The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	281480	290922	5167951		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|281480_282407_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|282411_283143_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|283123_283231_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|283290_284022_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|284243_285929_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_045172404.1|285925_286645_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|286691_287162_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|287202_287664_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_069916368.1|287788_289789_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.9	0.0e+00
WP_001292774.1|289785_290922_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 2
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	1159550	1294062	5167951	integrase,lysis,protease,transposase,terminase,holin,portal,capsid,tail,head	Escherichia_phage(35.71%)	150	1207749:1207780	1272577:1272608
WP_000422043.1|1159550_1160600_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559282.1|1160819_1161578_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278894.1|1161574_1162165_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1162204_1163077_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001498960.1|1163287_1165183_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|1165210_1165831_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285673.1|1165827_1166709_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1166846_1166891_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|1166982_1168545_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1168544_1170140_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000209520.1|1171512_1172706_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443056.1|1172705_1173512_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1173892_1174072_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1174157_1174658_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079504.1|1174703_1175210_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_148718209.1|1175676_1175853_+	ash family protein	NA	S5MQL6	Escherichia_phage	52.1	1.2e-07
WP_047642936.1|1175849_1176437_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	65.7	4.1e-28
WP_106918504.1|1177216_1179148_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	7.6e-172
WP_024213867.1|1179298_1179922_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.4	1.3e-64
WP_106918505.1|1179990_1183686_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	81.2	0.0e+00
WP_077632782.1|1184372_1185005_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_077166972.1|1184950_1185694_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	92.3	3.3e-139
WP_096848408.1|1185704_1186403_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	1.2e-132
WP_000847280.1|1186402_1186732_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_106918506.1|1186728_1189308_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	86.2	0.0e+00
WP_000533452.1|1189288_1189702_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	84.8	1.9e-43
WP_001299690.1|1189728_1190160_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_106918507.1|1190175_1190925_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.0	4.8e-130
WP_000683075.1|1190932_1191328_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_000974994.1|1191324_1191900_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_001204259.1|1191915_1192269_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.1e-40
WP_044863018.1|1192261_1192645_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522634.1|1192696_1193725_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.3e-114
WP_000256800.1|1193782_1194130_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_044863017.1|1194165_1195671_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_044863016.1|1195660_1197253_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	1.0e-185
WP_000259002.1|1197249_1197456_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_044863015.1|1197439_1199368_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	2.2e-259
WP_001405844.1|1199339_1199846_-	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_096852484.1|1200617_1201822_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.1	2.7e-98
WP_000654793.1|1202656_1203277_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	53.7	3.9e-53
WP_001499026.1|1203693_1204131_-|lysis	lysis protein	lysis	K7P869	Enterobacteria_phage	95.9	2.1e-69
WP_000087715.1|1204127_1204661_-	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	5.8e-98
WP_000284510.1|1204665_1204881_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_106918508.1|1205250_1207215_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.8	2.5e-295
1207749:1207780	attL	GCATGATGCCGGGTGCCTCCCGGTGAGTTCAG	NA	NA	NA	NA
WP_044863012.1|1209079_1209805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000271627.1|1210500_1210929_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000483502.1|1211409_1212468_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	2.0e-206
WP_000917733.1|1212619_1212817_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000342737.1|1212990_1213704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064918.1|1213956_1214622_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000904136.1|1214614_1214977_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_044862984.1|1214989_1216039_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.3e-109
WP_024210728.1|1216040_1216319_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_000902695.1|1216832_1217045_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	1.4e-26
WP_000206826.1|1217278_1217623_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|1217619_1217787_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_024213791.1|1217797_1218061_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	2.6e-30
WP_000209146.1|1218062_1218281_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_000072553.1|1218313_1218526_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
WP_001141100.1|1218631_1219024_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	61.2	3.8e-38
WP_000450863.1|1219039_1219810_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	1.8e-84
WP_044862985.1|1219839_1220580_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.7	4.0e-113
WP_032211818.1|1220586_1221540_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	50.8	3.1e-73
WP_000693899.1|1221562_1221988_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|1221971_1222247_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|1222350_1222740_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380318.1|1222909_1223062_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000559918.1|1223175_1223691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|1224219_1224408_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092783.1|1224404_1224593_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_044862986.1|1224688_1227160_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	3.1e-53
WP_106918509.1|1227224_1227473_+	excisionase	NA	NA	NA	NA	NA
