The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	0	11826	5272286		uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_001297434.1|1106_1595_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|1714_2107_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066997.1|2106_4185_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|4177_5326_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|5527_6172_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|6182_6572_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|6586_7636_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|7638_8499_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483202.1|8517_10119_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	4.9e-15
WP_001297437.1|10164_11826_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 2
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	21899	23414	5272286		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|21899_23414_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 3
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	35404	36157	5272286		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|35404_36157_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 4
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	48319	138091	5272286	capsid,head,holin,transposase,integrase,tail,terminase	Escherichia_phage(41.18%)	105	54164:54178	142689:142703
WP_000334632.1|48319_48991_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
WP_106888879.1|49030_50239_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.1e-208
WP_000879833.1|51669_52467_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|52476_53028_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|53196_53529_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274295.1|53862_54177_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
54164:54178	attL	TGTATCGCTGACATT	NA	NA	NA	NA
WP_000994405.1|54391_56050_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_062863611.1|56042_57038_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282706.1|57030_57717_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|57716_59090_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|59108_59552_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620060.1|59548_60676_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133112.1|60780_61245_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001368025.1|61249_62254_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|62250_62664_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|62666_63032_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253450.1|63031_63769_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|63778_64048_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983977.1|64056_64842_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|65131_65755_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|65798_66041_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|66149_66377_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491499.1|66674_67490_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001351364.1|67486_69181_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_000009306.1|69418_69601_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922694.1|69679_70597_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_106913337.1|70769_71690_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|71678_72149_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157249.1|72129_73548_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365562.1|73614_74310_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_106913338.1|74349_74715_-	permease	NA	NA	NA	NA	NA
WP_000824375.1|75280_76444_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_000218203.1|77035_77887_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826764.1|77994_79353_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|79352_80024_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920132.1|80156_80570_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740061.1|80678_81683_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240105.1|81683_82319_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001317164.1|82554_83226_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_024175323.1|85550_86024_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	89.2	2.4e-79
WP_033883542.1|86111_87383_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	56.6	6.3e-98
WP_033883544.1|87875_88541_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	91.8	2.8e-113
WP_106913339.1|88604_90341_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	96.8	9.2e-169
WP_000078852.1|90483_90624_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_106913340.1|90822_94290_-	host specificity protein J	NA	S5MW25	Escherichia_phage	97.4	0.0e+00
WP_077632782.1|94530_95163_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_106913341.1|95108_95852_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	2.3e-148
WP_033883549.1|95862_96561_-|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	98.7	8.1e-132
WP_000343411.1|96560_96902_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_106913342.1|96894_100137_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.6	0.0e+00
WP_033883554.1|100200_100614_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	69.3	4.6e-50
WP_136752569.1|100677_100887_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	91.3	1.2e-30
WP_000710934.1|100982_101357_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_062863664.1|101371_102088_-|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	8.9e-126
WP_000133378.1|102153_102498_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	3.2e-57
WP_000573391.1|102494_102941_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|102937_103288_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_028131506.1|103297_103624_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.7e-53
WP_001063099.1|106150_106372_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173022.1|106416_108354_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_106913343.1|108417_110079_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_000958387.1|110075_110639_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_032331514.1|110928_111294_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	2.3e-61
WP_000095744.1|111335_111536_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|111667_111994_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000735659.1|112338_112563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071852370.1|112648_112834_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	1.4e-19
WP_000650395.1|113050_113986_-	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	54.8	9.9e-93
WP_001280925.1|113993_114125_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	7.2e-10
WP_001092902.1|114480_115014_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_042969680.1|115050_115608_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	1.2e-50
WP_000284506.1|115611_115827_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_064562823.1|115903_116149_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	2.0e-16
WP_001379752.1|116174_116357_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	96.7	2.2e-25
WP_044860938.1|116507_118475_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	68.6	2.5e-255
WP_000719322.1|118997_119261_-	Shiga toxin Stx2b subunit B	NA	G8GYD3	Escherichia_phage	100.0	1.7e-42
WP_001379755.1|119273_120233_-	Shiga toxin Stx2 subunit A	NA	G8GYD2	Escherichia_phage	97.8	3.2e-171
WP_000024334.1|120616_121675_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.6	2.0e-206
WP_000917768.1|121825_122023_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_106913344.1|122249_123071_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.3	7.2e-79
WP_000140006.1|123067_123448_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	6.5e-35
WP_033883573.1|123448_124507_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	8.0e-91
WP_024175311.1|124508_124787_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_001260978.1|124922_125180_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	2.5e-30
WP_000220597.1|125185_125485_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	98.0	5.1e-51
WP_000104478.1|125687_126218_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	66.7	3.3e-45
WP_000034205.1|126214_126892_-	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	90.7	2.5e-61
WP_001226810.1|126888_127452_-	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	78.6	1.7e-31
WP_032298829.1|127438_127744_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	96.0	6.8e-51
WP_000017341.1|127740_128058_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_000450654.1|128054_128816_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.8	3.8e-82
WP_074015090.1|128849_129392_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	3.3e-80
WP_042969574.1|129303_130341_-	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	69.5	1.6e-88
WP_000693925.1|130409_130835_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887454.1|130818_131091_-	hypothetical protein	NA	H6WRX5	Salmonella_phage	50.0	8.5e-13
WP_000986593.1|131199_131601_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.0	1.6e-12
WP_000100897.1|131628_131820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351442.1|131819_132107_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000380312.1|132380_132533_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000935583.1|133028_133883_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	65.7	8.5e-67
WP_000449173.1|133893_134082_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199478.1|134078_134267_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106913345.1|134359_136804_+	exonuclease	NA	V5UQJ3	Shigella_phage	59.0	1.8e-178
WP_000096347.1|136862_137066_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533611.1|137065_138091_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.0	1.7e-101
142689:142703	attR	AATGTCAGCGATACA	NA	NA	NA	NA
>prophage 5
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	165841	167008	5272286		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830155.1|165841_167008_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	6.5e-227
>prophage 6
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	174652	175552	5272286		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|174652_175552_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 7
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	182907	185729	5272286		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704797.1|182907_184074_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.3e-114
WP_000043503.1|184322_185729_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	8.0e-38
>prophage 8
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	191080	198700	5272286		Enterobacteria_phage(40.0%)	8	NA	NA
WP_000717715.1|191080_192193_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	32.0	1.2e-44
WP_000605304.1|192189_192729_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001024672.1|192725_193130_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000998506.1|193134_193899_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_001367822.1|193928_194792_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.6	1.2e-105
WP_000699408.1|194788_195865_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	3.9e-101
WP_000183063.1|196237_197131_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116051.1|197305_198700_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
>prophage 9
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	204315	211108	5272286		Bacillus_phage(33.33%)	5	NA	NA
WP_001368047.1|204315_205686_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	2.9e-32
WP_000079263.1|205878_207315_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699707.1|207317_208541_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|208537_209017_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000048190.1|209986_211108_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 10
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	215351	225827	5272286		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|215351_216191_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137103.1|216368_218531_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|218533_218977_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|218982_220122_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001300971.1|220780_222364_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252337.1|222637_224491_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|224512_225094_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|225185_225827_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 11
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	230490	231843	5272286		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469735.1|230490_231843_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	4.6e-06
>prophage 12
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	244957	350356	5272286	capsid,head,holin,tRNA,integrase,tail,terminase	Enterobacteria_phage(29.87%)	110	296864:296884	347862:347882
WP_000675159.1|244957_246361_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|246357_247080_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_001351381.1|247270_247603_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|247811_248108_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|248109_248406_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|248508_249870_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001352710.1|250199_250517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|250922_251822_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|251903_252683_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844220.1|252782_253823_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490716.1|253870_255226_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823272.1|255229_255514_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182904.1|255544_255997_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000289788.1|257292_258147_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129565.1|258456_259509_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|259765_261043_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|261039_262044_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|262040_263006_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|262979_263726_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001368039.1|263777_264596_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	3.8e-24
WP_000822274.1|264660_265461_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195602.1|265457_266246_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|266468_266741_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134580.1|266861_267647_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|267865_268204_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001368051.1|268285_269320_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945469.1|269333_271814_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|271829_272504_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830483.1|272584_273127_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|273419_273701_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|273963_275073_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|275204_277238_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_000356790.1|281181_284814_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636926.1|284874_285195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|285769_286858_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001292774.1|289140_290277_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|290273_292274_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|293175_293637_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|293676_294147_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|294193_294913_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|294909_296595_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
296864:296884	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_016232182.1|297109_297358_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	80.2	1.6e-29
WP_157911323.1|297394_297568_-	hypothetical protein	NA	A0A2L1IV33	Escherichia_phage	67.2	4.9e-14
WP_044696803.1|297572_298046_-	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	93.6	2.4e-79
WP_062891124.1|298134_299397_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	41.2	2.0e-51
WP_106913349.1|300203_300875_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	84.6	1.6e-105
WP_000218372.1|300938_302381_-	hypothetical protein	NA	Q9LA62	Enterobacterial_phage	99.1	5.0e-59
WP_106913350.1|302563_306094_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	82.5	0.0e+00
WP_122993926.1|306345_306978_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	1.2e-102
WP_106913351.1|306923_307667_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	94.7	4.4e-144
WP_021565053.1|307677_308376_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	2.7e-127
WP_103757175.1|308572_309727_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.3e-128
WP_000807934.1|309943_310285_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	93.8	2.6e-59
WP_062891024.1|310277_313520_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_001513217.1|313567_313777_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|313872_314247_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_033883560.1|314261_314978_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	1.4e-126
WP_000133388.1|315044_315389_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573400.1|315385_315832_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	9.9e-75
WP_001007900.1|315828_316179_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	98.3	1.7e-58
WP_000126002.1|316188_316515_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.6e-53
WP_001063099.1|319041_319263_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173022.1|319307_321245_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_033883565.1|321308_322970_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958372.1|322966_323530_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_062872501.1|323819_324185_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	4.6e-62
WP_000095744.1|324226_324427_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|324558_324885_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000735659.1|325229_325454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071852370.1|325539_325725_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	1.4e-19
WP_000650395.1|325941_326877_-	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	54.8	9.9e-93
WP_001280925.1|326884_327016_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	7.2e-10
WP_001092902.1|327371_327905_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_042969680.1|327941_328499_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	1.2e-50
WP_000284506.1|328502_328718_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_064562823.1|328794_329040_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	2.0e-16
WP_001379752.1|329065_329248_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	96.7	2.2e-25
WP_106913352.1|329398_331366_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	68.6	1.9e-255
WP_000917742.1|331949_332147_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_087900278.1|332351_332747_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	92.9	2.9e-62
WP_106913353.1|332761_333751_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	3.1e-193
WP_001072668.1|333758_334574_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.9	3.2e-148
WP_000767110.1|334736_335132_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_062895811.1|335128_335455_-	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	98.1	1.3e-52
WP_000066917.1|335451_336105_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_012601564.1|336104_336599_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	87.2	1.5e-76
WP_106913354.1|336595_337579_-	replication protein	NA	Q8SBF1	Shigella_phage	97.2	1.7e-55
WP_000995577.1|337575_337875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087893389.1|337871_338096_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	90.5	1.5e-34
WP_001087340.1|338092_339238_-	peptidase	NA	A5LH69	Enterobacteria_phage	83.5	3.1e-173
WP_032308968.1|339234_339819_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	5.5e-57
WP_001231956.1|339846_340044_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|340139_340793_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000135680.1|341247_341610_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081278.1|341675_342500_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008178.1|342627_343164_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_001242713.1|343154_343517_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_000111289.1|343513_343717_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_021524341.1|343709_343949_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	2.0e-34
WP_021524342.1|343945_344494_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	94.1	1.0e-57
WP_001452608.1|344678_345011_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	97.3	3.2e-62
WP_062863629.1|345007_345766_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.6	3.6e-101
WP_000457723.1|345850_346093_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_021524344.1|346096_346231_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	1.2e-20
WP_001193437.1|346249_346504_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_032308692.1|346537_347824_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	99.5	8.4e-252
WP_042101647.1|347859_348546_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
347862:347882	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216961.1|348605_348713_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|348693_349425_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|349429_350356_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 13
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	370671	372192	5272286		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|370671_372192_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 14
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	375886	376555	5272286		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|375886_376555_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 15
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	383741	384599	5272286		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|383741_384599_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 16
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	399130	403431	5272286		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848214.1|399130_400597_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
WP_000198823.1|400714_401701_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001368027.1|401739_402453_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|402864_403431_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 17
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	409962	529179	5272286	capsid,protease,portal,holin,bacteriocin,transposase,integrase,tail	Escherichia_phage(39.06%)	103	440068:440084	526820:526836
WP_000194876.1|409962_411552_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_001234850.1|413457_414153_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|414301_416062_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|416186_416471_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|416609_417617_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135667.1|417798_418026_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256200.1|418045_419806_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000101906.1|420175_421417_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.6e-98
WP_000387403.1|421923_422130_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000182305.1|422251_422455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142000.1|422512_422692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226790.1|422876_423077_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001368043.1|423066_423306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204080.1|423298_423520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204974.1|423521_423755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669950.1|423760_424060_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761824.1|424056_425811_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.8	7.8e-91
WP_000557475.1|426099_426378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126664.1|426374_426797_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001114743.1|427263_427458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055278099.1|427454_429344_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	2.1e-182
WP_000133401.1|429601_429883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062863651.1|433284_433932_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211587.1|433966_435019_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|435015_435573_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982425.1|435569_437513_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|437509_437989_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|437985_438195_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|438191_438929_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971730.1|438970_439633_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001296826.1|439629_440247_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
440068:440084	attL	CCAGAGAACCTCGCCAG	NA	NA	NA	NA
WP_000528376.1|440265_440868_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|440877_441327_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013510.1|441323_442187_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|442173_442869_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778057.1|442875_445362_-	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000557378.1|445358_445622_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686735.1|445611_446106_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000849209.1|446513_447002_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000422188.1|449014_450658_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884941.1|450733_451384_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710363.1|451383_452448_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_062863650.1|452521_453577_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865548.1|453688_454792_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.2	5.6e-119
