000142777.1|5007225_5007405_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290233.1|5007445_5007691_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	90.1	2.2e-15
WP_000284506.1|5007767_5007983_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087730.1|5007987_5008521_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001056806.1|5008791_5009361_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5009360_5009507_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|5009734_5009920_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373410.1|5010396_5010873_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	99.4	9.5e-84
WP_000102415.1|5012988_5013201_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|5013200_5014703_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000792357.1|5014692_5016672_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_024025855.1|5016759_5017086_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	2.3e-49
WP_001281345.1|5017078_5017360_+	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	98.9	2.7e-46
WP_000974955.1|5017362_5017986_+	hypothetical protein	NA	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_000682719.1|5017998_5018397_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	98.5	2.9e-70
WP_000235098.1|5018404_5019157_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479043.1|5019170_5019593_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532075.1|5019619_5019928_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_106875770.1|5019971_5022617_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.5	0.0e+00
WP_000847306.1|5022613_5022943_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001365123.1|5022942_5023641_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_106875771.1|5023651_5024395_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.3	2.3e-145
WP_077698919.1|5024340_5024973_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	1.6e-102
WP_106875772.1|5025221_5028698_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.1	0.0e+00
WP_001230497.1|5028764_5029364_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_032212761.1|5029428_5030742_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|5030743_5031013_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000938124.1|5031467_5032829_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|5033205_5033358_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001299351.1|5033640_5034660_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|5034637_5034880_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034468.1|5034947_5037419_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	8.5e-59
WP_001098307.1|5037512_5037704_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|5037700_5037889_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|5038462_5038648_+	hypothetical protein	NA	NA	NA	NA	NA
5037907:5037925	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
WP_000394511.1|5038834_5039224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|5039365_5039521_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|5039796_5040084_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|5040083_5040275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|5040302_5040704_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|5040812_5041085_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|5041068_5041494_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|5041700_5042156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072097015.1|5042234_5043359_+	DNA-binding protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000788752.1|5043355_5044096_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.0	2.0e-117
WP_000450862.1|5044121_5044892_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001151233.1|5044907_5045321_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160651.1|5045672_5046446_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|5046811_5046949_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|5046993_5047206_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_072145984.1|5047373_5047652_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|5047653_5048703_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|5048715_5049087_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|5049076_5049448_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265267.1|5049599_5050418_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917739.1|5050704_5050902_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	95.4	5.7e-27
WP_000261909.1|5051039_5051753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|5052200_5052632_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_153244796.1|5052981_5053125_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000143462.1|5055182_5055362_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|5055402_5055675_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284518.1|5055751_5055967_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731198.1|5055971_5056316_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	1.4e-57
WP_000992152.1|5056366_5056900_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	6.2e-100
WP_012816791.1|5057418_5057604_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302717.1|5058088_5058403_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|5058484_5058709_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|5059111_5059621_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|5061503_5061710_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|5061706_5063299_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001254023.1|5063288_5064794_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_000256807.1|5064830_5065178_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522623.1|5065235_5066264_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|5066315_5066699_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204559.1|5066691_5067045_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	67.5	3.3e-41
WP_000975030.1|5067059_5067593_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|5067589_5067985_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|5067992_5068745_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|5068758_5069190_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|5069216_5069630_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_000082371.1|5069610_5072190_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.6	0.0e+00
WP_000847298.1|5072186_5072516_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032212654.1|5072515_5073214_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.8	5.8e-130
WP_024174194.1|5073219_5073963_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	1.4e-142
WP_000090917.1|5073899_5074532_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_101329699.1|5074592_5078072_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001233099.1|5078139_5078739_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.0	1.1e-108
WP_101329698.1|5078803_5080117_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.2	2.8e-77
WP_001023455.1|5080118_5080388_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000767049.1|5080609_5081152_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.0	9.3e-51
WP_106420821.1|5081096_5081291_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|5081281_5081863_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
>prophage 17
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	5200939	5288798	5388260	integrase,protease,transposase,tail,holin	Enterobacteria_phage(26.32%)	113	5256944:5256961	5288571:5288588
WP_000074974.1|5200939_5202058_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|5202026_5202296_-	excisionase	NA	NA	NA	NA	NA
WP_000048560.1|5202357_5204829_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000560212.1|5204952_5205174_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_001331716.1|5205579_5205744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|5205886_5206186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|5206538_5206817_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|5206818_5207010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|5207030_5207402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|5207499_5207802_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693944.1|5207798_5208224_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|5208246_5209209_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151187.1|5209249_5209672_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	3.9e-65