WP_044862987.1|1227450_1228584_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	5.8e-103
WP_089610354.1|1228915_1229074_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	74.5	5.5e-12
WP_001380464.1|1229496_1233489_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	93.1	0.0e+00
WP_000864633.1|1233860_1234334_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	4.8e-88
WP_045149551.1|1234420_1235665_-	hypothetical protein	NA	Q9LA60	Enterobacterial_phage	53.7	1.1e-73
WP_021572172.1|1236012_1237584_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
WP_000624622.1|1237603_1237951_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1237950_1238628_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_106918511.1|1238777_1239452_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.1	2.6e-111
WP_001367204.1|1239448_1239673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918512.1|1239682_1241083_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	91.4	4.7e-147
WP_000078852.1|1241225_1241366_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_106918513.1|1241564_1245038_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	91.6	0.0e+00
WP_000422722.1|1245765_1246191_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	9.8e-48
WP_000624684.1|1246187_1246538_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	2.8e-40
WP_106918514.1|1246568_1248182_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.0	5.2e-166
WP_074156316.1|1248290_1248923_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	1.1e-100
WP_033882662.1|1248868_1249612_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	1.6e-149
WP_089611680.1|1249622_1250321_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	4.0e-131
WP_001379814.1|1250530_1251676_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.7	1.3e-139
WP_000343408.1|1251883_1252225_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	7.6e-51
WP_106918515.1|1252217_1255460_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.4	0.0e+00
WP_001453746.1|1255507_1255717_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710935.1|1255812_1256187_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	1.7e-64
WP_001275447.1|1256201_1256918_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	1.4e-126
WP_106918516.1|1256983_1257328_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	1.2e-56
WP_000573391.1|1257324_1257771_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007908.1|1257767_1258118_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000125999.1|1258127_1258454_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.7e-53
WP_044860845.1|1258450_1261198_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	90.7	0.0e+00
WP_001063099.1|1261143_1261365_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173043.1|1261409_1263347_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001380454.1|1263411_1265073_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_000958383.1|1265069_1265633_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	97.9	4.4e-88
WP_000829192.1|1265921_1266287_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|1266328_1266529_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|1266660_1266987_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_001170911.1|1267337_1267562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|1267626_1267833_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000087458.1|1268542_1269076_-	lysozyme	NA	A0A088CC28	Shigella_phage	96.6	1.6e-100
WP_000284510.1|1269080_1269296_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290219.1|1269372_1269618_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	93.8	3.9e-17
WP_001379752.1|1269643_1269826_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	96.7	2.2e-25
WP_094248773.1|1269976_1271944_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	68.6	1.1e-255
WP_021574136.1|1272160_1272496_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.8e-44
WP_000216624.1|1272797_1272962_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
1272577:1272608	attR	GCATGATGCCGGGTGCCTCCCGGTGAGTTCAG	NA	NA	NA	NA
WP_001380362.1|1272958_1273390_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_001056019.1|1273638_1274790_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	31.0	1.4e-43
WP_032298929.1|1274789_1275395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918517.1|1275544_1275775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918518.1|1275827_1276052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918519.1|1276433_1277492_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.6	3.4e-206
WP_000917768.1|1277642_1277840_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_071525566.1|1278181_1278583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064919.1|1278776_1279466_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.2	3.5e-55
WP_001217429.1|1279458_1279821_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	7.3e-36
WP_001265072.1|1279833_1280883_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	2.6e-110
WP_072193422.1|1280884_1281163_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_106918520.1|1281372_1282554_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000967408.1|1282676_1282889_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000893387.1|1283178_1284270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000748513.1|1284266_1284695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001380433.1|1284735_1285329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001367112.1|1285325_1285718_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	56.5	5.3e-32
WP_001002672.1|1285979_1286291_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_000004322.1|1286283_1286538_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001151209.1|1286534_1286957_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|1286997_1287960_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|1287982_1288408_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|1288404_1288620_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103682.1|1288669_1289386_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.4	2.0e-53
WP_000379589.1|1289658_1289814_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171923.1|1289973_1290192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394528.1|1290214_1290589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1291121_1291310_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199473.1|1291306_1291495_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048374.1|1291590_1294062_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.5	2.3e-56
>prophage 3
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	1508173	1602112	5167951	integrase,transposase,terminase,holin,bacteriocin,portal,capsid	Escherichia_phage(58.97%)	95	1533986:1534001	1603833:1603848
