The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	0	11631	5646446		Burkholderia_virus(100.0%)	6	NA	NA
WP_001388534.1|888_5349_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_000081627.1|5361_6780_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_000979882.1|8070_8535_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209021.1|8531_9407_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|9403_10093_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|10140_11631_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 2
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	15336	15834	5646446	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|15336_15834_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 3
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	19800	22325	5646446	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|19800_21168_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|21257_22325_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 4
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	38821	39865	5646446		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|38821_39865_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 5
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	49907	54420	5646446		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000132907.1|49907_51407_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
WP_001341904.1|51467_52358_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275535.1|52393_53248_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|53589_54420_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 6
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	59757	60642	5646446		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|59757_60642_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 7
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	67146	72612	5646446	transposase	uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_000738579.1|67146_68172_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_085948178.1|68683_69896_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001297685.1|70742_71846_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078339.1|71853_72612_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 8
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	82950	84422	5646446	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114986.1|82950_83460_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
WP_000004477.1|83474_84422_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
>prophage 9
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	104299	109873	5646446		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|104299_105484_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|105554_107669_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|107765_108236_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|108332_108707_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|108832_109120_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820721.1|109127_109487_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|109486_109873_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 10
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	115443	124984	5646446		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|115443_117357_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|117356_118379_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|118372_118591_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|118644_119514_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|119568_119973_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|120274_120907_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|120957_123048_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|123114_124335_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601850.1|124420_124984_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	3.5e-61
>prophage 11
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	149210	150047	5646446		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|149210_150047_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 12
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	167023	170790	5646446		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|167023_168646_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253689.1|168721_170074_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|170070_170790_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 13
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	177353	178232	5646446		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|177353_178232_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 14
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	184201	186595	5646446		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|184201_186595_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 15
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	190974	192201	5646446		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105463.1|190974_192201_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 16
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	201430	203878	5646446		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|201430_203878_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 17
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	223888	225699	5646446		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073591.1|223888_224632_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.9e-09
WP_000907790.1|224628_225699_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 18
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	229239	230722	5646446		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|229239_229953_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|229954_230722_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 19
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	236455	239274	5646446		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|236455_237310_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042001.1|237554_238613_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|238605_239274_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 20
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	242280	246412	5646446		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|242280_242907_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106580.1|242980_245179_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000130621.1|245280_245526_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|245746_246412_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 21
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	254305	259945	5646446		Bacillus_virus(50.0%)	3	NA	NA
WP_000173630.1|254305_255112_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|255117_255519_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_106918305.1|255721_259945_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	2.1e-25
>prophage 22
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	263320	266056	5646446		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149160.1|263320_266056_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 23
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	279661	281704	5646446		Indivirus(100.0%)	1	NA	NA
WP_023441711.1|279661_281704_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.0e-45
>prophage 24
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	285049	287184	5646446		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|285049_285403_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|285456_286746_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|286758_287184_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 25
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	292065	292713	5646446		Bacillus_virus(100.0%)	1	NA	NA
WP_001341943.1|292065_292713_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 26
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	340175	342160	5646446		Bacillus_virus(50.0%)	2	NA	NA
WP_000107031.1|340175_341180_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
WP_001196495.1|341176_342160_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 27
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	359189	361523	5646446		Escherichia_phage(100.0%)	1	NA	NA
WP_000013916.1|359189_361523_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 28
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	365177	365390	5646446		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|365177_365390_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 29
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	369613	370609	5646446		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|369613_370609_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 30
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	375927	377469	5646446		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|375927_377469_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 31
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	401646	411784	5646446	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582492.1|401646_403491_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