WP_001249127.1|455530_458203_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_106913356.1|458769_462762_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	93.1	0.0e+00
WP_000864633.1|463133_463607_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	4.8e-88
WP_159027473.1|463693_464710_-	adhesin	NA	Q9LA60	Enterobacterial_phage	48.6	1.1e-55
WP_106913357.1|465070_473446_-	hypothetical protein	NA	A0A2R2Z366	Escherichia_phage	95.6	0.0e+00
WP_000012441.1|473530_474793_-	hypothetical protein	NA	A0A2R2Z372	Escherichia_phage	82.6	2.3e-169
WP_044190627.1|474803_475055_-|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	92.3	1.5e-11
WP_000455656.1|475064_475511_-	hypothetical protein	NA	V5UT82	Shigella_phage	99.3	2.4e-76
WP_106888899.1|475513_476170_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	99.1	6.9e-109
WP_001380385.1|476264_476618_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	99.1	9.9e-62
WP_106913358.1|476753_477950_-	hemagglutinin	NA	NA	NA	NA	NA
WP_000078907.1|478301_478442_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000197193.1|478643_480410_-	DUF1983 domain-containing protein	NA	A0A2R2Z364	Escherichia_phage	96.6	2.7e-192
WP_106888901.1|480406_482032_-	hypothetical protein	NA	G9L6L3	Escherichia_phage	94.5	8.3e-305
WP_000864635.1|482381_482855_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	89.2	5.4e-79
WP_106913359.1|482943_484077_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	52.1	1.7e-70
WP_106913360.1|484569_485235_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	91.4	1.0e-112
WP_106913361.1|485298_487101_-|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	9.3e-63
WP_000207914.1|487097_487748_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	95.3	7.6e-116
WP_000829201.1|487747_488311_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_042965323.1|488294_488756_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	99.3	6.6e-74
WP_001140444.1|488805_489195_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|489250_490465_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345012.1|490488_491496_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.4	8.8e-180
WP_106913362.1|491653_493798_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.2	0.0e+00
WP_000143996.1|493797_495504_-	hypothetical protein	NA	G9L6K0	Escherichia_phage	98.9	0.0e+00
WP_001086080.1|495484_496336_-	hypothetical protein	NA	A0A2L1IV66	Escherichia_phage	80.9	1.9e-95
WP_012816804.1|497417_497603_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000087720.1|498154_498688_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	3.3e-101
WP_000284510.1|498692_498908_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290232.1|498984_499257_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	97.8	7.2e-20
WP_032320589.1|499282_499465_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	88.3	2.3e-22
WP_000874434.1|499610_501635_-	DUF1737 domain-containing protein	NA	A0A0P0ZGE0	Escherichia_phage	63.0	5.4e-237
WP_106913363.1|503058_503700_-	type II restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_024178293.1|503732_505691_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	36.6	3.3e-82
WP_001204834.1|506980_507406_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	67.4	7.5e-48
WP_001561701.1|507484_508348_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	80.4	1.2e-132
WP_000844634.1|508347_509316_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	81.4	1.0e-156
WP_000932104.1|509317_510976_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	77.7	4.9e-260
WP_001271873.1|511009_511378_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	68.9	1.2e-41
WP_000349381.1|512254_512914_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	49.1	4.7e-49
WP_000781554.1|514155_514347_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	96.8	1.5e-27
WP_106913364.1|514343_514544_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	78.7	9.0e-20
WP_000651133.1|514718_515081_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	70.0	1.5e-36
WP_000657001.1|515488_516049_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	46.2	3.3e-19
WP_000127373.1|516035_516620_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.6	2.7e-32
WP_000749823.1|516643_517510_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	72.6	4.8e-118
WP_000998048.1|517769_519308_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612589.1|519357_519705_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_001171530.1|519701_520082_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.6e-65
WP_000587146.1|520331_520556_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	67.1	9.5e-18
WP_000656486.1|520552_521455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000504369.1|521447_521690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078339.1|521710_521857_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	72.9	1.5e-16
WP_000447742.1|521864_522119_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	84.5	4.6e-37
WP_000063634.1|522152_523442_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	73.2	1.9e-187
WP_001061917.1|523486_524137_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_000876014.1|524336_527186_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
526820:526836	attR	CCAGAGAACCTCGCCAG	NA	NA	NA	NA
WP_000559125.1|527352_529179_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 18
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	543914	558010	5272286		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281242.1|543914_546542_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|546688_547411_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_032308636.1|547538_551255_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.6	1.4e-20
WP_001075177.1|551950_554236_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|554382_555513_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|555512_555767_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|555820_556471_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000768973.1|556933_558010_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 19
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	563903	564806	5272286	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140593.1|563903_564806_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.0	4.8e-68
>prophage 20
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	567958	572962	5272286		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|567958_568561_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001388277.1|568868_570008_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_000461661.1|570011_570980_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_000860259.1|570979_572962_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 21
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	607387	610615	5272286		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|607387_607987_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012906.1|608045_609878_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|609964_610615_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 22
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	621174	623035	5272286		Sodalis_phage(50.0%)	2	NA	NA
WP_000156144.1|621174_622065_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	1.5e-66
WP_001293612.1|622261_623035_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 23
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	627246	628764	5272286		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|627246_628764_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 24
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	644913	645999	5272286		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|644913_645999_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 25
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	663867	664800	5272286		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|663867_664800_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 26
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	673477	728024	5272286	capsid,portal,holin,integrase	Escherichia_phage(77.94%)	70	664876:664899	728220:728243
664876:664899	attL	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_000012445.1|673477_674743_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
WP_000540400.1|674753_675047_-	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_106913365.1|675056_675503_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	98.0	5.8e-75
WP_106913366.1|675505_676162_-	hypothetical protein	NA	G3CFP6	Escherichia_phage	99.1	6.9e-109
WP_001380385.1|676256_676610_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	99.1	9.9e-62
WP_106913367.1|676745_677942_-	hemagglutinin	NA	NA	NA	NA	NA
WP_000078907.1|678292_678433_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000197193.1|678634_680401_-	DUF1983 domain-containing protein	NA	A0A2R2Z364	Escherichia_phage	96.6	2.7e-192
WP_042964415.1|680397_682023_-	hypothetical protein	NA	G9L6L3	Escherichia_phage	98.9	0.0e+00
WP_000864635.1|682372_682846_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	89.2	5.4e-79
WP_032308943.1|682934_684056_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	49.7	1.1e-61
WP_062872600.1|684548_685214_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	88.6	1.6e-108
WP_000117974.1|685485_687282_-	hypothetical protein	NA	A0A1I9LJS9	Stx_converting_phage	100.0	9.2e-63
WP_000207914.1|687278_687929_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	95.3	7.6e-116
WP_000829201.1|687928_688492_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_042965323.1|688475_688937_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	99.3	6.6e-74
WP_001140444.1|688986_689376_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|689431_690646_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345012.1|690669_691677_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.4	8.8e-180
WP_106913362.1|691833_693978_-|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.2	0.0e+00
WP_000143996.1|693977_695684_-	hypothetical protein	NA	G9L6K0	Escherichia_phage	98.9	0.0e+00
WP_001086080.1|695664_696516_-	hypothetical protein	NA	A0A2L1IV66	Escherichia_phage	80.9	1.9e-95
WP_012816804.1|697597_697783_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000087720.1|698334_698868_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	3.3e-101
WP_000284510.1|698872_699088_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290232.1|699164_699437_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	97.8	7.2e-20
WP_032320589.1|699462_699645_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	88.3	2.3e-22
WP_000874434.1|699790_701815_-	DUF1737 domain-containing protein	NA	A0A0P0ZGE0	Escherichia_phage	63.0	5.4e-237
WP_062863667.1|702597_702750_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	98.0	8.9e-20
WP_062863668.1|703214_704045_-	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	88.0	7.6e-129
WP_032308962.1|704080_704275_-	protein ninH	NA	G9L694	Escherichia_phage	96.9	7.1e-30
WP_032308963.1|704271_704835_-	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	98.4	2.9e-103
WP_000402093.1|704842_705292_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_032308964.1|705291_706263_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	97.8	1.4e-190
WP_062877173.1|706252_707773_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	99.4	2.7e-305
WP_001271433.1|707766_708144_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001369601.1|708310_708505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|708675_708879_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|708974_709688_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_000939558.1|709782_711252_+	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001064714.1|711248_712202_+	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_106913368.1|712819_713605_+	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	95.0	1.1e-137
WP_000917252.1|713675_713888_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_024258145.1|713959_714181_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	7.1e-34
WP_044191085.1|714201_714483_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	98.9	4.2e-47
WP_106913369.1|714500_715451_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	98.4	7.3e-176
WP_000187063.1|715447_716137_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_033805714.1|716136_716724_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.0	5.8e-107
WP_001071603.1|716798_717146_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_106913370.1|717209_718031_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	98.5	2.8e-147
WP_073547251.1|718107_718551_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	99.3	8.6e-79
WP_106913371.1|718658_719537_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	99.0	9.4e-178
WP_000157000.1|719533_719737_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476216.1|719729_719969_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_106913372.1|719965_720511_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	61.0	3.5e-13
WP_032298844.1|720617_721232_+	DUF551 domain-containing protein	NA	H6WZG0	Escherichia_phage	49.8	3.3e-44
WP_000002114.1|721224_721509_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	95.7	5.0e-48
WP_073547257.1|721557_722298_+	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	83.5	1.1e-105
WP_072096802.1|722340_722646_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	99.0	9.8e-50
WP_032276320.1|722735_722933_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	98.5	9.2e-33
WP_001260981.1|723061_723319_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	98.8	2.8e-37
WP_000211992.1|723643_724321_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_106913373.1|724371_724779_+	regulator	NA	A0A2R2Z303	Escherichia_phage	97.0	1.1e-67
WP_000163444.1|724788_725415_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_001291843.1|725374_725587_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994795.1|725622_726012_+	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	100.0	2.1e-52
WP_106913374.1|726155_726389_+	hypothetical protein	NA	G3CFG9	Escherichia_phage	98.7	4.4e-34
WP_000497812.1|726376_726628_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000405131.1|726688_726871_+	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_001218303.1|726854_728024_-|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	99.7	2.2e-230
728220:728243	attR	GTCCTCTTAGTTAAATGGATATAA	NA	NA	NA	NA
>prophage 27
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	731184	732618	5272286		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|731184_732618_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 28
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	743971	748203	5272286	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_106913375.1|743971_745244_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.5e-171
WP_000955028.1|745494_746439_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283496.1|746508_748203_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.1	4.4e-22
>prophage 29
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	751894	752815	5272286		Morganella_phage(100.0%)	1	NA	NA
WP_000484402.1|751894_752815_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	2.2e-76
>prophage 30
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	756633	757368	5272286		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|756633_757368_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 31
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	783682	799052	5272286		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|783682_785698_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001368261.1|785768_786755_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|786984_787746_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|787930_788902_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|789285_789543_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|789587_791315_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|791355_791865_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|791906_792758_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|792862_793231_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|793233_794145_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|794278_795376_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|795365_796241_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|796240_797074_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290224.1|797073_798090_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517431.1|798260_799052_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 32
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	802530	807468	5272286		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|802530_803835_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|803892_804792_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|804887_805463_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001325675.1|805523_805973_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|805959_806385_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|806598_807468_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 33
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	826021	826972	5272286		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|826021_826972_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 34
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	845019	845733	5272286		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|845019_845733_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 35
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	867030	871032	5272286		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|867030_868320_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|868405_869032_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001299062.1|869356_870394_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.0	6.3e-72
WP_001028614.1|870393_871032_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 36
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	877465	883762	5272286		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|877465_877639_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_062863560.1|877952_878468_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	98.8	1.9e-61
WP_000755158.1|878483_879023_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	97.8	2.9e-44
WP_000138282.1|879117_880695_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|880763_882230_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|882391_883762_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 37
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	892591	893023	5272286		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|892591_893023_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 38
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	903685	910142	5272286		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133579.1|903685_904969_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.9e-34
WP_000523616.1|905146_905347_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|905358_905694_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|905695_907546_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|907562_908078_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|908173_908497_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|908513_908900_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|908927_910142_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 39
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	925248	926760	5272286		Staphylococcus_phage(100.0%)	1	NA	NA
WP_106913377.1|925248_926760_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 40
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	932518	943808	5272286		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|932518_933772_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|934099_935290_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|935334_935673_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|935733_937068_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001345753.1|937057_937771_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|937935_939363_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970116.1|939920_943808_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	1.2e-131
>prophage 41
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	947927	948188	5272286		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|947927_948188_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 42
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	951646	955389	5272286		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|951646_952327_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|952599_953574_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|953589_955389_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 43
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	960291	1042837	5272286	capsid,head,lysis,portal,tRNA,transposase,integrase,plate,tail,terminase	Salmonella_phage(73.47%)	86	1004952:1004997	1039115:1039160
WP_001298974.1|960291_961029_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|961160_962495_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|962703_963585_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|963687_964275_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|964330_964714_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|965018_965708_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|965755_966793_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|966999_967419_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001343689.1|967487_968186_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082950.1|968217_970878_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|970991_972347_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|972392_972716_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001235102.1|980639_983213_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|983342_984074_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|984070_985051_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|985185_985923_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|986193_986535_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|986638_986686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|986784_987945_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|987987_989109_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|989119_990190_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_001368400.1|990399_990765_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212408.1|990914_991433_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969014.1|991422_992649_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|992664_993147_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|993223_993571_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|993612_994380_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|994410_994959_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|994977_995226_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|995474_996836_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|997002_997794_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|997814_999101_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|999155_999749_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|999871_1000750_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|1000835_1002497_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1002645_1002987_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|1003048_1003339_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|1003328_1003805_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1003936_1004419_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1004952:1004997	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000391794.1|1005119_1005602_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|1005628_1005847_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_001011753.1|1005915_1007016_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	1.2e-177
WP_000980391.1|1007012_1007498_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_001282733.1|1007494_1010572_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.4	0.0e+00
WP_000763311.1|1010564_1010684_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|1010698_1011001_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000046140.1|1011578_1012751_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	2.7e-204
WP_000905028.1|1012893_1013460_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	4.2e-86
WP_106913378.1|1015098_1016358_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	83.4	3.8e-188
WP_001086829.1|1016354_1016960_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	8.9e-111
WP_000268272.1|1016952_1017861_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177590.1|1017847_1018207_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993754.1|1018203_1018782_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000829135.1|1018850_1019297_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	2.5e-62
WP_001039936.1|1019289_1019721_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_001368405.1|1019816_1020245_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	4.9e-47
WP_000727858.1|1020241_1020619_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	7.9e-17
WP_001442491.1|1020620_1021094_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|1021113_1021329_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|1021332_1021536_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|1021535_1022000_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059200.1|1022095_1022746_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000742526.1|1022749_1023808_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	7.6e-182
WP_000216252.1|1023824_1024658_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	4.1e-122
WP_062863571.1|1024800_1026567_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520362.1|1026566_1027601_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.3	2.4e-172