WP_085947771.1|1508173_1509335_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409849.1|1509376_1510735_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_000287458.1|1511321_1513745_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000945561.1|1513753_1515772_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000610451.1|1515764_1517090_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_001061095.1|1517091_1517505_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_001307105.1|1517554_1518478_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199172.1|1518961_1520233_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154414.1|1520238_1521366_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|1521423_1522254_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018486.1|1522795_1524304_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|1524462_1524672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299828.1|1524726_1528689_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|1528728_1529367_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|1529654_1530746_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307100.1|1530745_1531438_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|1531449_1531836_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_106918528.1|1531843_1532644_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001196.1|1532653_1533244_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|1533254_1533749_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001352490.1|1533769_1535098_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.4e-233
1533986:1534001	attL	TTCTTTATTACCGGCG	NA	NA	NA	NA
WP_001273658.1|1535180_1535354_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_106918529.1|1536285_1544667_-	hypothetical protein	NA	A0A0H4IT29	Shigella_phage	99.9	0.0e+00
WP_106918530.1|1544736_1545987_-	hypothetical protein	NA	V5URW4	Shigella_phage	98.3	4.1e-203
WP_000540391.1|1545997_1546249_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000455652.1|1546258_1546705_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000509482.1|1546707_1547364_-	hypothetical protein	NA	A0A0P0ZGF6	Escherichia_phage	100.0	5.1e-104
WP_106918531.1|1547458_1547845_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	96.2	3.3e-66
WP_000078907.1|1547901_1548042_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000835361.1|1548272_1549007_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_044723776.1|1549097_1549715_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	99.5	4.3e-121
WP_000455635.1|1549720_1549999_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_000197192.1|1550013_1551282_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_024199968.1|1551278_1552904_-	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
WP_000513231.1|1553137_1553650_-	receptor recognizing protein Gp38	NA	A0A0P0ZFL3	Escherichia_phage	100.0	1.2e-92
WP_106918532.1|1554555_1556127_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	5.4e-168
WP_000624622.1|1556146_1556494_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1556493_1557171_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001562654.1|1559031_1559682_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	99.5	1.7e-120
WP_000829201.1|1559681_1560245_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_032330627.1|1560228_1560690_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	99.3	1.7e-74
WP_001140444.1|1560739_1561129_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|1561184_1562399_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_032330626.1|1562422_1563430_-	hypothetical protein	NA	V5UQM6	Shigella_phage	100.0	1.0e-180
WP_106918533.1|1563587_1565732_-|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	99.7	0.0e+00
WP_000143994.1|1565731_1567438_-|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	100.0	0.0e+00
WP_001086073.1|1567418_1568225_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_001283921.1|1568624_1568882_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001505200.1|1568878_1569376_-	kilA-N domain protein	NA	A0A0H4IPL1	Shigella_phage	100.0	2.4e-93
WP_071535903.1|1569597_1569804_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	66.1	2.1e-11
WP_000622438.1|1570031_1570166_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	100.0	4.2e-13
WP_001056876.1|1570180_1570747_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	100.0	1.4e-105
WP_032330623.1|1571019_1571553_-	lysozyme	NA	A0A0H4J3E2	Shigella_phage	100.0	1.0e-102
WP_000284510.1|1571557_1571773_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_096889470.1|1571850_1572096_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	8.5e-20
WP_000143459.1|1572136_1572316_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_052900924.1|1572451_1574392_-	SASA family carbohydrate esterase	NA	A0A0H4IQ82	Shigella_phage	100.0	0.0e+00
WP_000752026.1|1574897_1575167_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|1575176_1576124_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204859.1|1576630_1577065_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000144767.1|1577057_1577252_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_000813671.1|1577248_1577812_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000402092.1|1577819_1578269_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_001694414.1|1578268_1579240_-	toprim domain protein	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
WP_001694415.1|1579229_1580750_-	DEAD/DEAH box helicase	NA	A0A0H4IT01	Shigella_phage	100.0	4.9e-307
WP_001271433.1|1580743_1581121_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001302923.1|1581287_1581482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|1581652_1581856_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|1581951_1582665_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|1582759_1584229_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|1584225_1585179_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_106918534.1|1585796_1586582_+	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	96.2	3.4e-139
WP_047082372.1|1587414_1588083_+	ORF6N domain-containing protein	NA	A0A2L1IV98	Escherichia_phage	91.0	8.0e-113
WP_000917252.1|1588153_1588366_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_024177061.1|1588437_1588659_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	3.2e-34
WP_096097493.1|1588679_1588961_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	98.9	1.4e-47
WP_000459720.1|1588977_1589928_+	recombinase RecT	NA	A0A0H4IQ64	Shigella_phage	100.0	7.0e-179
WP_000187063.1|1589924_1590614_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344634.1|1590613_1591201_+	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000077905.1|1591276_1591624_+	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|1591687_1592509_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001453790.1|1593135_1594014_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_000157000.1|1594010_1594214_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476216.1|1594206_1594446_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_000036158.1|1594442_1595144_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	100.0	1.7e-134
WP_001694420.1|1595657_1596587_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	100.0	5.1e-182
WP_000203837.1|1596942_1597227_+	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_000211520.1|1597476_1598106_+	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000809302.1|1598161_1598593_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|1598589_1599216_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_001291843.1|1599175_1599388_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994793.1|1599423_1599804_+	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_000497812.1|1600167_1600419_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001208772.1|1600464_1600749_+	excisionase family protein	NA	A0A0P0ZGY2	Escherichia_phage	100.0	7.0e-50