WP_000206271.1|403487_404879_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|404976_405585_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_106918306.1|405813_409935_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	4.6e-25
WP_000072850.1|409955_410798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001346013.1|410950_411784_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 32
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	433844	444585	5646446		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|433844_434096_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|434237_434669_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|434913_436458_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|436467_437751_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483865.1|437754_438714_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|438700_439735_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|439985_441011_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|441020_442217_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_001307464.1|442491_443364_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|443652_444585_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 33
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	456516	461079	5646446		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|456516_456996_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|457034_457844_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|457941_458109_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|458129_458366_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|458582_459251_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|459422_460643_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|460623_461079_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 34
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	464452	471203	5646446		Morganella_phage(25.0%)	6	NA	NA
WP_001297374.1|464452_465277_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_000924289.1|465568_466186_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001426185.1|466182_467865_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	4.3e-22
WP_001295237.1|468122_468746_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|468800_469076_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|469094_471203_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 35
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	476324	477716	5646446		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|476324_477716_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 36
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	483858	497190	5646446	transposase,integrase	Enterobacteria_phage(66.67%)	15	483676:483698	497675:497697
483676:483698	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|483858_485028_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|485047_486907_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|486903_487329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|487656_488229_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|488302_488803_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283024.1|488799_489534_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_001149160.1|490085_490352_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|490348_490948_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244665.1|490940_491228_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459320.1|491220_491676_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000381395.1|491750_493322_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|493341_493689_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|493688_494366_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000856729.1|494521_494842_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_106918307.1|494856_497190_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.5	0.0e+00
497675:497697	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 37
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	503832	505167	5646446		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|503832_505167_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 38
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	512589	521751	5646446		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168497.1|512589_514278_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	1.6e-56
WP_001315912.1|514383_514482_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|515046_515136_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|515554_516739_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148063.1|516746_517244_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|517240_517603_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|517592_517940_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|518049_518499_+	membrane protein	NA	NA	NA	NA	NA
WP_000828487.1|518545_520039_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.2	5.5e-29
WP_001087147.1|520035_521751_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 39
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	528104	529058	5646446		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|528104_528533_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|528644_529058_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 40
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	533485	534634	5646446		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|533485_534634_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 41
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	540619	547988	5646446		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|540619_543034_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|543062_544136_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|544135_545236_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059106.1|545240_546644_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|546940_547021_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|547250_547391_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|547407_547767_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|547730_547988_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 42
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	558186	559524	5646446		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|558186_559524_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 43
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	570514	574355	5646446		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|570514_571288_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|571378_572269_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|572268_573228_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|573314_574355_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 44
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	579886	583248	5646446		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|579886_581716_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|581877_583248_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 45
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	595199	596192	5646446		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|595199_596192_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 46
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	599360	605213	5646446		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102345.1|599360_601229_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|601395_601815_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387752.1|601822_603328_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|603332_604298_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|604322_605213_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 47
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	618605	620252	5646446		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012624.1|618605_620252_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 48
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	628725	634137	5646446		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|628725_630747_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001299253.1|630793_632278_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047503.1|632411_633677_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_001280776.1|633807_634137_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 49
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	638179	644323	5646446		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|638179_639310_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006625.1|639306_640569_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226587.1|640568_641636_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000676056.1|641654_642536_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|642513_643188_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|643192_644323_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 50
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	660625	663426	5646446		Salmonella_phage(100.0%)	2	NA	NA
WP_000678272.1|660625_661951_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.3e-07
WP_001300182.1|661947_663426_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
>prophage 51