WP_000935423.1|5209777_5209990_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|5210022_5210241_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_001370098.1|5210242_5210401_+	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	75.6	2.2e-13
WP_001066422.1|5210404_5211961_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|5211980_5212328_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|5212324_5212999_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_136865621.1|5213004_5213223_+	hypothetical protein	NA	S4TNB5	Salmonella_phage	70.8	7.6e-12
WP_000208016.1|5213233_5214103_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|5214218_5214323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024174193.1|5214511_5214724_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.5e-28
WP_000756560.1|5214841_5215189_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	81.7	9.2e-44
WP_000046991.1|5215309_5215582_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.1	1.9e-12
WP_001265272.1|5215583_5216633_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.1e-108
WP_001121083.1|5216645_5217020_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.1	6.4e-35
WP_000762899.1|5217016_5217838_+	hypothetical protein	NA	K7P7B9	Enterobacteria_phage	61.9	8.2e-83
WP_000917750.1|5218063_5218261_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935558.1|5218411_5219470_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	90.1	3.8e-189
WP_001344632.1|5220356_5220488_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_032212668.1|5220930_5222781_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	97.1	0.0e+00
WP_000411804.1|5223227_5223434_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_096910863.1|5225021_5226235_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.3	2.3e-166
WP_000138558.1|5226416_5226689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|5226848_5227382_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|5228028_5228235_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|5228299_5228524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|5228641_5229798_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000347013.1|5230147_5230288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208049.1|5230417_5230531_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	85.7	2.9e-07
WP_000088311.1|5230598_5230901_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085948186.1|5230998_5232154_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_106875775.1|5232231_5232909_+|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	99.1	2.4e-120
WP_000710949.1|5232923_5233298_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001453698.1|5233393_5233603_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212947.1|5233654_5236897_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|5236889_5237231_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_032212666.1|5237230_5237929_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000194757.1|5237939_5238683_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.0	1.3e-148
WP_124983447.1|5238628_5239258_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	94.2	1.5e-97
WP_106875776.1|5239498_5242975_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.1	0.0e+00
WP_024174257.1|5243043_5243619_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_032212660.1|5243683_5244997_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_032212659.1|5244998_5245268_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	7.1e-44
WP_012817749.1|5245393_5246146_-	type III effector	NA	NA	NA	NA	NA
WP_001370123.1|5247261_5248380_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|5248376_5250170_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|5250188_5250896_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|5250892_5251480_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063978.1|5251476_5251875_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|5251871_5252729_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263584.1|5252862_5254407_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460789.1|5254418_5255555_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|5255567_5255660_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|5255739_5257038_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
5256944:5256961	attL	CAGGATGTGAAGAGCGAA	NA	NA	NA	NA
WP_000208650.1|5257152_5259333_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|5259352_5259799_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|5259786_5260926_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742335.1|5260971_5263068_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|5263067_5263814_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|5263810_5264455_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|5264561_5264867_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|5265308_5265521_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|5265806_5266019_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|5266029_5266218_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|5266192_5266423_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|5266412_5266586_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818477.1|5266634_5267708_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001399304.1|5267779_5270524_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	4.6e-37
WP_000533662.1|5270618_5271692_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.7	1.3e-200
WP_001303849.1|5271669_5271888_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|5271927_5272095_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000022062.1|5272183_5272465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208006.1|5272579_5273377_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.1	5.7e-49
WP_000582238.1|5273387_5274143_-	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	4.2e-142
WP_001289864.1|5274144_5274552_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000763386.1|5274548_5274770_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	98.6	6.4e-35
WP_001443983.1|5274868_5275150_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548546.1|5275160_5275352_-	DUF1382 family protein	NA	A0A0P0ZC49	Stx2-converting_phage	100.0	4.3e-27
WP_032204932.1|5275324_5275507_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.2e-28
WP_000186740.1|5275506_5276184_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100845.1|5276180_5276966_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995439.1|5276971_5277268_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372922.1|5277322_5277487_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	9.3e-23
WP_001198859.1|5277455_5277620_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	9.0e-26
WP_001132915.1|5277692_5278061_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	96.7	1.1e-63
WP_000213975.1|5278246_5278447_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_072097037.1|5279195_5279651_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	6.8e-63
WP_096910866.1|5279999_5280818_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.2	3.3e-36
WP_001274756.1|5280984_5281698_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|5281798_5281999_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|5282117_5282411_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185425.1|5282443_5283343_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	6.0e-172
WP_000788869.1|5283339_5284041_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145926.1|5284037_5284328_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|5284401_5284842_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_001254222.1|5284838_5285021_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000566869.1|5285017_5285188_+	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	96.4	3.5e-25
WP_001108066.1|5285180_5285801_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	2.0e-94