WP_044191060.1|1600801_1602112_+|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	99.3	2.0e-253
1603833:1603848	attR	CGCCGGTAATAAAGAA	NA	NA	NA	NA
>prophage 4
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	2083786	2151690	5167951	integrase,tRNA,lysis,protease,transposase,terminase,capsid,portal,tail,head	Enterobacteria_phage(38.98%)	75	2092267:2092313	2141484:2141530
WP_000420935.1|2083786_2084923_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383954.1|2085191_2087429_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_106918560.1|2087415_2090388_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|2090388_2091279_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177452.1|2091461_2092223_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2092267:2092313	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2092735_2093689_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|2093875_2095360_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|2095543_2095849_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|2095905_2096574_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|2096939_2097053_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2097121_2097355_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|2097671_2098262_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|2098359_2098935_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279163.1|2098934_2101895_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_001233071.1|2101959_2102559_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_053276098.1|2102629_2106043_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.3	0.0e+00
WP_000090891.1|2106103_2106736_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001441739.1|2106672_2107416_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_016230622.1|2107421_2108120_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_000847355.1|2108119_2108449_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_086518786.1|2108445_2111007_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.6	0.0e+00
WP_000459458.1|2110999_2111434_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_033805293.1|2111415_2111838_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_053276106.1|2111853_2112594_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.4	1.5e-131
WP_000683105.1|2112601_2112997_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975051.1|2112993_2113572_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000753019.1|2113583_2113937_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158868.1|2113948_2114344_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063218.1|2114385_2115411_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_001369910.1|2115466_2115799_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_053276103.1|2115808_2117128_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	1.5e-232
WP_053276104.1|2117108_2118710_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	4.2e-309
WP_000198149.1|2118706_2118913_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001339397.1|2120118_2120796_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2120795_2121143_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_021572172.1|2121162_2122734_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
WP_106918561.1|2122654_2123542_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	5.6e-154
WP_000453576.1|2123516_2124062_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001421937.1|2124450_2124645_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_001031427.1|2124809_2125016_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079503.1|2125301_2125712_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_000738500.1|2126002_2126296_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|2126386_2126569_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001824639.1|2126785_2127283_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.2e-89
WP_000670959.1|2127282_2127498_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|2128086_2129184_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|2129373_2129757_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001358249.1|2129774_2130764_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_106918562.1|2130771_2131581_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	5.8e-150
WP_000767113.1|2131600_2131990_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210164.1|2131986_2132313_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_106918563.1|2132309_2132963_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	1.2e-126
WP_106918564.1|2132962_2133463_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	95.1	2.5e-82
WP_106918565.1|2133459_2134401_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	98.4	7.5e-141
WP_001250269.1|2134390_2134570_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515828.1|2134745_2135297_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_000649477.1|2135340_2135541_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2135631_2136306_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000559922.1|2136520_2137036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021564948.1|2137505_2137868_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	4.3e-60
WP_000081280.1|2137933_2138758_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000008165.1|2138885_2139422_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242717.1|2139412_2139775_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206811.1|2139774_2140080_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_000433949.1|2140079_2140451_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_001298992.1|2140306_2141470_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|2141804_2142437_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2141484:2141530	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250423.1|2142439_2142955_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_050864259.1|2142965_2143973_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|2146624_2147317_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|2147536_2148079_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|2148559_2149426_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2149427_2149640_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|2149747_2150269_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|2150304_2151690_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 5
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	2384229	2443908	5167951	integrase,transposase,holin	Stx2-converting_phage(33.33%)	57	2420207:2420222	2427119:2427134
WP_000131044.1|2384229_2386263_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|2386391_2386979_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|2386992_2388465_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|2388478_2390149_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209088.1|2390360_2391026_+	membrane protein	NA	NA	NA	NA	NA