WP_000961024.1|1027638_1028487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368407.1|1028496_1029159_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000106358.1|1029178_1029988_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_001217575.1|1030351_1030585_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|1030595_1030784_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_062863572.1|1030937_1033352_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_000104159.1|1033348_1034206_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	3.2e-162
WP_000145290.1|1034202_1034505_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752625.1|1034501_1034729_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.0e-35
WP_001244163.1|1034728_1034962_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000996716.1|1035029_1035371_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	3.9e-55
WP_000956176.1|1035488_1035785_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460849.1|1035792_1036302_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
WP_000102105.1|1036334_1036577_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932271.1|1036698_1037331_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.9	3.7e-59
WP_000218400.1|1037333_1038350_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.7	2.8e-189
WP_001083624.1|1038360_1039029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|1040598_1041812_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
1039115:1039160	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_001120794.1|1042344_1042464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524906.1|1042618_1042837_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 44
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1052287	1056339	5272286		Klosneuvirus(50.0%)	4	NA	NA
WP_000097662.1|1052287_1053568_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_001295173.1|1053805_1055206_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|1055226_1055889_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|1055889_1056339_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 45
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1060274	1065571	5272286		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|1060274_1060520_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|1060516_1060927_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246510.1|1060899_1063044_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	2.4e-195
WP_000777969.1|1063053_1064013_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985499.1|1064368_1065571_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	3.8e-28
>prophage 46
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1078620	1084180	5272286	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|1078620_1078806_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|1079040_1081671_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|1081798_1082299_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_062863587.1|1082541_1083603_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132235.1|1083682_1084180_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.5e-31
>prophage 47
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1089646	1090612	5272286		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287446.1|1089646_1090612_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 48
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1098087	1099101	5272286		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001355855.1|1098087_1099101_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	2.3e-26
>prophage 49
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1119448	1126588	5272286		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|1119448_1122010_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|1122115_1122772_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001368390.1|1122822_1123590_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	7.4e-70
WP_000847985.1|1123785_1124694_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|1124690_1125953_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1125949_1126588_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 50
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1131802	1135518	5272286		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|1131802_1132795_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|1132857_1133997_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|1134136_1134763_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|1134756_1135518_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 51
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1138630	1140663	5272286		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|1138630_1139236_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090383.1|1139235_1140663_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	3.7e-30
>prophage 52
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1164531	1165317	5272286		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|1164531_1165317_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 53
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1169483	1174403	5272286		Vibrio_phage(33.33%)	5	NA	NA
WP_001199970.1|1169483_1170155_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|1170293_1170434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268443.1|1170447_1171320_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|1171379_1172678_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|1172765_1174403_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 54
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1178435	1185483	5272286		Erysipelothrix_phage(33.33%)	4	NA	NA
WP_000046800.1|1178435_1179737_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|1179793_1182550_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000098270.1|1182781_1184122_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_000211812.1|1184142_1185483_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.3	3.5e-06
>prophage 55
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1190084	1190933	5272286		Vibrio_phage(100.0%)	1	NA	NA
WP_000100393.1|1190084_1190933_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 56
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1195791	1196547	5272286		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|1195791_1196547_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 57
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1208073	1223460	5272286	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001307370.1|1208073_1209279_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	2.3e-73
WP_000184253.1|1209278_1209722_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|1209772_1210579_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678651.1|1210655_1211753_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|1212332_1213586_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237948.1|1213817_1215149_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775946.1|1215210_1217037_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_001285985.1|1217036_1220579_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_001138205.1|1220571_1223460_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 58
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1228936	1235709	5272286		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|1228936_1229731_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|1229737_1230613_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|1230763_1233010_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|1233022_1233553_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|1234237_1234927_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|1234995_1235709_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 59
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1245340	1247835	5272286		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|1245340_1246759_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603517.1|1247073_1247835_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 60
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1264227	1265501	5272286	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085949146.1|1264227_1265501_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
>prophage 61
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1273534	1280870	5272286		Stx2-converting_phage(33.33%)	10	NA	NA
WP_001204826.1|1273534_1273927_-	antitermination protein	NA	A0A0P0ZCW9	Stx2-converting_phage	89.7	2.0e-63
WP_001227788.1|1274668_1274881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197494.1|1275110_1275572_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001241340.1|1275666_1276053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032308721.1|1276503_1276797_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001076061.1|1276765_1277233_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	46.8	1.9e-12
WP_000126671.1|1277249_1277699_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000868602.1|1277695_1277938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024178270.1|1277941_1278265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833605.1|1278731_1280870_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	42.7	1.7e-127
>prophage 62
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1284726	1288261	5272286	integrase	Vibrio_phage(33.33%)	4	1281049:1281062	1289342:1289355
1281049:1281062	attL	ATTGTTCGCCGCGT	NA	NA	NA	NA
WP_000069484.1|1284726_1284924_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.3	7.8e-08
WP_001123241.1|1285171_1285876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368189.1|1285974_1287189_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.1	5.9e-138
WP_001272558.1|1287505_1288261_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
1289342:1289355	attR	ATTGTTCGCCGCGT	NA	NA	NA	NA
>prophage 63
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1312540	1327932	5272286	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280215.1|1312540_1313941_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|1313958_1315275_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1315310_1316678_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|1316713_1317202_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001355763.1|1317201_1319121_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|1319556_1321005_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|1321006_1321132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1321128_1321200_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192803.1|1321254_1321803_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|1321845_1323363_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1323372_1324471_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813168.1|1324561_1326295_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
WP_000715214.1|1326300_1327011_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1327035_1327932_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 64
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1331856	1337224	5272286		Pandoravirus(50.0%)	3	NA	NA
WP_024178269.1|1331856_1333290_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	4.4e-31
WP_024178268.1|1333346_1334090_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195023.1|1334350_1337224_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 65
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1345751	1346984	5272286		Catovirus(100.0%)	1	NA	NA
WP_106913385.1|1345751_1346984_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	4.3e-104
>prophage 66
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1364990	1365668	5272286		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|1364990_1365668_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 67
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1386669	1432119	5272286	transposase,integrase,protease,tRNA	Enterobacteria_phage(25.0%)	44	1383059:1383074	1437456:1437471
1383059:1383074	attL	TCTGCCGGAAAGGCTT	NA	NA	NA	NA
WP_001062128.1|1386669_1387824_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|1388259_1389654_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_000858396.1|1389730_1390228_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|1390322_1391030_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|1391109_1391841_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|1391853_1392804_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|1392912_1393476_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|1393475_1393892_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000399648.1|1394139_1395120_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001055620.1|1395346_1396327_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|1396344_1397049_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|1397066_1397633_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|1397629_1397920_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174751.1|1397927_1398521_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239939.1|1398513_1399650_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|1399804_1400812_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|1400928_1401975_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|1402150_1402870_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|1403053_1403380_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|1403379_1404099_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|1404259_1405312_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1405339_1405615_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001365878.1|1405679_1406759_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|1406960_1408217_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839764.1|1408266_1410402_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|1410799_1411507_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218781.1|1411885_1413151_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	5.8e-80
WP_000147021.1|1413406_1414450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|1414841_1415267_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1415263_1415614_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_085947598.1|1416720_1417882_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001033855.1|1417982_1418855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000572543.1|1418902_1419217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001380823.1|1419238_1419424_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000377254.1|1419476_1419971_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000555344.1|1420470_1421430_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_024210746.1|1423539_1424064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001380818.1|1424892_1425120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096852933.1|1425847_1427060_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.6	4.2e-168
WP_000253495.1|1428092_1428476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096852934.1|1428568_1429745_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.7	2.1e-103
WP_001368194.1|1429922_1430546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155955724.1|1431064_1431292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000258197.1|1431615_1432119_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	33.0	1.7e-06
1437456:1437471	attR	TCTGCCGGAAAGGCTT	NA	NA	NA	NA
>prophage 68
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1454179	1455352	5272286		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524934.1|1454179_1455352_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	2.7e-39
>prophage 69
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1477566	1478451	5272286		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|1477566_1478451_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 70
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1484294	1495117	5272286		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|1484294_1485122_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|1485321_1486248_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|1486298_1486556_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1486598_1488818_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|1488928_1490341_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|1490415_1491153_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|1491385_1493644_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183494.1|1494189_1494672_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|1494724_1495117_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 71
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1498944	1509906	5272286		Bacillus_virus(20.0%)	11	NA	NA
WP_033554192.1|1498944_1500837_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	2.0e-92
WP_000105733.1|1500865_1501447_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444760.1|1501446_1502274_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1502298_1502721_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|1502721_1503351_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|1503555_1505037_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|1505184_1505856_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442859.1|1505861_1507022_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001368207.1|1507990_1508764_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|1508821_1508992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|1509252_1509906_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 72
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1519421	1520855	5272286		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|1519421_1520855_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 73
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1525992	1527231	5272286	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|1525992_1527231_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 74
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1533613	1549797	5272286	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|1533613_1534627_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|1534864_1535080_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918823.1|1535190_1536936_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437378.1|1537130_1538972_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|1539049_1539556_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|1539809_1540574_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018000.1|1540850_1541474_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_106913386.1|1541627_1543148_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000627213.1|1543454_1544945_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|1544986_1545319_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212470.1|1545537_1546521_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082869.1|1546704_1549797_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	2.6e-158
>prophage 75
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1562218	1563184	5272286		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|1562218_1563184_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 76
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1588922	1591217	5272286		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1588922_1591217_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 77
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1599204	1600350	5272286		Streptococcus_phage(100.0%)	1	NA	NA
WP_001297158.1|1599204_1600350_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 78
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1623997	1627921	5272286		Streptococcus_phage(50.0%)	4	NA	NA
WP_000809273.1|1623997_1624858_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249157.1|1624921_1626958_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|1626915_1627311_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|1627330_1627921_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
>prophage 79
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1632916	1634211	5272286		Diadromus_pulchellus_ascovirus(50.0%)	3	NA	NA
WP_000189326.1|1632916_1633219_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.2	1.5e-13
WP_000449041.1|1633269_1633713_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|1633692_1634211_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
>prophage 80
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1638895	1640785	5272286		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1638895_1640785_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 81
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1646266	1652905	5272286		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|1646266_1648939_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|1648963_1650451_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|1650478_1650931_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|1651561_1652905_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 82
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1656986	1659859	5272286	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|1656986_1657835_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|1657924_1659859_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 83
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1666487	1667964	5272286		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|1666487_1667459_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|1667685_1667964_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 84
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1672032	1686826	5272286		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|1672032_1672842_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|1673051_1674029_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_106913387.1|1674042_1675029_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	4.3e-38
WP_000030005.1|1675049_1675616_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|1675612_1676188_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|1676156_1676714_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|1676720_1677446_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|1677493_1678927_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|1678949_1679237_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|1679354_1679846_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|1679891_1680746_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|1680742_1681015_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620404.1|1681227_1681860_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047087.1|1681856_1682585_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|1682581_1683235_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_042003650.1|1683464_1685801_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	4.9e-40
WP_001176896.1|1685896_1686826_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 85
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1693575	1698323	5272286		Salmonella_phage(50.0%)	5	NA	NA
WP_000445144.1|1693575_1694703_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|1694762_1695227_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209021.1|1695223_1696099_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|1696095_1696785_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|1696832_1698323_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 86
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1702028	1702526	5272286	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1702028_1702526_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 87
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1706492	1709017	5272286	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|1706492_1707860_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|1707949_1709017_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 88
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1725513	1726557	5272286		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1725513_1726557_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 89
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1737122	1738007	5272286		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|1737122_1738007_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 90
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1744347	1748501	5272286		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|1744347_1745373_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019649.1|1745440_1746622_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001307418.1|1746631_1747735_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078332.1|1747742_1748501_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	6.9e-20
>prophage 91
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1758833	1760305	5272286	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|1758833_1759343_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004432.1|1759357_1760305_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 92
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1780182	1785756	5272286		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|1780182_1781367_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|1781437_1783552_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|1783648_1784119_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1784215_1784590_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|1784715_1785003_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|1785010_1785370_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|1785369_1785756_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 93
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1791326	1800867	5272286		Tupanvirus(25.0%)	9	NA	NA
WP_000634793.1|1791326_1793240_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
WP_000057356.1|1793239_1794262_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|1794255_1794474_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|1794527_1795397_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|1795451_1795856_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|1796157_1796790_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001343408.1|1796840_1798931_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.3e-76
WP_000963797.1|1798997_1800218_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_033557547.1|1800303_1800867_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	6.0e-61
>prophage 94
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1825095	1825932	5272286		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1825095_1825932_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 95