WP_001028836.1|5285797_5286463_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	3.2e-130
WP_000750155.1|5286674_5287634_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001097237.1|5288108_5288798_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
5288571:5288588	attR	CAGGATGTGAAGAGCGAA	NA	NA	NA	NA
>prophage 18
NZ_CP027317	Escherichia coli strain 2015C-3107 chromosome, complete genome	5388260	5292464	5334813	5388260	transposase,tail,tRNA,holin,lysis,portal,capsid,terminase,head	Enterobacteria_phage(40.0%)	44	NA	NA
WP_001341423.1|5292464_5293139_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|5293135_5293483_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066419.1|5293502_5295059_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.2	1.3e-161
WP_000411802.1|5295281_5295488_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001135302.1|5295487_5295985_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000092313.1|5295981_5296419_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001307652.1|5297372_5297567_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001429103.1|5297994_5298501_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	1.5e-34
WP_001299181.1|5298472_5300401_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	1.8e-261
WP_000259002.1|5300384_5300591_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831794.1|5300587_5302180_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.1e-183
WP_001254023.1|5302169_5303675_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.8e-99
WP_000256807.1|5303711_5304059_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522623.1|5304116_5305145_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|5305196_5305580_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000975030.1|5305939_5306473_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	5.0e-57
WP_000683065.1|5306469_5306865_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_001143019.1|5306872_5307625_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000479115.1|5307638_5308070_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_000533420.1|5308096_5308510_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	7.8e-42
WP_101329686.1|5308490_5311070_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.0	0.0e+00
WP_000847306.1|5311066_5311396_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001365123.1|5311395_5312094_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_032316709.1|5312104_5312848_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.7	8.0e-146
WP_136720099.1|5312793_5313426_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	95.7	1.6e-102
WP_106875779.1|5314626_5317137_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.8	0.0e+00
WP_024174257.1|5317205_5317781_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	55.6	1.2e-59
WP_032212660.1|5317845_5319159_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001370649.1|5319160_5319430_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	1.4e-44
WP_001131642.1|5319543_5320119_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|5320409_5320991_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|5321058_5321694_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|5321821_5322880_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|5322954_5323605_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|5323787_5324378_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|5324651_5325515_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531590.1|5325498_5326635_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.2	2.1e-28
WP_000359448.1|5326884_5328111_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|5328159_5329281_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735415.1|5329356_5330817_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|5330816_5331488_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|5331655_5333026_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|5333029_5333671_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001370675.1|5333706_5334813_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP027318	Escherichia coli strain 2015C-3107 plasmid unnamed, complete sequence	81954	0	3502	81954	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_101329732.1|2340_3502_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	1.4e-51
>prophage 2
NZ_CP027318	Escherichia coli strain 2015C-3107 plasmid unnamed, complete sequence	81954	19836	30691	81954	transposase,protease	Enterobacterial_phage(25.0%)	9	NA	NA
WP_001034100.1|19836_23739_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_000114001.1|23986_24244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|24635_25792_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001341455.1|26298_26781_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000274418.1|26825_27260_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001443814.1|27271_27490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086163.1|27489_28173_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_077249722.1|28556_29459_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921962.1|29731_30691_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.6	1.6e-61
>prophage 3
NZ_CP027318	Escherichia coli strain 2015C-3107 plasmid unnamed, complete sequence	81954	33694	44497	81954	transposase,integrase	Stx2-converting_phage(75.0%)	11	NA	NA
WP_000361610.1|33694_34672_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_106875780.1|34970_35645_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.8e-12
WP_000631725.1|35641_35989_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001066422.1|36008_37565_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000937603.1|37843_39031_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|39030_39396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001066422.1|40219_41776_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.0	8.3e-161
WP_000631725.1|41795_42143_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|42139_42814_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|42867_43254_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_085948186.1|43340_44497_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 4
NZ_CP027318	Escherichia coli strain 2015C-3107 plasmid unnamed, complete sequence	81954	52065	59505	81954	integrase	Escherichia_phage(33.33%)	8	39032:39091	73312:73764
39032:39091	attL	CAGAAGGGCGGGGGGACTCCGTCCGGCCAGTGAACCGTGCCACACTCCGGGCAGTACATG	NA	NA	NA	NA
WP_096910843.1|52065_52149_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.2e-07
WP_001044768.1|52602_53019_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|53015_53246_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000465041.1|53805_54219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|54220_55003_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000864810.1|55175_55529_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001213545.1|55941_57381_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987096.1|57384_59505_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
73312:73764	attR	CATGTACTGCCCGGAGTGTGGCACGGTTCACTGGCCGGACGGAGTCCCCCCGCCCTTCTGATGCTTCCCCGTTTTGCCGACATTTTTCAGCAGGGAAACCGCTGGCTTAACTGGCTGGAGAAACAACCGGAAGGTTCAGTGCGTCCGGTAGTCATTGAGTCTGTGACAAAAATCATGGCCTGCGGGACCACGCTGATGGGGTACACACAGTGGTGCTGTTCATCTCCGGACTGCAGCCACATAAAAAAGGTCTGCTTCCGGTGTAAAAGTCGCTCCTGCCCGCACTGCGGAGTGAAGGCTGGCGCACAGTGGATACAGTATCTGCTGAGTCTGGTTCCCGACTGTCCGTGGCAGCATATTGTGTTCACACTTCCCTGCCAGTACTGGTCCCTGGTGTTCCACAACCGGAGGTTACTGGCAGAGATGAGCCGCATTGCTGCGGATGTGATACAG	NA	NA	NA	NA
>prophage 5
NZ_CP027318	Escherichia coli strain 2015C-3107 plasmid unnamed, complete sequence	81954	70834	72770	81954	transposase	Stx2-converting_phage(100.0%)	2	NA	NA
WP_101329731.1|70834_72373_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	4.3e-295
WP_000612591.1|72422_72770_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
>prophage 6
NZ_CP027318	Escherichia coli strain 2015C-3107 plasmid unnamed, complete sequence	81954	77634	80273	81954	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085948186.1|77634_78790_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000422675.1|79796_80273_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