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	666462	670321	5646446		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|666462_667359_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213590.1|667358_668075_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383411.1|668158_670321_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
>prophage 52
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	677806	679636	5646446		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|677806_679636_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 53
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	692049	695336	5646446		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|692049_693690_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|693768_694038_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|694041_694557_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|694559_695336_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 54
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	704126	704741	5646446		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|704126_704741_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 55
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	718424	721211	5646446		uncultured_virus(100.0%)	1	NA	NA
WP_000250057.1|718424_721211_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.3e-71
>prophage 56
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	725289	727760	5646446		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|725289_726699_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|726710_727760_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 57
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	744128	851824	5646446	transposase,capsid,lysis,portal,plate,holin,protease,tRNA,terminase,integrase,head,tail	Escherichia_phage(43.75%)	111	780228:780274	811679:811725
WP_000718893.1|744128_745025_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621656.1|745192_746089_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|746122_746908_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_001315111.1|747006_747606_+	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_000920762.1|747599_748472_+	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_000560983.1|748468_748906_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|748950_749892_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|749955_750864_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|751092_751404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|751404_751695_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|752299_752518_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086390.1|752736_752979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|753309_754239_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829008.1|754235_754871_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|754867_755770_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|755782_758833_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|759026_759860_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001298963.1|760012_761053_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931345.1|761102_762851_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019489.1|762850_763921_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446023.1|763910_765362_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729592.1|765372_765819_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|766131_766446_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009269.1|766442_767591_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179751.1|767662_768487_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211515.1|768569_769829_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144123.1|769825_771295_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_001341797.1|771582_772059_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001341961.1|772033_772420_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001369519.1|772403_773342_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063496.1|773338_774373_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|774657_775278_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|775537_776521_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270270.1|776669_777344_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|777485_778859_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|778855_779554_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|779703_780204_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
780228:780274	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|780390_781371_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|781440_781734_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|781870_782143_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|782312_782813_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|782876_783101_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277903.1|783100_783403_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	96.0	2.5e-45
WP_001113264.1|783402_783627_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|783623_783899_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_106918308.1|783888_786165_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.1	0.0e+00
WP_001143636.1|786366_787311_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
WP_000142509.1|787318_788308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559725.1|788297_789419_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
WP_000038161.1|789833_790868_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156872.1|790867_792640_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085972.1|792813_793668_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_001248595.1|793726_794800_+|capsid	phage major capsid protein, P2 family	capsid	Q94MC7	Enterobacteria_phage	99.2	5.7e-201
WP_023568552.1|794803_795547_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.8	9.2e-126
WP_000988633.1|795646_796156_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|796155_796359_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|796362_796644_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_042002652.1|796643_797141_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_106918309.1|797155_797581_+	protein lysA	NA	Q858W1	Yersinia_virus	88.7	1.6e-58
WP_106918310.1|797568_797994_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	2.1e-66
WP_001300730.1|797965_798139_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_106918311.1|798101_798569_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_106918312.1|798561_799014_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	6.9e-76
WP_097316138.1|799080_799716_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	3.4e-113
WP_063610681.1|799712_800060_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	6.5e-58
WP_089628582.1|800064_800973_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.3	9.8e-162
WP_001285341.1|800965_801577_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.9e-117
WP_000905106.1|804312_804906_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	1.5e-102
WP_001286716.1|804965_806156_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|806168_806687_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001461862.1|806743_807019_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
WP_000785970.1|807051_807171_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_106918313.1|808887_809610_+	hypothetical protein	NA	A0A0F7LA40	Escherichia_phage	82.5	1.0e-76
WP_000978897.1|809624_810104_+|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_106918314.1|810103_811267_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.2	1.8e-205
WP_000468308.1|811348_811567_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|811803_812706_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
811679:811725	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|812886_813849_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045673.1|814167_815157_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708994.1|815263_816019_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|816073_816841_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|816948_817548_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|817648_818089_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|818300_818600_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|818626_819055_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|819059_819806_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|819902_820913_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|821047_822556_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|822578_823424_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|823848_824094_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|824178_824664_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|824756_825683_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|825749_827081_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|827090_827621_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|827713_828673_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|828764_829790_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001341957.1|829945_832144_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|832346_832559_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_106918315.1|832718_836891_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.4e-24