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1842906	1846674	5272286		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|1842906_1844529_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|1844605_1845958_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|1845954_1846674_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 96
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1853237	1854116	5272286		Sodalis_phage(100.0%)	1	NA	NA
WP_000039090.1|1853237_1854116_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 97
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1860085	1862479	5272286		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1860085_1862479_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 98
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1866858	1868085	5272286		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105512.1|1866858_1868085_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	1.5e-133
>prophage 99
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1877315	1879763	5272286		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1877315_1879763_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 100
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1899774	1901585	5272286		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073609.1|1899774_1900518_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	8.3e-10
WP_000907790.1|1900514_1901585_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 101
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1905122	1906608	5272286		Planktothrix_phage(50.0%)	2	NA	NA
WP_001368330.1|1905122_1905839_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.2e-14
WP_000082101.1|1905840_1906608_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 102
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1912341	1915160	5272286		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|1912341_1913196_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|1913440_1914499_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|1914491_1915160_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 103
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1918166	1922298	5272286		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|1918166_1918793_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106536.1|1918866_1921065_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000130621.1|1921166_1921412_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|1921632_1922298_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 104
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1930191	1936074	5272286		Bacillus_virus(50.0%)	5	NA	NA
WP_000173666.1|1930191_1930998_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|1931003_1931405_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593552.1|1931524_1931884_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001216257.1|1932214_1933339_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_000149132.1|1933338_1936074_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 105
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1949488	1951531	5272286		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|1949488_1951531_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 106
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1954645	1956780	5272286		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|1954645_1954999_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|1955052_1956342_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065786.1|1956354_1956780_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
>prophage 107
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	1961651	1962299	5272286		Bacillus_virus(100.0%)	1	NA	NA
WP_001368331.1|1961651_1962299_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 108
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2009762	2011747	5272286		Bacillus_virus(50.0%)	2	NA	NA
WP_000107026.1|2009762_2010767_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|2010763_2011747_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 109
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2027497	2029831	5272286		Escherichia_phage(100.0%)	1	NA	NA
WP_000013948.1|2027497_2029831_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.5	2.4e-71
>prophage 110
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2033485	2033698	5272286		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|2033485_2033698_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 111
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2037922	2038918	5272286		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182672.1|2037922_2038918_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	1.2e-11
>prophage 112
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2044236	2045778	5272286		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|2044236_2045778_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 113
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2070741	2081432	5272286	tRNA	uncultured_Caudovirales_phage(66.67%)	7	NA	NA
WP_000582482.1|2070741_2072586_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
WP_000206275.1|2072582_2073974_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|2074071_2074680_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_064506874.1|2074908_2079144_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
WP_001271686.1|2079115_2079499_+	protein YhhH	NA	NA	NA	NA	NA
WP_000072855.1|2079603_2080446_+	lyase	NA	NA	NA	NA	NA
WP_001346013.1|2080598_2081432_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 114
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2103529	2114258	5272286		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|2103529_2103781_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001368341.1|2103922_2104354_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|2104598_2106143_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|2106152_2107436_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|2107439_2108399_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|2108385_2109420_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|2109658_2110684_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213855.1|2110693_2111890_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	7.1e-35
WP_001307464.1|2112164_2113037_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|2113325_2114258_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 115
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2126965	2131528	5272286		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|2126965_2127445_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|2127483_2128293_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|2128390_2128558_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|2128578_2128815_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|2129031_2129700_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|2129871_2131092_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|2131072_2131528_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 116
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2134868	2191831	5272286	transposase,integrase,protease,tRNA	Morganella_phage(15.79%)	44	2144683:2144698	2181944:2181959
WP_000158702.1|2134868_2136140_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	69.5	3.8e-172
WP_042964799.1|2136235_2137189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380339.1|2137358_2137565_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000509393.1|2137661_2138192_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	47.2	8.5e-25
WP_000916858.1|2138184_2138649_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001203999.1|2138641_2138938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000332872.1|2138930_2139245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204662.1|2139237_2140281_+	topoisomerase	NA	A0A1B0VML8	Pseudomonas_phage	49.5	4.9e-40
WP_000198858.1|2140261_2142100_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	37.1	1.1e-100
WP_001370963.1|2142799_2143090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074017404.1|2143506_2143761_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_050554298.1|2143772_2144069_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001005467.1|2144158_2144566_+	hypothetical protein	NA	NA	NA	NA	NA
2144683:2144698	attL	GATAATTTGTTTTTTG	NA	NA	NA	NA
WP_001297374.1|2145445_2146270_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_000924289.1|2146561_2147179_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001368338.1|2147175_2148858_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.9e-22
WP_001295237.1|2149115_2149739_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|2149793_2150069_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|2150087_2152196_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_001070177.1|2152202_2152892_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678446.1|2152897_2154979_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000747337.1|2154963_2155830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468836.1|2155832_2157038_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|2157317_2158709_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001368327.1|2158829_2160539_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702898.1|2160591_2162910_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|2162919_2164302_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218908.1|2164988_2166173_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_085948812.1|2166506_2167714_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.0e-97
WP_085949146.1|2167789_2169062_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_062863434.1|2169138_2169411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264907.1|2169444_2169636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368516.1|2169645_2170011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032308929.1|2170502_2174594_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.5	3.3e-310
WP_000634452.1|2175506_2176244_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001223361.1|2177075_2179163_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	3.4e-08
WP_000593013.1|2179508_2181353_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
WP_032308933.1|2182721_2183753_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	1.8e-18
2181944:2181959	attR	CAAAAAACAAATTATC	NA	NA	NA	NA
WP_000916806.1|2184023_2184467_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705929.1|2184482_2184770_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|2184782_2186039_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001254932.1|2187527_2188679_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_062895918.1|2189528_2191070_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	8.3e-129
WP_001016257.1|2191084_2191831_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
>prophage 117
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2198600	2201288	5272286		Cronobacter_phage(100.0%)	1	NA	NA
WP_000431136.1|2198600_2201288_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.7	5.7e-93
>prophage 118
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2207450	2209763	5272286	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001171530.1|2207450_2207831_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.6e-65
WP_000612589.1|2207827_2208175_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_000998048.1|2208224_2209763_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 119
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2227258	2229668	5272286		Yersinia_phage(33.33%)	5	NA	NA
WP_001241714.1|2227258_2228080_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.8	1.5e-44
WP_001367430.1|2228079_2228280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000855069.1|2228413_2228887_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	1.9e-12
WP_001186704.1|2228901_2229378_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692313.1|2229446_2229668_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
>prophage 120
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2238462	2239797	5272286		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|2238462_2239797_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 121
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2247101	2256263	5272286		Micromonas_sp._RCC1109_virus(25.0%)	11	NA	NA
WP_000168480.1|2247101_2248790_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|2248895_2248994_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000454297.1|2248980_2249271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060506.1|2249558_2249648_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001368517.1|2250066_2251251_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000148037.1|2251258_2251756_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|2251752_2252115_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|2252104_2252452_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|2252561_2253011_+	membrane protein	NA	NA	NA	NA	NA
WP_032308656.1|2253057_2254551_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.2	3.3e-29
WP_001087153.1|2254547_2256263_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	4.3e-41
>prophage 122
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2262616	2263570	5272286		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|2262616_2263045_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|2263156_2263570_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 123
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2267997	2269146	5272286		Oenococcus_phage(100.0%)	1	NA	NA
WP_024213531.1|2267997_2269146_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 124
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2273852	2281221	5272286		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|2273852_2276267_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|2276295_2277369_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|2277368_2278469_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|2278473_2279877_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|2280173_2280254_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|2280483_2280624_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|2280640_2281000_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|2280963_2281221_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 125
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2291418	2292756	5272286		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|2291418_2292756_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 126
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2303745	2307586	5272286		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|2303745_2304519_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|2304609_2305500_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|2305499_2306459_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|2306545_2307586_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 127
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2313117	2316479	5272286		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|2313117_2314947_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_062863519.1|2315108_2316479_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 128
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2328431	2329424	5272286		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845133.1|2328431_2329424_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 129
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2332592	2338445	5272286		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|2332592_2334461_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001297694.1|2334627_2335047_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387753.1|2335054_2336560_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000211856.1|2336564_2337530_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|2337554_2338445_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 130
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2351834	2353481	5272286		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012602.1|2351834_2353481_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.4e-65
>prophage 131
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2361896	2367308	5272286		Bacillus_phage(33.33%)	4	NA	NA
WP_001238890.1|2361896_2363918_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001299253.1|2363964_2365449_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2365582_2366848_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2366978_2367308_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 132
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2371350	2377494	5272286		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|2371350_2372481_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006625.1|2372477_2373740_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226587.1|2373739_2374807_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000676056.1|2374825_2375707_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145194.1|2375684_2376359_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612023.1|2376363_2377494_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 133
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2396014	2399873	5272286		Bacillus_phage(100.0%)	3	NA	NA
WP_000130701.1|2396014_2396911_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|2396910_2397627_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383389.1|2397710_2399873_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 134
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2407357	2409187	5272286		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2407357_2409187_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 135
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2421599	2424886	5272286		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|2421599_2423240_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|2423318_2423588_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|2423591_2424107_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|2424109_2424886_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 136
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2434955	2435570	5272286		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|2434955_2435570_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 137
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2449253	2452040	5272286		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2449253_2452040_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 138
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2456118	2458589	5272286		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|2456118_2457528_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2457539_2458589_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 139
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2465759	2470490	5272286		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|2465759_2466548_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_000160873.1|2466587_2467484_-	sugar kinase	NA	NA	NA	NA	NA
WP_001299483.1|2467656_2468535_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000094544.1|2468559_2469447_+	aldolase	NA	NA	NA	NA	NA
WP_000357967.1|2469479_2470490_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 140
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2483214	2486265	5272286		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|2483214_2486265_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 141
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2501040	2505901	5272286		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|2501040_2501661_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|2501920_2502904_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|2503052_2503727_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2503832_2505206_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2505202_2505901_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 142
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2517475	2521978	5272286		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|2517475_2518321_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2518745_2518991_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2519075_2519561_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2519653_2520580_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|2520646_2521978_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 143
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2527615	2531800	5272286		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_064506899.1|2527615_2531800_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
>prophage 144
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2544792	2552039	5272286		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|2544792_2545455_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174083.1|2545466_2547968_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|2548276_2549356_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|2549370_2549691_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184843.1|2549741_2552039_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 145
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2564157	2565372	5272286		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|2564157_2565372_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 146
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2572112	2573957	5272286		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591366.1|2572112_2573957_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 147
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2582462	2585515	5272286		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|2582462_2583413_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|2584330_2585515_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 148
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2589631	2597960	5272286		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2589631_2593660_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|2593736_2597960_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 149
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2607176	2608940	5272286		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|2607176_2607848_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|2607890_2608481_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|2608667_2608940_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 150
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2614308	2615898	5272286		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|2614308_2615898_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 151
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2631268	2634952	5272286		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|2631268_2634952_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 152
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2640602	2641394	5272286		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130528.1|2640602_2641394_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.6	1.5e-46
>prophage 153
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2657201	2658317	5272286		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2657201_2658317_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 154
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2667532	2668141	5272286		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2667532_2668141_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 155
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2674737	2676153	5272286		Escherichia_phage(100.0%)	1	NA	NA
WP_000918372.1|2674737_2676153_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 156
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2681491	2685104	5272286		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2681491_2684314_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2684567_2685104_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 157
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2688921	2690271	5272286		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2688921_2690271_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 158
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2695855	2697814	5272286		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2695855_2697814_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 159
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2707097	2709245	5272286		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2707097_2709245_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 160
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2714490	2716476	5272286		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|2714490_2716476_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 161
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2720461	2722077	5272286		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611419.1|2720461_2721142_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	3.2e-08
WP_001075526.1|2721318_2722077_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 162
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2727681	2728470	5272286		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|2727681_2728470_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 163
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2733308	2734811	5272286		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|2733308_2734811_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 164
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2756006	2824987	5272286	transposase,tRNA	Stx2-converting_phage(20.0%)	58	NA	NA
WP_001295074.1|2756006_2757524_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|2757760_2759218_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295383.1|2759276_2761424_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|2761503_2762838_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|2763203_2764742_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000779483.1|2765623_2765950_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|2765946_2766210_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_106913398.1|2766281_2767148_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839256.1|2767232_2767430_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761662.1|2767441_2767930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854896.1|2767926_2768304_-	toxin	NA	NA	NA	NA	NA
WP_024175300.1|2768350_2768725_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692358.1|2768887_2769109_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186727.1|2769171_2769648_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214386.1|2769663_2770149_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	9.9e-12