WP_000370311.1|2391271_2391967_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023907.1|2391959_2393387_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|2393397_2394117_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339583.1|2394643_2395498_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046293.1|2395723_2397049_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|2397157_2397394_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|2397405_2397999_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001299025.1|2398158_2399028_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_000621018.1|2399276_2400134_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106918576.1|2400254_2404508_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|2405623_2405725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089568326.1|2406088_2406352_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|2406351_2406492_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|2406526_2406754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|2407576_2408119_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|2408193_2408781_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716392.1|2408838_2409507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131077.1|2409532_2412058_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001323478.1|2412047_2413691_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|2413659_2414370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|2414682_2415012_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|2415259_2415874_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|2416291_2416981_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|2416977_2417934_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667065.1|2417930_2420129_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121356.1|2420139_2421096_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
2420207:2420222	attL	ACCACCGGACCATTCT	NA	NA	NA	NA
WP_001111349.1|2421074_2421485_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000144687.1|2421822_2423142_+|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	2.5e-17
WP_001280444.1|2423234_2424083_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000875212.1|2424363_2425383_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000839232.1|2425596_2425794_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761703.1|2425805_2426294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094440.1|2426290_2426668_-	toxin	NA	NA	NA	NA	NA
WP_024166067.1|2426714_2427092_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692350.1|2427166_2427388_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
2427119:2427134	attR	AGAATGGTCCGGTGGT	NA	NA	NA	NA
WP_001367144.1|2427474_2427951_-	RadC family protein	NA	NA	NA	NA	NA
WP_001449312.1|2427966_2428446_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.6	1.2e-12
WP_000680583.1|2428539_2428785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234621.1|2428784_2429603_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000846706.1|2429823_2430234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775504.1|2430249_2430933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102618.1|2431066_2432137_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203548.1|2432133_2433039_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000544649.1|2433035_2435420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000521941.1|2436805_2437393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000721150.1|2437724_2438351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021572172.1|2438752_2440324_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
WP_000624622.1|2440343_2440691_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000422722.1|2440799_2441225_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	9.8e-48
WP_000624684.1|2441221_2441572_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	2.8e-40
WP_106918514.1|2441602_2443216_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.0	5.2e-166
WP_106918577.1|2443242_2443908_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.2e-21
>prophage 6
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	2507892	2556367	5167951	tRNA,transposase,plate	Shigella_phage(12.5%)	37	NA	NA
WP_085947772.1|2507892_2509106_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_106918580.1|2510065_2512159_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	4.7e-26
WP_087904906.1|2512117_2512324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|2512374_2513850_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|2513856_2514270_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|2514273_2516124_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|2516087_2517170_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|2517194_2518475_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|2518471_2518996_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|2518998_2520330_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|2520334_2521096_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_106918581.1|2521104_2523864_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.0	4.7e-82
WP_000088873.1|2523860_2524604_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240543.1|2524608_2526024_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985795.1|2526132_2529567_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377959.1|2529577_2530930_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|2530953_2531436_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|2531479_2532394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|2532403_2532883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|2533019_2533805_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|2534344_2535076_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|2535140_2535608_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|2535604_2536327_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|2536360_2537116_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|2537187_2538546_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|2538593_2539364_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|2539441_2540242_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_106918582.1|2540482_2541397_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|2541393_2542197_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|2547958_2548531_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|2548718_2549750_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|2549742_2550396_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|2550435_2551251_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|2551368_2551773_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|2551769_2552477_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|2552588_2554307_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|2555386_2556367_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	2989261	3123353	5167951	integrase,transposase,tRNA,protease	Stx2-converting_phage(33.33%)	102	2980841:2980856	3053285:3053300
2980841:2980856	attL	AGACTGACAGTTCTGC	NA	NA	NA	NA