WP_000644414.1|836892_837129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797347.1|838121_838730_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|838913_839231_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_001341952.1|839507_840668_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110785.1|840670_843103_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000007523.1|843451_844342_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001297636.1|844670_846851_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001341951.1|846944_847850_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647882.1|847876_848494_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|848803_849784_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000374004.1|850047_851151_-	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000424845.1|851161_851824_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 58
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	875442	877287	5646446		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591366.1|875442_877287_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 59
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	885791	888844	5646446		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|885791_886742_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|887659_888844_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 60
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	892960	901289	5646446		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|892960_896989_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|897065_901289_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 61
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	910505	912269	5646446		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|910505_911177_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940105.1|911219_911810_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|911996_912269_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 62
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	917637	919227	5646446		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|917637_919227_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 63
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	934600	938284	5646446		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|934600_938284_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 64
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	950165	950957	5646446		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|950165_950957_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 65
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	966963	968079	5646446		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|966963_968079_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 66
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	977294	977903	5646446		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|977294_977903_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 67
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	983455	1038335	5646446	capsid,holin,tRNA,terminase,integrase,head,tail	Enterobacteria_phage(29.03%)	65	1027962:1027976	1041792:1041806
WP_001093919.1|983455_983737_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.2e-43
WP_001061338.1|983773_984346_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.4	5.1e-108
WP_000628776.1|984345_984912_-	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	92.5	4.0e-97
WP_000192143.1|985425_985974_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	95.1	8.5e-60
WP_001450018.1|985970_986180_-	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	100.0	8.8e-34
WP_001242710.1|986191_986803_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	74.7	5.7e-57
WP_000008177.1|986793_987330_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_021522371.1|987457_988282_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	3.9e-149
WP_000135680.1|988347_988710_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000981537.1|989167_989821_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|989916_990114_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514178.1|990141_990726_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	1.6e-56
WP_044863395.1|990722_991868_+	peptidase	NA	A5LH69	Enterobacteria_phage	85.3	8.5e-179
WP_000620696.1|991864_992089_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_032343211.1|992085_992904_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	8.9e-122
WP_023441586.1|992900_993395_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	5.2e-85
WP_000066917.1|993394_994048_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|994044_994371_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767113.1|994367_994757_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|994776_995586_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001223334.1|995601_996117_+	hypothetical protein	NA	V5URU3	Shigella_phage	28.7	4.6e-15
WP_032317762.1|996126_997116_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_001047129.1|997129_997882_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
WP_000691354.1|998449_999397_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|999406_999676_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_100038732.1|1000176_1002114_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.8	0.0e+00
WP_033815707.1|1002249_1002429_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	98.3	4.9e-25
WP_001290221.1|1002469_1002742_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_001072901.1|1002818_1003034_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087733.1|1003038_1003572_+	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_000661712.1|1003845_1004541_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280922.1|1004635_1004767_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_071529499.1|1004989_1005175_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001109019.1|1005413_1005965_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_000828068.1|1006310_1006637_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_000095741.1|1006768_1006969_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829190.1|1007010_1007376_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000958380.1|1007664_1008228_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001368653.1|1008224_1009886_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_106918316.1|1009949_1011887_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	98.9	0.0e+00
WP_001063096.1|1011931_1012153_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|1014679_1015006_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1015015_1015366_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1015362_1015809_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1015805_1016150_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275476.1|1016216_1016933_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030040.1|1016938_1017313_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001453698.1|1017408_1017618_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807964.1|1020747_1021089_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001357740.1|1021088_1021787_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_001356665.1|1021797_1022541_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	100.0	3.7e-151
WP_122999208.1|1022486_1023119_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.7	9.3e-103
WP_106918318.1|1024319_1026830_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.9	0.0e+00
WP_001230429.1|1026896_1027496_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106918319.1|1027560_1028874_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
1027962:1027976	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_001023407.1|1028875_1029145_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001370116.1|1029554_1030160_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.5	1.8e-111
WP_001121225.1|1030384_1031035_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001217539.1|1031628_1031877_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000332271.1|1031938_1033036_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_000543823.1|1033124_1034162_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|1034295_1034538_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|1034703_1035687_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|1035769_1037185_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147329.1|1037237_1038335_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.1	2.4e-29
1041792:1041806	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
>prophage 68
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1042524	1046137	5646446		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|1042524_1045347_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|1045600_1046137_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 69