WP_001234751.1|2770238_2771057_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	8.8e-45
WP_001117568.1|2771147_2771381_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_062863428.1|2771451_2774298_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_085949146.1|2774446_2775719_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_000634450.1|2775908_2776646_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001228922.1|2778795_2779932_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	1.8e-117
WP_000401034.1|2780027_2781725_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001032733.1|2781793_2782051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001367551.1|2782271_2782487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525616.1|2782899_2783091_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878008.1|2783232_2784252_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_136750695.1|2785026_2785188_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_062863585.1|2785362_2787333_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977392.1|2787351_2788143_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_000021267.1|2788732_2789362_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.2	3.3e-52
WP_001096212.1|2789543_2791331_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001124813.1|2791518_2792739_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.6	1.6e-63
WP_062863584.1|2792864_2793695_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_001237806.1|2793856_2794045_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000545469.1|2794063_2794636_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001165712.1|2794692_2795169_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	45.9	6.1e-30
WP_000935977.1|2795231_2795438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700770.1|2795565_2796768_-	hypothetical protein	NA	Q9MCI8	Enterobacteria_phage	62.5	1.0e-41
WP_085949146.1|2798434_2799707_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_096853275.1|2800297_2801968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835435.1|2804137_2806285_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	7.7e-24
WP_033806437.1|2806289_2807558_-	TolC family protein	NA	NA	NA	NA	NA
WP_000912969.1|2809053_2810097_+	subtilase AB5 cytotoxin subunit A	NA	NA	NA	NA	NA
WP_024166125.1|2810113_2810536_+	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	44.3	3.6e-26
WP_001367443.1|2810850_2811837_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.5	1.8e-108
WP_001282578.1|2811937_2812672_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_001058128.1|2812707_2813631_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000865294.1|2813692_2814802_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001380660.1|2814814_2815525_-	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000948499.1|2815570_2816401_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000376548.1|2816404_2817877_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000629093.1|2817925_2818801_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001149831.1|2818833_2819751_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000224561.1|2820654_2821341_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.0	1.9e-29
WP_000005864.1|2821452_2822400_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000998048.1|2822674_2824213_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612589.1|2824262_2824610_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_001171530.1|2824606_2824987_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.6e-65
>prophage 165
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2828639	2830130	5272286		Escherichia_phage(100.0%)	1	NA	NA
WP_000009550.1|2828639_2830130_+	AAA family ATPase	NA	A0A1Q1N957	Escherichia_phage	30.8	8.5e-46
>prophage 166
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2841041	2843025	5272286		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|2841041_2841335_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2841378_2843025_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 167
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2847536	2848070	5272286		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|2847536_2848070_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 168
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2852990	2853968	5272286		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2852990_2853968_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 169
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2861953	2862499	5272286		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2861953_2862499_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 170
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2866414	2879445	5272286	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990321.1|2866414_2867752_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122507.1|2867761_2869609_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2869601_2870552_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2870637_2870946_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2871021_2872302_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312489.1|2872387_2873647_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2873649_2874654_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2874735_2874933_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2875036_2876335_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|2876539_2876965_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|2877003_2879445_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 171
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2927359	2933847	5272286		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|2927359_2927890_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|2928199_2929156_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210554.1|2929295_2930798_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001368084.1|2930811_2931834_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000595979.1|2931820_2932816_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|2932848_2933847_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 172
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2938162	2940923	5272286		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|2938162_2938627_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|2938784_2940923_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 173
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2944545	2950642	5272286		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|2944545_2945493_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|2945677_2945731_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|2945871_2948568_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|2948773_2949160_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2949232_2949694_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013041.1|2949706_2950642_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 174
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2958919	2967933	5272286	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_000416395.1|2958919_2961775_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001188289.1|2961774_2962257_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|2962351_2963863_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_029800526.1|2964129_2965230_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|2965229_2966312_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294550.1|2966430_2967933_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
>prophage 175
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	2973062	2989117	5272286	integrase	Enterobacteria_phage(66.67%)	16	2971247:2971261	2999231:2999245
2971247:2971261	attL	CTTAGAAAACAAGCT	NA	NA	NA	NA
WP_001368097.1|2973062_2974082_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	3.2e-44
WP_001357997.1|2975899_2976694_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	28.6	8.3e-08
WP_001357996.1|2976721_2977789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000931915.1|2977791_2978193_-	protein gop	NA	NA	NA	NA	NA
WP_001660389.1|2978603_2979176_-	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638628.1|2979249_2979750_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283017.1|2979746_2980481_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	9.4e-131
WP_001149160.1|2981032_2981299_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980250.1|2981295_2981895_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001244665.1|2981887_2982175_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459302.1|2982167_2982623_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|2982758_2983079_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783660.1|2983093_2985427_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.2	0.0e+00
WP_044815386.1|2985772_2985967_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001218329.1|2986182_2987448_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_001022619.1|2987647_2989117_-	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
2999231:2999245	attR	AGCTTGTTTTCTAAG	NA	NA	NA	NA
>prophage 176
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3000470	3002618	5272286		uncultured_virus(100.0%)	1	NA	NA
WP_001040175.1|3000470_3002618_-	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
>prophage 177
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3007716	3008697	5272286		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991447.1|3007716_3008697_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	3.9e-100
>prophage 178
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3012057	3013734	5272286		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|3012057_3012660_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|3013137_3013734_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 179
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3024000	3025461	5272286		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|3024000_3025461_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 180
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3032028	3032583	5272286		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|3032028_3032583_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 181
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3040084	3041029	5272286	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181160.1|3040084_3041029_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	3.8e-60
>prophage 182
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3061043	3066408	5272286		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919594.1|3061043_3062708_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410127.1|3062756_3064118_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|3064332_3065247_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|3065385_3066408_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 183
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3069634	3070914	5272286		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|3069634_3070372_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098813.1|3070374_3070914_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 184
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3079103	3175193	5272286	protease,lysis,portal,holin,tRNA,transposase,integrase,tail,terminase	Enterobacteria_phage(28.79%)	104	3073708:3073722	3102126:3102140
3073708:3073722	attL	TGTCGCGGATCTCAT	NA	NA	NA	NA
WP_001218299.1|3079103_3080339_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.0	3.8e-233
WP_001105425.1|3080497_3081631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008238.1|3082069_3082606_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.2	1.3e-97
WP_000081297.1|3082734_3083559_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000135680.1|3083624_3083987_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001020631.1|3084766_3085459_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	1.4e-120
WP_001191670.1|3085556_3085817_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
WP_000515856.1|3085809_3086361_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	100.0	3.4e-101
WP_001087315.1|3086357_3087521_+	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	79.3	2.4e-168
WP_000620686.1|3087517_3087742_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	91.9	8.5e-35
WP_000995577.1|3087738_3088038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092421.1|3088034_3089018_+	hypothetical protein	NA	Q8SBF1	Shigella_phage	98.1	6.0e-56
WP_072108178.1|3089014_3089509_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	5.6e-87
WP_062863449.1|3089508_3090162_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.2	4.7e-126
WP_000210181.1|3090158_3090485_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_000767110.1|3090481_3090877_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072668.1|3091039_3091855_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.9	3.2e-148
WP_001368056.1|3091862_3092852_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001047117.1|3092865_3093618_+	antitermination protein	NA	Q8SBE4	Shigella_phage	97.6	1.1e-134
WP_001368064.1|3094024_3094984_+	Shiga toxin Stx2b subunit A	NA	G8GYD2	Escherichia_phage	97.5	9.3e-171
WP_000719322.1|3094996_3095260_+	Shiga toxin Stx2b subunit B	NA	G8GYD3	Escherichia_phage	100.0	1.7e-42
WP_106888780.1|3095778_3097755_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	69.6	1.0e-264
WP_001379752.1|3097905_3098088_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	96.7	2.2e-25
WP_000005635.1|3098113_3098398_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	62.8	3.6e-06
WP_000284505.1|3098473_3098689_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	1.5e-33
WP_001368066.1|3098692_3099250_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	4.3e-51
WP_000551499.1|3099261_3099576_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	77.9	5.0e-41
WP_000992077.1|3099704_3100238_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	6.9e-99
WP_000675930.1|3100458_3100572_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	94.6	1.1e-11
WP_001082509.1|3100573_3101041_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	92.9	2.8e-72
WP_033800741.1|3101064_3101289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373398.1|3101710_3102187_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	98.7	1.8e-82
3102126:3102140	attR	ATGAGATCCGCGACA	NA	NA	NA	NA
WP_001077608.1|3102183_3104307_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|3104303_3104516_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|3104515_3106018_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114430.1|3105962_3107987_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.5	0.0e+00
WP_001097064.1|3108074_3108401_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	5.2e-49
WP_001281347.1|3108393_3108675_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_000974953.1|3108677_3109301_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	9.8e-105
WP_000682716.1|3109313_3109712_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235131.1|3109719_3110469_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	5.6e-131
WP_000479069.1|3110488_3110920_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	6.9e-41
WP_044809160.1|3110946_3111351_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	9.0e-43
WP_158707276.1|3112294_3112933_+	hypothetical protein	NA	A0A0K2FI43	Enterobacteria_phage	99.1	4.5e-105
WP_158707284.1|3112933_3113935_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	75.4	3.3e-118
WP_000847298.1|3113931_3114261_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001368094.1|3114260_3114959_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	5.6e-133
WP_001380365.1|3114969_3115713_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	2.3e-148
WP_077632782.1|3115658_3116291_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_000514887.1|3116531_3119999_+	host specificity protein J	NA	S5MW25	Escherichia_phage	98.4	0.0e+00
WP_000078852.1|3120197_3120338_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_106888783.1|3120480_3121881_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	91.6	9.5e-148
WP_001367204.1|3121890_3122115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972077.1|3122111_3122786_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	1.9e-114
WP_000361566.1|3123160_3124312_+	hypothetical protein	NA	Q9LA53	Enterobacteria_phage	93.1	4.5e-79
WP_000864633.1|3124398_3124872_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	4.8e-88
WP_001217531.1|3125084_3125333_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	84.0	1.3e-31
WP_000202566.1|3125551_3127138_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|3127530_3128136_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3128262_3128424_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|3128545_3129619_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563058.1|3129615_3130398_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088379.1|3130712_3131576_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143253.1|3131547_3133098_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|3133355_3134135_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477808.1|3134261_3135584_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
WP_000816471.1|3135635_3136859_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224879.1|3136938_3137658_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566150.1|3137818_3138082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000105851.1|3138113_3139130_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|3139157_3139802_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|3139907_3140876_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|3140924_3142307_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|3142327_3143560_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3143866_3145534_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|3145744_3147682_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|3147771_3148098_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001297279.1|3148182_3148704_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942344.1|3148755_3149403_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|3149399_3150269_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3150479_3150953_+	protein CreA	NA	NA	NA	NA	NA
WP_001188666.1|3150965_3151655_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_001219614.1|3151654_3153079_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_000920308.1|3153136_3154489_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3154547_3155264_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|3155359_3155500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223164.1|3155899_3156586_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001386572.1|3156799_3156865_+	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001264697.1|3156945_3159408_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_000241660.1|3159409_3160342_+	homoserine kinase	NA	NA	NA	NA	NA
WP_000781063.1|3160342_3161629_+	threonine synthase	NA	NA	NA	NA	NA
WP_000738723.1|3161842_3162139_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|3162398_3163379_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000906203.1|3163570_3164347_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_001112601.1|3164416_3165847_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_106913401.1|3166125_3167079_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|3167193_3167781_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|3167814_3168381_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|3168529_3169243_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|3169268_3169673_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|3170049_3171966_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|3172054_3173185_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|3173288_3173498_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681359.1|3174026_3175193_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	4.4e-90
>prophage 185
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3182224	3185041	5272286	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|3182224_3185041_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 186
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3189447	3190596	5272286		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|3189447_3190596_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 187
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3196066	3201727	5272286		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|3196066_3197620_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349932.1|3197693_3198911_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|3199039_3200182_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|3200212_3201727_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 188
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3209622	3212376	5272286		Bacillus_phage(50.0%)	5	NA	NA
WP_000624375.1|3209622_3210102_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000998542.1|3210122_3210302_+	antitoxin	NA	NA	NA	NA	NA
WP_001248977.1|3210400_3210868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796362.1|3210903_3211503_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_000257193.1|3211527_3212376_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 189
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3220120	3225543	5272286		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|3220120_3223027_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035734.1|3223191_3225543_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 190
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3231875	3232574	5272286		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|3231875_3232574_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 191
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3245276	3247001	5272286		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_024213451.1|3245276_3247001_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.1e-36
>prophage 192
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3272974	3313615	5272286	head,transposase,integrase,plate,tail	Shigella_phage(63.89%)	54	3268031:3268045	3287009:3287023
3268031:3268045	attL	GAAAAACTCTCCGAC	NA	NA	NA	NA
WP_001217338.1|3272974_3274018_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
WP_000077537.1|3274588_3275119_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|3275309_3275558_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289282.1|3275559_3277650_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	1.5e-165
WP_000129798.1|3277726_3278659_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	44.1	3.5e-66
WP_000259979.1|3278661_3278883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057198.1|3278895_3279153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032320537.1|3279227_3279500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049300.1|3279504_3279798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129556.1|3279809_3280340_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_001368057.1|3280424_3281003_+	DUF5420 family protein	NA	NA	NA	NA	NA
WP_000564275.1|3281006_3281540_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	68.9	6.3e-68
WP_000465567.1|3281539_3282055_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	52.4	8.0e-44
WP_000973027.1|3282058_3282610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633436.1|3282606_3282939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000409990.1|3283076_3283364_+	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	48.9	1.8e-16
WP_001280089.1|3283344_3283584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032308652.1|3284431_3284944_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	43.1	3.6e-28
WP_000852377.1|3285013_3285439_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125307.1|3285510_3286011_+	lysozyme	NA	I7HDJ5	Xanthomonas_virus	41.9	1.0e-27
WP_122993908.1|3286045_3286474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122255.1|3286457_3286676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342744.1|3286686_3286914_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|3286894_3287203_+	DUF2730 family protein	NA	NA	NA	NA	NA
3287009:3287023	attR	GAAAAACTCTCCGAC	NA	NA	NA	NA
WP_001279080.1|3287199_3287490_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_001057665.1|3288073_3289738_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532594.1|3289737_3291327_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.3	7.2e-168
WP_000046903.1|3291310_3292642_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.6	3.5e-152
WP_000094812.1|3292763_3293237_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_000846115.1|3293412_3294546_+	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	53.0	2.1e-92
WP_001142976.1|3294545_3295493_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	65.9	7.4e-120
WP_001002043.1|3295536_3295914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104957.1|3295910_3296330_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	52.9	8.0e-34
WP_000627430.1|3296326_3296890_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	2.2e-42
WP_000207435.1|3296893_3297124_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_032308646.1|3297123_3298605_+|tail	tail protein	tail	A0A0C4UQS0	Shigella_phage	51.1	1.1e-130
WP_000015475.1|3298613_3298979_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000213222.1|3298993_3299470_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_001107491.1|3299597_3301652_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	39.4	1.1e-75
WP_000168758.1|3301638_3302997_+	DMT family permease	NA	A0A0C4UR32	Shigella_phage	31.2	4.2e-52
WP_000098563.1|3302980_3304105_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	47.7	3.7e-94
WP_072098124.1|3304094_3304709_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	49.7	8.0e-51
WP_000763303.1|3304701_3305139_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	57.6	1.6e-40
WP_001146842.1|3305138_3306221_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	52.6	1.5e-97
WP_000301574.1|3306211_3306772_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	7.9e-45
WP_032308645.1|3306771_3307683_+	hypothetical protein	NA	A0A0C4UQS2	Shigella_phage	58.7	7.1e-27
WP_024178248.1|3307717_3308239_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.0	1.6e-47