WP_001232412.1|2989261_2990266_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2990268_2991528_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2991613_2992894_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2992969_2993278_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|2993363_2994314_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_106918601.1|2994306_2996154_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	7.5e-60
WP_032359827.1|2996163_2997501_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|2997519_2997981_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_106918602.1|2997952_2999500_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|2999498_3000638_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|3000620_3000674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045172127.1|3001532_3002273_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001295188.1|3002312_3002858_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|3002952_3004005_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_021499494.1|3004101_3005070_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|3005091_3008415_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000004771.1|3010286_3011264_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|3011588_3013397_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|3013389_3014124_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|3014134_3014530_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|3014540_3014900_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|3014962_3016096_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|3016184_3016718_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3016714_3017032_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3017206_3017353_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|3017463_3017589_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3017640_3018207_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|3018248_3019277_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|3019666_3020536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|3020738_3021092_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3021229_3022876_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3022919_3023213_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|3023488_3024745_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|3024760_3025237_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|3025573_3027010_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3027127_3028429_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|3028544_3028883_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_106918603.1|3028858_3030556_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|3030592_3031168_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218780.1|3031547_3032813_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
WP_000147021.1|3033068_3034112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106918604.1|3034804_3036343_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	5.3e-293
WP_000612591.1|3036392_3036740_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_024165538.1|3036736_3037117_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_040078340.1|3037842_3038580_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075826376.1|3040728_3041865_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.0	1.8e-117
WP_106918605.1|3041959_3043642_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001032733.1|3043724_3043982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106918728.1|3044148_3045356_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	1.1e-96
WP_001367551.1|3045553_3045769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525616.1|3046181_3046373_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001339397.1|3046679_3047357_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3047356_3047704_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_021572172.1|3047723_3049295_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
WP_127891385.1|3051015_3051177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001498922.1|3051351_3053322_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
3053285:3053300	attR	GCAGAACTGTCAGTCT	NA	NA	NA	NA
WP_000977393.1|3053340_3054132_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_000021267.1|3054721_3055351_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.2	3.3e-52
WP_001096212.1|3055532_3057320_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001124814.1|3057506_3058727_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.6	1.6e-63
WP_097467326.1|3058852_3059749_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_075826361.1|3059844_3060030_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_106918607.1|3060136_3061349_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	1.9e-99
WP_075826362.1|3061764_3062241_-	LuxR family transcriptional regulator	NA	Q9LA52	Enterobacteria_phage	45.9	5.1e-29
WP_032209787.1|3062303_3062510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097467328.1|3062637_3063618_-	hemagglutinin	NA	Q9MCI8	Enterobacteria_phage	62.5	8.4e-42
WP_157920871.1|3063693_3063840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918608.1|3064103_3065972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918609.1|3066050_3079352_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_075826383.1|3079638_3080886_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000835435.1|3080945_3083093_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	7.7e-24
WP_000821922.1|3083097_3084366_-	TolC family protein	NA	NA	NA	NA	NA
WP_000899430.1|3086023_3086797_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001053450.1|3086821_3091144_-	hemagglutinin	NA	NA	NA	NA	NA
WP_106918610.1|3091809_3093858_-	TonB-dependent siderophore receptor IreA	NA	A0A0P0I887	Acinetobacter_phage	33.5	8.5e-12
WP_000416155.1|3097040_3098072_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.2	1.8e-18
WP_000916813.1|3098342_3098786_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705929.1|3098801_3099089_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345351.1|3099101_3100358_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000436078.1|3100574_3100859_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	60.7	1.9e-23
WP_000107483.1|3101279_3102293_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_000998354.1|3102304_3103621_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|3103648_3104569_-	ribokinase	NA	NA	NA	NA	NA
WP_001298267.1|3104873_3105656_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001315617.1|3105657_3105756_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_001371476.1|3106528_3106666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918611.1|3107015_3107291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918514.1|3107297_3108911_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.0	5.2e-166
WP_000624684.1|3108941_3109292_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	2.8e-40
WP_000422722.1|3109288_3109714_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	9.8e-48
WP_000553833.1|3110149_3110347_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_033801398.1|3110594_3111020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024175299.1|3111016_3111400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918607.1|3112196_3113409_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	1.9e-99