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1049954	1051304	5646446		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|1049954_1051304_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 70
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1056889	1058848	5646446		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|1056889_1058848_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 71
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1068130	1070278	5646446		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|1068130_1070278_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 72
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1075523	1077509	5646446		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066006.1|1075523_1077509_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 73
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1081494	1083044	5646446		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611428.1|1081494_1082175_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075526.1|1082285_1083044_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 74
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1088648	1089437	5646446		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|1088648_1089437_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 75
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1094278	1095781	5646446		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|1094278_1095781_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 76
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1116977	1120189	5646446	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|1116977_1118495_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856834.1|1118731_1120189_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
>prophage 77
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1127189	1127768	5646446		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000491535.1|1127189_1127768_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	78.1	8.6e-79
>prophage 78
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1138542	1140081	5646446		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|1138542_1140081_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 79
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1175355	1176345	5646446		Salmonella_phage(100.0%)	1	NA	NA
WP_000953025.1|1175355_1176345_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
>prophage 80
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1180264	1232978	5646446	transposase,integrase,protease,tRNA	Vibrio_phage(16.67%)	49	1161235:1161249	1187581:1187595
1161235:1161249	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_001375513.1|1180264_1181884_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_000704132.1|1181880_1183452_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
WP_001218841.1|1183568_1184834_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|1185213_1185789_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|1185825_1187523_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|1187498_1187837_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
1187581:1187595	attR	TATGGATGATGAGAC	NA	NA	NA	NA
WP_000961959.1|1187952_1189254_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_001427817.1|1189371_1190808_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|1191144_1191621_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|1191636_1192893_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|1193168_1193462_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|1193505_1195152_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|1195289_1195643_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|1195895_1196876_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001008073.1|1197124_1197994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940530.1|1198383_1199412_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|1199453_1200020_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|1200071_1200197_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|1200307_1200454_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|1200635_1200953_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|1200949_1201483_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|1201571_1202705_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|1202767_1203127_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|1203137_1203533_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|1203543_1204278_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_106918320.1|1204270_1206079_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|1206403_1207381_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|1207599_1209102_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|1209153_1209468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|1209464_1209779_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|1209807_1213131_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|1213152_1214121_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|1214217_1215270_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|1215364_1215910_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_100699686.1|1216773_1216827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294203.1|1216809_1217949_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|1217947_1219495_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|1219466_1219928_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|1219946_1221284_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122520.1|1221293_1223141_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|1223133_1224084_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|1224169_1224478_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460361.1|1224554_1225835_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|1225920_1227180_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|1227182_1228187_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|1228268_1228466_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|1228569_1229868_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|1230072_1230498_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|1230536_1232978_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 81
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1236910	1302616	5646446	protease,transposase	Stx2-converting_phage(21.43%)	64	NA	NA
WP_000943991.1|1236910_1238074_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001299838.1|1238157_1239783_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|1239899_1240175_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254642.1|1240323_1240653_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569731.1|1240834_1241584_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|1241580_1242336_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|1242443_1243508_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001341647.1|1243862_1245260_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|1245275_1245581_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|1245590_1246055_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|1246068_1246719_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|1246728_1247583_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|1247582_1248269_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|1248397_1248673_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|1248999_1249395_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|1249401_1249716_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|1249720_1249948_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|1249989_1250439_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001427815.1|1250509_1251304_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_072097616.1|1251743_1252358_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_000440544.1|1252365_1253574_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_001119478.1|1253708_1254347_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|1254565_1255186_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228344.1|1255494_1256898_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_001062220.1|1257164_1257599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345317.1|1257697_1258765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000331456.1|1259011_1259674_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001296686.1|1259781_1260747_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560553.1|1260854_1261715_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|1261803_1262184_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|1262312_1264256_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|1264445_1265186_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_023442195.1|1265175_1265733_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|1266057_1266264_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|1266325_1267669_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|1267991_1268630_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|1268835_1270569_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060926.1|1270565_1274345_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|1274347_1274689_