WP_001115258.1|3308360_3308585_-	hypothetical protein	NA	S4TP62	Salmonella_phage	56.2	2.9e-14
WP_000904930.1|3308794_3309355_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_074433801.1|3309454_3311497_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	81.3	1.1e-280
WP_000144787.1|3311644_3311827_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114107.1|3311862_3312108_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001310452.1|3312723_3312924_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528252.1|3312877_3313615_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.5	3.4e-104
>prophage 193
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3317672	3318224	5272286		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923735.1|3317672_3318224_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 194
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3326851	3328276	5272286		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|3326851_3328276_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 195
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3335926	3342394	5272286		Mamastrovirus(33.33%)	5	NA	NA
WP_001189600.1|3335926_3337477_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001307572.1|3337523_3339914_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|3340119_3340656_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|3340696_3341359_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|3341467_3342394_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 196
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3345706	3346558	5272286		Sodalis_phage(100.0%)	1	NA	NA
WP_001439410.1|3345706_3346558_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.6	6.1e-57
>prophage 197
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3357241	3364047	5272286	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|3357241_3358660_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|3358698_3359625_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|3359661_3360117_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396033.1|3360294_3360999_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|3361013_3361544_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001368063.1|3361617_3364047_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
>prophage 198
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3369290	3370088	5272286		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|3369290_3370088_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 199
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3375999	3376344	5272286		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|3375999_3376344_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 200
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3380273	3381698	5272286	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753945.1|3380273_3381698_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 201
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3393582	3394341	5272286		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|3393582_3394341_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 202
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3403169	3407285	5272286		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|3403169_3403766_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294774.1|3403802_3407285_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 203
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3420243	3421275	5272286		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|3420243_3421275_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 204
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3427932	3435785	5272286		Indivirus(25.0%)	9	NA	NA
WP_000997037.1|3427932_3428736_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
WP_000648603.1|3428732_3429647_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3429887_3430688_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211710.1|3430765_3431536_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3431583_3432942_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052751.1|3433013_3433769_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|3433802_3434525_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917888.1|3434521_3434989_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|3435053_3435785_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
>prophage 205
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3446258	3449024	5272286		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000614398.1|3446258_3449024_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.6	4.7e-82
>prophage 206
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3459988	3466444	5272286		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103297.1|3459988_3462130_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	1.3e-26
WP_000509097.1|3462205_3466444_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
>prophage 207
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3473622	3477541	5272286		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|3473622_3474201_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3474406_3475174_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225685.1|3475144_3475885_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|3476040_3476319_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|3476321_3476582_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543896.1|3476767_3477541_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	5.4e-20
>prophage 208
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3483369	3484536	5272286		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001316884.1|3483369_3484536_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.1e-31
>prophage 209
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3489213	3496795	5272286		Streptococcus_phage(50.0%)	6	NA	NA
WP_000749881.1|3489213_3490269_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|3490556_3491660_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893252.1|3491671_3492925_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001111349.1|3493241_3493652_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_062863451.1|3493630_3494587_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|3494596_3496795_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 210
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3515698	3519004	5272286		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001368472.1|3515698_3516565_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.6e-52
WP_001296896.1|3516728_3517322_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|3517333_3517570_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046304.1|3517678_3519004_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 211
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3524579	3535055	5272286	holin	Catovirus(33.33%)	5	NA	NA
WP_001159102.1|3524579_3526250_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089114.1|3526263_3527736_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001351501.1|3527749_3528337_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3528465_3530499_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001597640.1|3531071_3535055_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	1.4e-124
>prophage 212
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3551313	3552363	5272286		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692742.1|3551313_3552363_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
>prophage 213
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3567116	3568016	5272286		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952481.1|3567116_3568016_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
>prophage 214
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3572557	3576837	5272286		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177934.1|3572557_3575632_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.7	0.0e+00
WP_000805905.1|3575754_3576837_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.7	1.4e-191
>prophage 215
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3582247	3584208	5272286		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|3582247_3583198_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|3583194_3584208_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 216
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3587385	3588495	5272286		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3587385_3588495_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 217
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3598234	3599508	5272286	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085949146.1|3598234_3599508_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
>prophage 218
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3602860	3604018	5272286		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|3602860_3604018_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 219
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3611433	3612549	5272286		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|3611433_3612549_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 220
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3616838	3626810	5272286		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|3616838_3617750_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219312.1|3617874_3618783_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|3618925_3620110_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698917.1|3620235_3623379_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_062863595.1|3623375_3624578_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_000113933.1|3624767_3625457_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|3625514_3626810_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 221
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3633762	3642743	5272286	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|3633762_3634890_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007633.1|3634912_3635245_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.2e-10
WP_000934822.1|3635272_3637120_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3637130_3638102_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|3638230_3638578_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|3638754_3639639_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|3639937_3640477_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|3640627_3641077_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150473.1|3641080_3642184_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.5e-52
WP_001021161.1|3642272_3642743_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 222
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3666575	3671622	5272286	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|3666575_3667199_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3667324_3668599_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|3668786_3671141_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|3671349_3671622_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 223
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3674750	3675446	5272286		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|3674750_3675446_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 224
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3678769	3682316	5272286		Bacillus_phage(100.0%)	2	NA	NA
WP_001235596.1|3678769_3680542_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	1.2e-49
WP_001256180.1|3680534_3682316_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.1e-42
>prophage 225
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3691151	3694301	5272286		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3691151_3694301_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 226
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3701309	3709871	5272286		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|3701309_3701861_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|3701989_3703921_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|3703973_3704303_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|3704302_3704908_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|3705017_3706892_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|3707072_3707717_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250096.1|3707952_3708915_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801846.1|3708911_3709871_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	6.5e-15
>prophage 227
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3718115	3721075	5272286		Escherichia_phage(50.0%)	2	NA	NA
WP_001344274.1|3718115_3718457_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
WP_000083961.1|3718570_3721075_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
>prophage 228
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3725614	3798337	5272286	capsid,head,protease,lysis,portal,tRNA,transposase,integrase,tail,terminase	Enterobacteria_phage(50.88%)	81	3732426:3732485	3806615:3807382
WP_001157535.1|3725614_3726292_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
WP_001295323.1|3726278_3727058_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001300573.1|3727120_3727975_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|3728035_3728845_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|3728834_3729458_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|3729428_3730115_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
3732426:3732485	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_000580859.1|3734293_3735961_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|3735970_3737230_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001301143.1|3737240_3738056_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855361.1|3738052_3738946_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815545.1|3739082_3740150_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001368239.1|3740146_3740656_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|3740773_3741496_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|3741498_3741993_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|3742166_3743552_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|3743587_3744109_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3744216_3744429_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|3744430_3745297_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001315309.1|3745777_3746320_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|3746539_3747232_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001368238.1|3747262_3749872_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|3749884_3750892_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_024178274.1|3750902_3751418_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|3751420_3752053_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001298992.1|3752387_3753551_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000433946.1|3753406_3753778_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	82.8	2.5e-47
WP_000206810.1|3753777_3754083_-	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_001242707.1|3754082_3754445_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008165.1|3754435_3754972_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|3755099_3755924_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|3755989_3756352_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|3756822_3757338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|3757552_3758227_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|3758317_3758518_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|3758561_3759119_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|3759294_3759474_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001356227.1|3759463_3760405_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001300314.1|3760401_3760896_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	3.6e-86
WP_000066917.1|3760895_3761549_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210187.1|3761545_3761872_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767117.1|3761868_3762258_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_001061438.1|3762277_3763087_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_001360050.1|3763094_3764084_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001204780.1|3764101_3764485_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|3764674_3765772_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|3766360_3766576_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|3766575_3767073_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|3767289_3767472_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|3767562_3767856_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001298896.1|3768146_3768557_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|3768842_3769049_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|3769213_3769408_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453587.1|3769796_3770342_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_106913403.1|3770316_3772242_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000198149.1|3772238_3772445_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001368373.1|3772441_3774043_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
WP_000123334.1|3774023_3775343_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	3.7e-234
WP_001368365.1|3775352_3775685_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000063218.1|3775740_3776766_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158866.1|3776807_3777203_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
WP_000785283.1|3777214_3777568_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	96.6	8.4e-61
WP_000985116.1|3777579_3778158_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000683105.1|3778154_3778550_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001368370.1|3778557_3779298_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	7.3e-131
WP_000479169.1|3779313_3779736_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_096849140.1|3779762_3780014_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.7	2.6e-40
WP_085947772.1|3780034_3781247_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001167882.1|3781257_3781413_+	hypothetical protein	NA	A0A2R9YJK0	Escherichia_phage	92.3	1.3e-05
WP_000840358.1|3781405_3783967_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.2	0.0e+00
WP_000847345.1|3783963_3784293_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152667.1|3784292_3784991_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
WP_000140706.1|3784995_3785739_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.1e-147
WP_071525611.1|3785675_3786308_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	96.7	2.3e-93
WP_000515543.1|3786368_3789767_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_001230388.1|3789833_3790433_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_024178296.1|3790497_3793860_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885603.1|3793859_3794444_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|3794498_3795167_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937515.1|3795223_3795529_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	3.6e-12
WP_001226370.1|3795712_3797197_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201842.1|3797383_3798337_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
3806615:3807382	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCTGCCGGACGCAACCAGGCCAATCTGGATATCGCCGAAATTCGCCAGCAGCAGTCGGTAGTGAATTATGAACAGAAAATCCAGAACGCCTTTAAAGAAGTGGCAGATGCGCTGGCATTACGTCAAAGCCTGAACGATCAAATTAGCGCCCAGCAGCGTTATCTGGCATCGCTGCAAATTACTTTGCAACGGGCGCGGGCATTATATCAGCACGGCGCAGTAAGTTATCTGGAAGTGCTGGATGCCGAACGTTCGTTATTTGCAACCCGACAAACTTTACTTGACCTGAATTATGCCCGTCAGGTTAACGAAATTTCTTTATATACCGCACTTGGTGGCGGTTAGCAGCAATAACTTTTAACTCCAGGAGAGAATAAATGAAAAAAGCACTGCAAGTCGCAATGTTCAGTCTGTTTACCGTTATTGGCTTTAATGCCCAGGCTAACGAACATCATCATGAAACCATGAGCGAAGCACAACCACAGGTTATTAGTGCCACTGGCGAGGTAAAGGGTATTGATCTGGAAAGCAAAAAAATCACCATCCATCACGATCCGATTGCTGCTGTGAACTGGCCGGAGATGACCATGCGCTTTACCATCACCCCGCAGACGAAAATGAGTGAAATTAAAACCGGCGACAAAGTGGCGTTTAATTTTGTCCAGCAGGGCAACCTTTCTTTATTACAGGATATTAAAGTCAGCCAGTAA	NA	NA	NA	NA
>prophage 229
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3808632	3811776	5272286		Leptospira_phage(100.0%)	1	NA	NA
WP_000573943.1|3808632_3811776_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
>prophage 230
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3822702	3828745	5272286		Tupanvirus(50.0%)	3	NA	NA
WP_000077711.1|3822702_3826584_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.6	3.4e-62
WP_000096744.1|3826799_3827933_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140654.1|3827929_3828745_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 231
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3843887	3845108	5272286		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000029834.1|3843887_3845108_-	phosphoadenosine phosphosulfate reductase	NA	L0P6Z6	Lactobacillus_phage	32.5	2.3e-57
>prophage 232
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3848175	3850290	5272286		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|3848175_3849741_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|3849861_3850290_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 233
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3865715	3866363	5272286		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|3865715_3865925_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|3865979_3866363_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 234
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3871178	3873617	5272286		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|3871178_3872390_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231422.1|3872528_3873617_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 235
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3880627	3883210	5272286	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|3880627_3883210_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 236
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3890148	3893681	5272286		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367854.1|3890148_3891819_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	5.2e-76
WP_001207507.1|3891902_3892838_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|3892955_3893681_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 237
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3901577	3902657	5272286		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|3901577_3902657_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 238
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3906753	3908418	5272286		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337088.1|3906753_3908418_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.4e-84
>prophage 239
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3913044	3916858	5272286	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|3913044_3914991_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_106913407.1|3915193_3916858_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.7	0.0e+00
>prophage 240
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3921317	3922082	5272286		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|3921317_3922082_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 241
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3929513	3942234	5272286		Bacillus_phage(25.0%)	8	NA	NA
WP_000186103.1|3929513_3930191_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001297245.1|3930187_3932872_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_001297248.1|3932864_3933437_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087967.1|3933445_3935494_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_000741137.1|3935516_3937190_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|3937189_3937279_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|3937591_3937798_+	YbfA family protein	NA	NA	NA	NA	NA
WP_106888805.1|3938040_3942234_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
>prophage 242
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3947513	3950416	5272286		Hokovirus(50.0%)	2	NA	NA
WP_106913408.1|3947513_3948893_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.2	3.8e-56
WP_001032700.1|3948934_3950416_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.0	5.5e-45
>prophage 243
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3953794	3954586	5272286		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114021.1|3953794_3954586_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	4.9e-08
>prophage 244
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3990724	3994244	5272286		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|3990724_3991444_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951297.1|3991440_3992382_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	8.3e-23
WP_000784351.1|3992495_3992876_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|3993191_3994244_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 245
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	3998600	4005174	5272286		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|3998600_3999617_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096857.1|3999877_4001350_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|4001417_4002206_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|4002334_4002484_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113005.1|4002650_4003424_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604032.1|4003423_4004113_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|4004115_4005174_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 246
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4015528	4016818	5272286		Klosneuvirus(100.0%)	1	NA	NA
WP_001307065.1|4015528_4016818_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 247
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4023299	4024208	5272286		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4023299_4024208_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 248
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4034805	4050896	5272286	transposase	Anomala_cuprea_entomopoxvirus(14.29%)	14	NA	NA