WP_001335904.1|3114894_3115686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371489.1|3116071_3116278_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000813431.1|3116371_3116974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327829.1|3117446_3117662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000263652.1|3119349_3120525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|3120737_3121415_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3121414_3121762_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_021572172.1|3121781_3123353_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
>prophage 8
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	3709970	3728870	5167951	transposase,integrase	Stx2-converting_phage(42.86%)	8	3716669:3716684	3739032:3739047
WP_001428357.1|3709970_3711749_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.3	1.7e-21
WP_001428356.1|3711761_3721526_+	contact-dependent inhibition toxin CdiA	NA	A0A0R6PJK4	Moraxella_phage	33.4	1.6e-28
3716669:3716684	attL	CATTACCCGTCTGACG	NA	NA	NA	NA
WP_001046156.1|3721534_3721900_+	ribonuclease toxin immunity protein CdiI	NA	NA	NA	NA	NA
WP_106918642.1|3722399_3722570_+|transposase	transposase	transposase	Q76S41	Shigella_phage	68.4	1.3e-06
WP_001339397.1|3722606_3723284_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3723283_3723631_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_021572172.1|3723650_3725222_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
WP_001218916.1|3727664_3728870_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.4	2.2e-161
3739032:3739047	attR	CATTACCCGTCTGACG	NA	NA	NA	NA
>prophage 9
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	4466391	4539717	5167951	transposase,integrase,protease	Stx2-converting_phage(29.41%)	55	4465932:4465948	4539921:4539937
4465932:4465948	attL	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_106918514.1|4466391_4468005_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.0	5.2e-166
WP_000624684.1|4468035_4468386_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.2	2.8e-40
WP_000422722.1|4468382_4468808_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	96.9	9.8e-48
WP_001274563.1|4468889_4469441_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_032209866.1|4469525_4469723_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000976864.1|4469734_4470226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854816.1|4470222_4470597_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001285402.1|4470686_4471055_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692323.1|4471217_4471439_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186727.1|4471507_4471984_-	RadC family protein	NA	NA	NA	NA	NA
WP_000706981.1|4471999_4472479_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.5e-12
WP_001234638.1|4472741_4473560_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	38.4	8.8e-45
WP_042960768.1|4473728_4473884_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_024226900.1|4473958_4474414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050876204.1|4474489_4477006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918681.1|4477126_4480249_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001594209.1|4480576_4481449_-	GTPase family protein	NA	NA	NA	NA	NA
WP_122994265.1|4482748_4484233_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000804452.1|4484554_4485157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323667.1|4485243_4485522_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_064758499.1|4486201_4486351_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_000221500.1|4487078_4487648_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271028.1|4487908_4488292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013770.1|4488288_4488702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260388.1|4489007_4489631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124189.1|4489719_4489953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287795.1|4489972_4490182_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000098937.1|4490680_4491178_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_106918682.1|4491559_4492716_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000544018.1|4493201_4494758_+	L-lactate permease	NA	NA	NA	NA	NA
WP_001102090.1|4494807_4495527_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000054156.1|4495537_4496953_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000431499.1|4496956_4497655_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001294844.1|4498881_4500429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021572172.1|4506326_4507898_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	1.1e-168
WP_000624622.1|4507917_4508265_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4508264_4508942_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000323312.1|4509775_4510048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264907.1|4510081_4510273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001370958.1|4510282_4510648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034014.1|4511139_4515231_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.5	3.3e-310
WP_000634452.1|4516143_4516881_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001223349.1|4517712_4519803_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_000593013.1|4520148_4521993_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
WP_000416157.1|4523361_4524393_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916811.1|4524663_4525107_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705928.1|4525122_4525410_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|4525422_4526679_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001254932.1|4528221_4529373_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000483811.1|4531022_4531250_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_001238642.1|4531627_4532203_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001499293.1|4532631_4533909_-	hemagglutinin	NA	B0FIT1	Escherichia_phage	39.4	8.4e-10
WP_072096839.1|4534151_4534379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000344106.1|4534487_4538003_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_033801469.1|4538454_4539717_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	2.6e-80
4539921:4539937	attR	CCGGACTCGGAATCGAA	NA	NA	NA	NA
>prophage 10
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	4822282	4829422	5167951		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4822282_4822921_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_106918697.1|4822917_4824180_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_000847985.1|4824176_4825085_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4825280_4826048_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|4826098_4826755_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|4826860_4829422_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 11
NZ_CP027312	Escherichia coli strain 2013C-3181 chromosome, complete genome	5167951	4904459	4989014	5167951	integrase,tRNA,transposase,plate,terminase,holin,capsid,portal,tail,head	Enterobacteria_phage(75.0%)	91	4916228:4916244	4992535:4992551