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|1274900_1275152_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|1275145_1275496_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|1275575_1276106_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_023442194.1|1276415_1277372_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|1277511_1279014_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|1279027_1280050_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|1280036_1281032_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|1281064_1282063_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|1282238_1283612_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166267.1|1283767_1284319_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|1284412_1285765_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000099160.1|1286069_1287608_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|1287656_1288004_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|1288000_1288405_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001106238.1|1288840_1289305_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|1289463_1291602_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001341327.1|1291995_1293651_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001297258.1|1293700_1295122_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181312.1|1295240_1296188_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|1296372_1296426_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|1296566_1299263_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000399648.1|1299490_1300471_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|1300747_1301134_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1301206_1301668_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|1301680_1302616_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 82
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1310927	1362996	5646446	integrase,tRNA,transposase	Stx2-converting_phage(48.0%)	47	1308285:1308300	1344730:1344745
1308285:1308300	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000416407.1|1310927_1313783_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|1313782_1314226_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1314579_1316091_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|1316357_1317458_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|1317457_1318540_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|1318658_1320161_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|1320290_1321310_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000772685.1|1321753_1323016_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000356577.1|1323259_1324099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091133.1|1324236_1325823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|1326112_1326790_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1326789_1327137_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1327156_1328728_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|1329037_1329310_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|1329311_1329866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|1329862_1330615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|1331529_1331790_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|1331786_1332335_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|1332334_1332559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|1332555_1332879_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|1332893_1335227_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|1336132_1336957_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|1337005_1337578_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000177060.1|1338931_1339189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|1339745_1340513_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|1340513_1341470_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125190.1|1341466_1342465_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|1342461_1343364_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|1343408_1345733_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
1344730:1344745	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068905.1|1345819_1346773_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|1346769_1347291_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|1349040_1349298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|1350030_1351389_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|1351627_1353013_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|1353062_1353410_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_133395011.1|1353406_1353721_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.0	4.5e-50
WP_001221615.1|1354141_1354576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|1354563_1354965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|1355130_1355700_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|1356439_1358011_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1358030_1358378_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1358377_1359055_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001344112.1|1359122_1359299_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_077221339.1|1359932_1360211_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000839179.1|1360660_1361065_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|1361061_1361409_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|1361457_1362996_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
>prophage 83
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1374349	1376484	5646446		Yersinia_phage(33.33%)	4	NA	NA
WP_001234622.1|1374349_1375168_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.6e-44
WP_000849588.1|1375222_1375708_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186774.1|1375723_1376200_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1376262_1376484_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 84
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1380112	1381093	5646446		Stx2-converting_phage(100.0%)	1	NA	NA
WP_106918322.1|1380112_1381093_-	sialate O-acetylesterase	NA	Q08JA2	Stx2-converting_phage	55.3	1.0e-100
>prophage 85
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1384455	1386132	5646446		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|1384455_1385058_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|1385535_1386132_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 86
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1395259	1396720	5646446		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208222.1|1395259_1396720_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	2.8e-49
>prophage 87
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1403289	1403844	5646446		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151863.1|1403289_1403844_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
>prophage 88
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1411345	1412290	5646446	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181189.1|1411345_1412290_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	5.0e-60
>prophage 89
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1418852	1422821	5646446		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001341289.1|1418852_1420322_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_000819015.1|1420388_1422821_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 90
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1439430	1441095	5646446		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919568.1|1439430_1441095_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 91
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1451709	1452989	5646446		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|1451709_1452447_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|1452449_1452989_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 92
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1460917	1463793	5646446		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|1460917_1462507_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|1462899_1463505_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|1463631_1463793_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 93
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1469428	1470751	5646446		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|1469428_1470751_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 94
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1477494	1482849	5646446		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093813.1|1477494_1478727_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046749.1|1479033_1480701_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409443.1|1480911_1482849_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 95
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1486132	1488246	5646446		Bacillus_phage(50.0%)	2	NA	NA
WP_001188663.1|1486132_1486822_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219614.1|1486821_1488246_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 96
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1500015	1509084	5646446		Cyanophage(20.0%)	9	NA	NA