WP_000996096.1|4034805_4036542_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001296990.1|4036534_4037530_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|4037532_4038204_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007102.1|4038432_4039797_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_000399648.1|4040067_4041048_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001145128.1|4041307_4041790_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_024178256.1|4041909_4044060_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	4.8e-42
WP_000386551.1|4044087_4045050_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|4045190_4046276_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|4046504_4046765_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146339.1|4047029_4047296_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990176.1|4047369_4048047_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430036.1|4048088_4050371_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|4050635_4050896_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 249
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4054436	4059661	5272286		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|4054436_4055159_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|4055155_4055815_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|4055953_4056700_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|4057103_4057607_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001368135.1|4057905_4058793_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|4059027_4059093_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|4059145_4059661_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 250
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4064658	4066251	5272286		Tupanvirus(100.0%)	1	NA	NA
WP_000961456.1|4064658_4066251_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	9.0e-62
>prophage 251
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4070143	4074274	5272286		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209382.1|4070143_4072576_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|4072581_4073481_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001350053.1|4073611_4074274_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	8.2e-25
>prophage 252
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4077592	4079464	5272286		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315369.1|4077592_4079464_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 253
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4090799	4092002	5272286		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4090799_4092002_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 254
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4100568	4109718	5272286		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|4100568_4100826_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|4100985_4101273_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189120.1|4101256_4101979_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|4102039_4102942_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|4103029_4103506_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126084.1|4103856_4104969_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996018.1|4105063_4106197_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093858.1|4106206_4107160_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|4107156_4108002_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|4108061_4108550_+	YbjO family protein	NA	NA	NA	NA	NA
WP_062863495.1|4108590_4109718_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	1.6e-28
>prophage 255
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4113055	4115793	5272286		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|4113055_4113784_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270735.1|4114001_4114517_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|4114642_4114966_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|4114962_4115793_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 256
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4119380	4121099	5272286		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|4119380_4121099_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 257
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4130396	4154233	5272286	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188139.1|4130396_4132343_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4132415_4132640_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4132962_4133283_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4133313_4135590_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|4136274_4136493_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4136777_4137482_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202174.1|4137523_4139245_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
WP_001043613.1|4139245_4141012_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537432.1|4141134_4142100_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|4142644_4143139_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_062863615.1|4143273_4147419_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4147573_4148185_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|4148195_4149539_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|4149629_4150922_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_106913412.1|4151160_4153605_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.6e-221
WP_000213098.1|4153615_4154233_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 258
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4160543	4163758	5272286		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|4160543_4161284_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|4161475_4163758_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 259
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4167856	4168945	5272286		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057153.1|4167856_4168945_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 260
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4174031	4178572	5272286		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|4174031_4174316_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705706.1|4174522_4176787_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|4176823_4178572_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 261
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4193277	4204410	5272286	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|4193277_4193826_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|4193852_4194500_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|4194721_4195912_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|4196096_4197185_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|4197786_4199187_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|4199355_4200558_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193823.1|4200823_4203436_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001090508.1|4203642_4204410_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 262
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4220331	4222239	5272286		Tupanvirus(100.0%)	1	NA	NA
WP_106913413.1|4220331_4222239_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 263
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4234838	4236893	5272286		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|4234838_4236893_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 264
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4241126	4326724	5272286	protease,lysis,portal,holin,integrase,tail,terminase	Escherichia_phage(42.86%)	80	4274145:4274204	4305402:4306171
WP_000375136.1|4241126_4241786_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001058323.1|4242506_4243625_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|4243621_4245415_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|4245433_4246141_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003663.1|4246137_4246725_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063978.1|4246721_4247120_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004920.1|4247116_4247974_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|4248107_4249652_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460803.1|4249663_4250800_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|4250812_4250905_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001368126.1|4250984_4252283_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208650.1|4252397_4254578_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|4254597_4255044_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|4255031_4256171_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742348.1|4256216_4258313_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|4258312_4259059_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|4259055_4259700_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|4259806_4260112_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|4260553_4260766_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|4261051_4261264_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|4261274_4261463_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|4261437_4261668_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|4261657_4261831_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|4261878_4262952_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071525587.1|4263023_4265768_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264955.1|4265850_4266879_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|4266851_4267544_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|4267673_4268846_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062098.1|4268845_4271392_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.3e-70
WP_000209869.1|4271388_4271988_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|4272080_4272386_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420617.1|4272385_4273306_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
4274145:4274204	attL	TGGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTG	NA	NA	NA	NA
WP_106913414.1|4275892_4277134_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|4277171_4277399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607019.1|4277419_4277998_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001368133.1|4277994_4279305_-|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	99.8	2.0e-253
WP_001208773.1|4279357_4279642_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_106913415.1|4280497_4281412_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	96.7	2.7e-175
WP_000402094.1|4281411_4281861_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	99.3	3.8e-82
WP_000813672.1|4281868_4282432_+	bacteriophage lambda NinG family protein	NA	A0A0P0ZG59	Escherichia_phage	99.5	2.0e-104
WP_000144767.1|4282428_4282623_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001368310.1|4283555_4284503_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	2.0e-170
WP_000752026.1|4284512_4284782_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000874412.1|4285286_4287227_+	SASA family carbohydrate esterase	NA	A0A088CD51	Shigella_phage	99.4	0.0e+00
WP_000143459.1|4287362_4287542_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_001368314.1|4287582_4287828_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	7.2e-19
WP_000284510.1|4287905_4288121_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087455.1|4288125_4288659_+	lysozyme	NA	A0A088CC28	Shigella_phage	100.0	6.0e-103
WP_001056878.1|4288933_4289506_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	100.0	5.1e-108
WP_000455406.1|4289505_4289655_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001368309.1|4289662_4290100_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	98.6	1.0e-71
WP_000644480.1|4290298_4290796_+	DNA-binding protein	NA	Q9AZ05	Salmonella_phage	100.0	3.1e-93
WP_001283921.1|4290792_4291050_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000999684.1|4291275_4291650_+	hypothetical protein	NA	Q716B1	Shigella_phage	74.6	1.4e-42
WP_001086073.1|4292058_4292865_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_062863470.1|4292845_4294552_+	hypothetical protein	NA	A0A0H4IT14	Shigella_phage	99.8	0.0e+00
WP_106913416.1|4294551_4296675_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	97.6	0.0e+00
WP_033806713.1|4296832_4297840_+	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.1	9.7e-179
WP_001140442.1|4299132_4299522_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|4299571_4300033_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000207913.1|4300565_4301216_+	hypothetical protein	NA	Q08J85	Stx2-converting_phage	95.8	2.0e-116
WP_106904485.1|4301212_4303249_+|tail	phage tail protein	tail	A0A0P0ZGL7	Escherichia_phage	96.1	7.4e-117
WP_001367204.1|4303258_4303483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888818.1|4303479_4304154_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.2	9.0e-112
WP_024199968.1|4305468_4307094_+	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
4305402:4306171	attR	CACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCAGACAACCATGCCTTATATCGATATAACAACTATGCGCGGGATGATGCCAGGCGTTATTGCATCTATGCTGCCAGATCATTCTGCTGTACTGGCAGAAAACTGTCATTTTCGCTATGGAGTGATCACGCCTGAACACCAGATGTCAGAGGCTGAGAAAACATTCGCGATTAAGCCGAAAACCATTTTTCATTACCGTGACGATTTCTGGTTTGCATGGACGGATGTGGTGGATGTGATCCGCAGTCCGGTCGCTCAGGACTCCCACGGGCGTATTTACTACACTGACGGGCGTTTTCCTAAAGTGACGGATGCGACCATTGCCACAAAAGGGGACGGGAATCACCCGACATCATCGTATCGTCTGGGGATCCCCGCGCCGACGACAGCACCTGTCTGTACTGTTCAGCAGGGCGGTGATGTTTCTGACGATAACCCGAATGATGACGAAACCCGGTTTTATACGGAAACCTTTGTCTCAGATTATGGTGAAGAAGGTCCGCCAGGTCCGGCGTCTCTGGAGGTAACACTCCGTACTCCGGGGACTGCGGTACAGCTGACGCTGTCTCCGGTGCCATTGCAGAATGCCAGTATTAAACGCCGCCGGATTTATCGCTCTGCATCAGGTGGAGGAGAAGCGGATTTTTTACTTGTGGCTGAACTGGATGCATCCGTGCTCAGTTACACGGACAAAATACCGGGGAAAAACCTTG	NA	NA	NA	NA
WP_000197192.1|4307090_4308359_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|4308373_4308652_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|4308657_4309275_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835363.1|4309365_4310100_+	Ail/Lom family outer membrane beta-barrel protein	NA	V5URH5	Shigella_phage	100.0	1.3e-135
WP_000078907.1|4310331_4310472_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000710194.1|4310823_4312035_+	hemagglutinin	NA	NA	NA	NA	NA
WP_001380385.1|4312170_4312524_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	99.1	9.9e-62
WP_062863480.1|4312618_4313275_+	hypothetical protein	NA	G3CFP6	Escherichia_phage	97.2	4.5e-108
WP_032308635.1|4313277_4313724_+	hypothetical protein	NA	V5UT82	Shigella_phage	98.6	5.2e-76
WP_000540399.1|4313733_4314006_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	92.3	1.6e-11
WP_000012443.1|4314016_4315282_+	hypothetical protein	NA	Q08J71	Stx2-converting_phage	97.6	8.2e-199
WP_106913417.1|4315351_4323694_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.2	0.0e+00
WP_001273658.1|4324624_4324798_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240631.1|4324880_4326209_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.2	1.9e-230
WP_001028095.1|4326229_4326724_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 265
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4341501	4342425	5272286		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|4341501_4342425_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 266
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4349244	4351806	5272286	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409849.1|4349244_4350603_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_085948466.1|4350643_4351806_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 267
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4357042	4357876	5272286		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|4357042_4357876_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 268
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4362010	4362544	5272286		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4362010_4362544_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 269
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4371852	4372773	5272286		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4371852_4372773_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 270
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4377435	4377681	5272286		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4377435_4377681_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 271
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4393527	4394469	5272286		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|4393527_4394469_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 272
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4406827	4408009	5272286		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|4406827_4407562_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|4407772_4408009_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 273
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4411281	4412924	5272286		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|4411281_4411923_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|4411919_4412924_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 274
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4425238	4425496	5272286		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4425238_4425496_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 275
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4432785	4436508	5272286		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|4432785_4433487_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251350.1|4433486_4434731_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|4434759_4435671_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|4435686_4436508_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 276
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4439784	4441762	5272286		Mycoplasma_phage(100.0%)	2	NA	NA
WP_106913420.1|4439784_4440642_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|4440625_4441762_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 277
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4446882	4448253	5272286		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|4446882_4448253_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 278
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4451389	4458681	5272286	transposase	Phage_21(25.0%)	6	NA	NA
WP_000444487.1|4451389_4452640_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|4452742_4453066_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_001299921.1|4454079_4454298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949146.1|4454558_4455831_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_001307135.1|4456033_4456243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368009.1|4456359_4458681_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
>prophage 279
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4467214	4468902	5272286		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|4467214_4467634_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|4467633_4468902_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 280
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4495643	4498395	5272286		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|4495643_4497323_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|4497447_4498395_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 281
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4501531	4505539	5272286		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|4501531_4502614_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|4502613_4503447_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|4503443_4503836_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257056.1|4503839_4504649_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|4504684_4505539_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 282
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4508640	4508871	5272286		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|4508640_4508871_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 283
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4520002	4530013	5272286		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|4520002_4521541_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_106913422.1|4521537_4522248_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|4522247_4522925_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|4523650_4524493_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_032308816.1|4524542_4525001_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|4525113_4526019_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|4526110_4527124_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|4527325_4528234_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|4528377_4528791_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|4529395_4530013_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 284
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4539860	4541875	5272286		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|4539860_4540874_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|4540870_4541875_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 285
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4546568	4547138	5272286		Aeromonas_phage(100.0%)	1	NA	NA
WP_001258743.1|4546568_4547138_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.6	2.1e-21
>prophage 286
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4552313	4639010	5272286	capsid,head,protease,holin,transposase,integrase,tail,terminase	Escherichia_phage(33.87%)	89	4556117:4556133	4613914:4613930
WP_000046706.1|4552313_4554482_+	tape measure protein	NA	E5AFZ2	Erwinia_phage	28.1	1.3e-55
WP_000640576.1|4554638_4555427_+	hypothetical protein	NA	A0A0A0RK63	Escherichia_phage	78.0	9.9e-78
4556117:4556133	attL	GTATTACCGTGAAGGAG	NA	NA	NA	NA
WP_001016257.1|4556198_4556945_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_062895918.1|4556959_4558501_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	8.3e-129
WP_074015438.1|4558679_4559567_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001368012.1|4559657_4560377_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|4560416_4560815_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|4560919_4561459_-	septation protein A	NA	NA	NA	NA	NA
WP_000028551.1|4561488_4562232_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737218.1|4562588_4563242_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113692.1|4563287_4564427_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.7	8.3e-102
WP_000113186.1|4564404_4564653_-	excisionase	NA	NA	NA	NA	NA
WP_001033168.1|4564717_4567189_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	5.3e-53
WP_000199470.1|4567284_4567473_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450223.1|4567469_4567658_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000389971.1|4568185_4568371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391952.1|4569302_4569584_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693933.1|4569567_4570005_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	54.4	1.0e-28
WP_000729531.1|4570091_4571102_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.2	1.4e-169
WP_157911324.1|4571013_4571556_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.8e-79
WP_000450613.1|4571589_4572306_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	2.8e-71
WP_074015058.1|4572338_4572620_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.4	2.8e-27
WP_001266017.1|4572616_4572922_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.9	1.7e-49
WP_000014352.1|4572908_4573253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368005.1|4573254_4573623_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	62.1	1.8e-29
WP_000567227.1|4573619_4573973_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	62.5	5.1e-34
WP_000902691.1|4574206_4574419_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.9	6.9e-18
WP_000756598.1|4574540_4574885_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	97.4	1.8e-55
WP_000191873.1|4575007_4575280_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	54.7	5.0e-13
WP_001265191.1|4575281_4576331_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	8.2e-112
WP_001217428.1|4576343_4576706_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.1e-35
WP_001064919.1|4576698_4577388_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.2	3.5e-55
WP_071525566.1|4577581_4577983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134790173.1|4578108_4578306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917743.1|4578325_4578523_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000231840.1|4580097_4581033_+	SAM-dependent DNA methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	42.5	3.0e-41
WP_096849131.1|4582058_4584026_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	67.8	4.4e-252
WP_000143455.1|4584176_4584356_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.1e-24
WP_001290220.1|4584396_4584642_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	92.6	1.5e-16
WP_000284510.1|4584718_4584934_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001041954.1|4584937_4585522_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	88.3	4.3e-54
WP_001092904.1|4585962_4586496_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.0	3.6e-100
WP_052834940.1|4586652_4586835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|4587203_4587410_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001170911.1|4587474_4587699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828070.1|4588049_4588376_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|4588507_4588708_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|4588749_4589115_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958383.1|4589404_4589968_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	97.9	4.4e-88
WP_001380454.1|4589964_4591626_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_000173022.1|4591689_4593627_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001063099.1|4593671_4593893_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125999.1|4596581_4596908_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.7e-53
WP_001007908.1|4596917_4597268_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573391.1|4597264_4597711_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4597707_4598052_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275449.1|4598117_4598834_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	4.0e-126
WP_000710935.1|4598848_4599223_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	1.7e-64
WP_122993918.1|4599318_4599528_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	97.1	7.4e-33