WP_085947772.1|4904459_4905673_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000162574.1|4909279_4909762_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|4909893_4910370_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4910359_4910650_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4910711_4911053_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4911201_4912863_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4912948_4913827_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001300112.1|4913949_4914540_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_087514500.1|4914621_4915179_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_158707530.1|4915301_4916588_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
4916228:4916244	attL	GGTACAGCGCGGCAATG	NA	NA	NA	NA
WP_001338897.1|4916608_4917400_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|4917566_4918928_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4919064_4919313_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4919331_4919880_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|4919910_4920678_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4920719_4921067_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|4921143_4921626_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|4921641_4922868_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|4922857_4923376_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|4923525_4923891_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168044.1|4924100_4925171_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|4925181_4926303_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|4926345_4927506_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4927603_4927651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974887.1|4927818_4928808_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_001242988.1|4928874_4929177_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_001001394.1|4929272_4929599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813366.1|4929617_4929959_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	1.7e-55
WP_040091109.1|4929969_4930248_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	5.3e-34
WP_000357024.1|4930259_4930502_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.5e-37
WP_040091107.1|4930498_4930624_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	3.6e-11
WP_001560998.1|4930698_4930902_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	100.0	4.0e-31
WP_000153674.1|4930898_4931144_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_040091102.1|4931140_4931440_+	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	3.7e-41
WP_001036813.1|4931451_4931655_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_000714526.1|4931651_4932482_+	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.3	7.4e-132
WP_157919787.1|4932535_4933156_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	2.0e-09
WP_000599411.1|4933152_4933518_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	3.9e-61
WP_106918703.1|4933524_4936302_+	replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	96.2	0.0e+00
WP_001603071.1|4936667_4937813_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_032234544.1|4937802_4938321_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_000087812.1|4938852_4939899_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_106918704.1|4939898_4941650_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.6	0.0e+00
WP_001262655.1|4941804_4942641_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055104.1|4942664_4943717_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_069905309.1|4943762_4944563_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	93.2	3.8e-133
WP_069905310.1|4944665_4945160_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
WP_000864901.1|4945159_4945360_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_032198071.1|4945362_4945686_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	91.6	1.8e-46
WP_032198070.1|4945740_4946286_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.6	1.9e-91
WP_106918705.1|4946282_4946690_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	6.7e-62
WP_032198068.1|4946827_4947295_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	7.6e-86
WP_032198067.1|4947287_4947923_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_032198066.1|4947919_4948501_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.6e-101
WP_032198065.1|4948497_4948848_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	1.3e-58
WP_032198064.1|4948851_4949748_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.8e-155
WP_032250949.1|4949740_4950271_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	1.5e-93
WP_106918706.1|4950273_4952100_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	93.3	1.1e-103
WP_106918707.1|4952096_4952999_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	63.6	1.2e-98
WP_096217443.1|4953007_4953625_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	83.5	5.7e-89
WP_001447286.1|4953588_4954134_-	transferase	NA	NA	NA	NA	NA
WP_000979954.1|4954322_4954811_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_106918708.1|4954823_4957631_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.8	0.0e+00
WP_000333503.1|4957617_4957773_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|4957781_4958156_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|4958211_4958724_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_032198054.1|4958723_4959908_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	1.3e-222
WP_000132830.1|4960065_4961175_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488108.1|4961217_4961478_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|4961669_4961810_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_106918709.1|4961945_4962242_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_157838996.1|4962395_4962647_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_106918710.1|4962576_4963383_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_000178456.1|4963533_4963875_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|4964145_4964883_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079112.1|4965017_4965998_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040149.1|4965994_4966726_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|4966855_4969429_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852116.1|4975294_4976593_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
WP_001300818.1|4976589_4976913_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|4976958_4978314_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082964.1|4978427_4981088_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001343689.1|4981119_4981818_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|4981886_4982306_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4982512_4983550_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|4983597_4984287_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|4984591_4984975_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_106918711.1|4985030_4985618_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|4985720_4986602_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4986810_4988145_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_045172350.1|4988276_4989014_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
4992535:4992551	attR	GGTACAGCGCGGCAATG	NA	NA	NA	NA