WP_106913423.1|4599575_4602818_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
WP_000343410.1|4602810_4603152_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_001379814.1|4603359_4604505_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.7	1.3e-139
WP_001152196.1|4604714_4605413_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.2e-132
WP_033882927.1|4605423_4606167_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.4	9.2e-150
WP_122995430.1|4606112_4606745_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	1.1e-100
WP_106888844.1|4607458_4610932_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	91.5	0.0e+00
WP_000078852.1|4611130_4611271_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_106888845.1|4611413_4613141_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.6	6.5e-231
WP_000547695.1|4613182_4613854_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	98.6	2.5e-122
WP_106913424.1|4614259_4615504_+	hypothetical protein	NA	Q9LA60	Enterobacterial_phage	55.8	1.5e-80
4613914:4613930	attR	CTCCTTCACGGTAATAC	NA	NA	NA	NA
WP_000864633.1|4615590_4616064_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	4.8e-88
WP_106913425.1|4617212_4621205_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	93.1	0.0e+00
WP_089610354.1|4621627_4621786_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	74.5	5.5e-12
WP_001079504.1|4622119_4622626_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|4622671_4623172_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4623257_4623437_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|4623817_4624624_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|4624623_4625817_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000763511.1|4627189_4628785_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194611.1|4628784_4630347_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|4630438_4630483_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|4630620_4631502_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4631498_4632119_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|4632219_4633092_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|4633131_4633722_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559291.1|4633718_4634477_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.0e-06
WP_000422045.1|4634696_4635746_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|4635781_4636033_-	YciN family protein	NA	NA	NA	NA	NA
WP_001326307.1|4636412_4639010_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	3.0e-86
>prophage 287
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4643934	4644525	5272286		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|4643934_4644525_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 288
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4652340	4657998	5272286		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484977.1|4652340_4654275_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.6	6.9e-32
WP_000437858.1|4654342_4655470_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|4655614_4656403_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968858.1|4656770_4657124_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|4657191_4657998_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 289
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4670913	4672179	5272286		Klosneuvirus(100.0%)	1	NA	NA
WP_000069228.1|4670913_4672179_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 290
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4685926	4687009	5272286		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|4685926_4687009_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 291
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4696071	4697345	5272286	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085949146.1|4696071_4697345_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
>prophage 292
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4706526	4707042	5272286		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|4706526_4707042_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 293
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4713365	4720635	5272286	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628065.1|4713365_4714598_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4714852_4715836_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123739.1|4716313_4717687_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|4717815_4718751_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|4718926_4719361_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837909.1|4719501_4720635_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 294
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4725595	4726585	5272286		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|4725595_4726585_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 295
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4757871	4761774	5272286		Klosneuvirus(100.0%)	1	NA	NA
WP_000139565.1|4757871_4761774_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 296
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4765713	4766662	5272286		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|4765713_4766244_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|4766488_4766662_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 297
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4778467	4788641	5272286	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_064750227.1|4778467_4779676_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.8e-208
WP_001307190.1|4779715_4780930_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|4780982_4781519_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024178299.1|4781591_4783553_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|4783644_4783875_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|4784096_4784273_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|4784318_4784735_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760592.1|4784813_4786220_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047456.1|4786464_4787610_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|4787627_4788641_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 298
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4792021	4792849	5272286		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_053293987.1|4792021_4792849_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	38.3	9.0e-13
>prophage 299
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4797114	4799217	5272286		Salmonella_phage(100.0%)	1	NA	NA
WP_000706260.1|4797114_4799217_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	4.0e-134
>prophage 300
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4804126	4806235	5272286		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103411.1|4804126_4806235_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.3e-26
>prophage 301
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4816915	4818460	5272286		Escherichia_phage(100.0%)	1	NA	NA
WP_000702551.1|4816915_4818460_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 302
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4825345	4825636	5272286		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|4825345_4825636_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 303
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4831648	4833090	5272286		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|4831648_4831933_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|4832079_4833090_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 304
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4836364	4838270	5272286		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285539.1|4836364_4837291_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193551.1|4837283_4838270_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
>prophage 305
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4845001	4846384	5272286		Bacillus_virus(100.0%)	1	NA	NA
WP_000426277.1|4845001_4846384_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 306
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4851663	4858599	5272286		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_015953151.1|4851663_4854459_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
WP_000832499.1|4854503_4856876_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628547.1|4856913_4858599_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	2.9e-10
>prophage 307
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4873821	4972961	5272286	capsid,head,lysis,portal,transposase,integrase,tail,terminase	Enterobacteria_phage(31.15%)	106	4958729:4958746	4961281:4961298
WP_085947772.1|4873821_4875035_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_106913375.1|4878552_4879825_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.5e-171
WP_000113127.1|4880875_4882468_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154340.1|4882546_4883500_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194880.1|4883748_4885284_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000911173.1|4885277_4886306_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222719.1|4886305_4887298_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172481.1|4887309_4888332_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_062863579.1|4888358_4889234_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558520.1|4889257_4889548_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286606.1|4889604_4890363_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000637082.1|4890366_4891281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062863580.1|4891487_4892939_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558032.1|4893165_4894584_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|4894722_4895082_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|4895081_4896008_-	glutaminase B	NA	NA	NA	NA	NA
WP_001296740.1|4896071_4897460_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366496.1|4897560_4898442_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258554.1|4898519_4899635_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|4899784_4900975_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|4900999_4901665_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|4901876_4902311_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|4902330_4902714_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|4902745_4902964_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|4903020_4904460_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_001022785.1|4904484_4906158_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|4906213_4906525_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001368376.1|4906552_4907875_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|4907989_4908301_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|4908499_4909198_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087239.1|4909242_4910142_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|4910336_4911524_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|4911650_4911746_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592817.1|4911964_4912855_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.4e-19
WP_000671744.1|4913109_4913502_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024810.1|4913777_4914296_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001368367.1|4914340_4916386_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|4916522_4917269_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|4917357_4918044_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|4918221_4918425_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527756.1|4918460_4919921_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	8.6e-43
WP_062863581.1|4920009_4921293_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4921896_4922010_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4922078_4922312_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|4922628_4923219_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885584.1|4923316_4923892_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	8.5e-103
WP_106913430.1|4923891_4926855_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	93.2	1.5e-54
WP_001233547.1|4926919_4927519_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	2.5e-105
WP_000515750.1|4927586_4931066_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_000090905.1|4931126_4931729_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	5.6e-89
WP_000140764.1|4931665_4932409_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_001152612.1|4932414_4933113_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847345.1|4933112_4933442_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_032292244.1|4933438_4936018_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.1	0.0e+00
WP_000459457.1|4936010_4936445_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|4936426_4936849_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001368370.1|4936864_4937605_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	7.3e-131
WP_000683105.1|4937612_4938008_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985116.1|4938004_4938583_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000785283.1|4938594_4938948_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	96.6	8.4e-61
WP_000158866.1|4938959_4939355_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
WP_000063218.1|4939396_4940422_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_001368365.1|4940477_4940810_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000123334.1|4940819_4942139_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	3.7e-234
WP_001368373.1|4942119_4943721_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
WP_000198149.1|4943717_4943924_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_106913431.1|4943920_4945846_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000453603.1|4945820_4946366_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	8.1e-95
WP_106913432.1|4946754_4946988_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	82.5	7.3e-21
WP_000373090.1|4947045_4947456_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|4947607_4947781_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|4947952_4948108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985912.1|4948187_4948253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|4948255_4948444_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4948454_4948667_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|4949029_4949527_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|4949523_4950057_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000839590.1|4950368_4950584_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|4951337_4951553_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_062863620.1|4952228_4952981_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.0	2.0e-128
WP_001265196.1|4952994_4954044_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	5.7e-113
WP_023140913.1|4954045_4954324_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000980999.1|4954390_4954642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000884073.1|4954858_4955071_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_001546200.1|4955115_4955223_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000042049.1|4955632_4956886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018849.1|4957499_4958621_-	hypothetical protein	NA	J9Q803	Salmonella_phage	26.3	3.5e-20
4958729:4958746	attL	ACGTCCGCTCCTGGCACA	NA	NA	NA	NA
WP_024178309.1|4958772_4959375_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	30.6	3.1e-07
WP_000198670.1|4959593_4960283_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.6	1.2e-10
WP_001010972.1|4960354_4961101_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.6	4.3e-06
WP_001151189.1|4961403_4961805_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
4961281:4961298	attR	ACGTCCGCTCCTGGCACA	NA	NA	NA	NA
WP_000054494.1|4961845_4962811_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.9e-56
WP_000705362.1|4962791_4963313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|4963296_4963527_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379970.1|4963610_4964018_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379589.1|4964184_4964340_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344951.1|4964341_4964917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|4965403_4965592_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|4965588_4965780_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_106913434.1|4965873_4968357_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.6e-59
WP_001296941.1|4968444_4968681_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876996.1|4968715_4969996_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.1	1.5e-155
WP_001360138.1|4970015_4970126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836057.1|4970183_4971203_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|4971214_4972429_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4972634_4972961_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
>prophage 308
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	4977842	4982407	5272286		Escherichia_phage(100.0%)	4	NA	NA
WP_001340362.1|4977842_4980266_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|4980276_4980894_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|4980895_4981750_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|4981792_4982407_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 309
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5000168	5001470	5272286		Bacillus_phage(100.0%)	1	NA	NA
WP_000732498.1|5000168_5001470_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 310
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5011365	5013177	5272286		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945877.1|5011365_5013177_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 311
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5033061	5034336	5272286	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|5033061_5034336_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 312
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5041247	5042746	5272286		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|5041247_5041769_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|5041849_5042746_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 313
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5052327	5061119	5272286		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|5052327_5053143_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|5053270_5053852_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|5053997_5055167_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|5055332_5055422_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|5055720_5056746_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|5056742_5057675_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|5057787_5058999_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|5059289_5060438_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|5060477_5061119_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 314
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5068221	5068890	5272286		Escherichia_phage(100.0%)	1	NA	NA
WP_001310861.1|5068221_5068890_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 315
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5077180	5078401	5272286		environmental_halophage(100.0%)	1	NA	NA
WP_000144602.1|5077180_5078401_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
>prophage 316
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5081895	5082264	5272286		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_000367160.1|5081895_5082264_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 317
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5100855	5120449	5272286	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553686.1|5100855_5102556_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	6.1e-32
WP_000069375.1|5102612_5104991_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|5105323_5106157_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|5106313_5107360_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270810.1|5107491_5107683_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175624.1|5107686_5109123_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001326034.1|5109185_5109899_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|5110145_5110610_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|5110687_5111437_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|5111436_5111988_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|5112050_5113031_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|5113131_5113431_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672381.1|5113435_5115823_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|5115837_5116821_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|5117104_5117149_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|5117271_5117628_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|5117680_5117878_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|5117974_5118517_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|5118520_5120449_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 318
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5131748	5134010	5272286		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|5131748_5134010_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 319
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5140137	5140965	5272286		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|5140137_5140965_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 320
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5148441	5149662	5272286		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|5148441_5149662_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 321
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5156426	5157080	5272286		Planktothrix_phage(100.0%)	1	NA	NA
WP_024213362.1|5156426_5157080_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
>prophage 322
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5162681	5164643	5272286		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235819.1|5162681_5164643_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 323
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5169569	5170211	5272286		Tupanvirus(100.0%)	1	NA	NA
WP_001135062.1|5169569_5170211_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 324
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5173454	5174309	5272286		Indivirus(100.0%)	1	NA	NA
WP_001186337.1|5173454_5174309_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 325
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5177627	5182204	5272286		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|5177627_5178911_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616432.1|5179057_5180533_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001295489.1|5180713_5182204_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	1.1e-08
>prophage 326
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5188154	5190333	5272286	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_000826413.1|5188154_5189363_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	8.6e-206
WP_001349736.1|5189370_5190333_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	1.8e-41
>prophage 327
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5198706	5207590	5272286	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_077760418.1|5198706_5200392_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290564.1|5200596_5201178_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220994.1|5201217_5201913_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|5201970_5203881_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|5204012_5204357_+	RidA family protein	NA	NA	NA	NA	NA
WP_001300615.1|5205496_5205856_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|5205975_5206155_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854965.1|5206228_5207590_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 328
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5211452	5213009	5272286		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|5211452_5213009_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 329
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5218649	5218859	5272286		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|5218649_5218859_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 330
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5224190	5226239	5272286		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|5224190_5226239_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 331
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5233735	5238205	5272286		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|5233735_5234392_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|5234787_5235129_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879285.1|5235141_5236014_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|5236017_5236392_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|5236530_5236761_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|5236862_5237519_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|5237542_5238205_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 332
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5246261	5247737	5272286		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|5246261_5247737_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 333
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5254082	5258797	5272286		Bacillus_virus(66.67%)	7	NA	NA
WP_000202996.1|5254082_5254838_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|5254834_5255620_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|5255766_5256777_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|5256785_5257397_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|5257535_5257601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024954.1|5257671_5258274_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|5258275_5258797_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 334
NZ_CP027586	Escherichia coli strain 2012EL-2448 chromosome, complete genome	5272286	5262815	5264866	5272286		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639271.1|5262815_5263634_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
WP_000252979.1|5263686_5264082_+	membrane protein	NA	NA	NA	NA	NA
WP_000019584.1|5264122_5264866_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