WP_000130189.1|1500015_1500969_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|1501083_1501671_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|1501705_1502272_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|1502420_1503134_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|1503159_1503564_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|1503940_1505857_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|1505945_1507076_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|1507179_1507389_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681360.1|1507917_1509084_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 97
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1516127	1518944	5646446	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|1516127_1518944_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 98
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1523350	1524499	5646446		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|1523350_1524499_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 99
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1529969	1535630	5646446		Hepacivirus(50.0%)	4	NA	NA
WP_000351348.1|1529969_1531523_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
WP_000349932.1|1531596_1532814_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|1532942_1534085_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_023441728.1|1534115_1535630_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 100
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1543525	1546279	5646446		Bacillus_phage(50.0%)	5	NA	NA
WP_000624375.1|1543525_1544005_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000998542.1|1544025_1544205_+	antitoxin	NA	NA	NA	NA	NA
WP_001248979.1|1544303_1544771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000796358.1|1544806_1545406_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_000257163.1|1545430_1546279_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 101
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1554023	1559446	5646446		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|1554023_1556930_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035672.1|1557094_1559446_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	6.0e-38
>prophage 102
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1565778	1566477	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|1565778_1566477_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 103
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1579178	1580903	5646446		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|1579178_1580903_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 104
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1608156	1609200	5646446		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|1608156_1609200_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 105
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1613445	1613997	5646446		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|1613445_1613997_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 106
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1622624	1624049	5646446		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|1622624_1624049_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 107
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1631698	1638166	5646446		Mamastrovirus(33.33%)	5	NA	NA
WP_001189601.1|1631698_1633249_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_023442178.1|1633295_1635686_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|1635891_1636428_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|1636468_1637131_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|1637239_1638166_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 108
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1641428	1642331	5646446		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|1641428_1642331_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 109
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1652237	1659043	5646446	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|1652237_1653656_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|1653694_1654621_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|1654657_1655113_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|1655290_1655995_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|1656009_1656540_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001369168.1|1656613_1659043_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
>prophage 110
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1664222	1665020	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1664222_1665020_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 111
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1670931	1671276	5646446		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1670931_1671276_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 112
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1675205	1676630	5646446	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753939.1|1675205_1676630_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 113
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1689224	1689983	5646446		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001341242.1|1689224_1689983_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.7	2.2e-26
>prophage 114
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1698811	1702927	5646446		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|1698811_1699408_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294742.1|1699444_1702927_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
>prophage 115
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1715886	1716918	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|1715886_1716918_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 116
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1723576	1731429	5646446		Indivirus(25.0%)	9	NA	NA
WP_000997040.1|1723576_1724380_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_000648609.1|1724376_1725291_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1725531_1726332_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000155276.1|1726409_1727180_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1727227_1728586_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|1728657_1729413_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326291.1|1729446_1730169_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1730165_1730633_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|1730697_1731429_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
>prophage 117
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1741906	1744774	5646446		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614364.1|1741906_1744774_-	AAA domain-containing protein	NA	K4FB40	Cronobacter_phage	29.3	4.3e-78
>prophage 118
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1758171	1762084	5646446		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|1758171_1758750_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|1758955_1759723_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1759693_1760434_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032183258.1|1760589_1760877_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|1760864_1761125_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543897.1|1761310_1762084_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
>prophage 119
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1775952	1778910	5646446		Hokovirus(50.0%)	2	NA	NA
WP_000859525.1|1775952_1776348_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_001143094.1|1776465_1778910_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
>prophage 120
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1802146	1803313	5646446		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001399806.1|1802146_1803313_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
>prophage 121
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1807990	1811702	5646446		Streptococcus_phage(66.67%)	3	NA	NA
WP_000749860.1|1807990_1809046_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
WP_001285288.1|1809333_1810437_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|1810448_1811702_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
>prophage 122
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1820159	1827936	5646446	integrase	Enterobacteria_phage(66.67%)	6	NA	NA
WP_000890057.1|1820159_1821989_+	hypothetical protein	NA	I7HJD8	Enterobacteria_phage	29.3	1.8e-29
WP_000179455.1|1822023_1822737_+	hypothetical protein	NA	I7I023	Enterobacteria_phage	49.3	5.7e-48
WP_001341225.1|1822817_1824152_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001111350.1|1824382_1824793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121330.1|1824771_1825728_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|1825737_1827936_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 123
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1846835	1850140	5646446		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001299025.1|1846835_1847705_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_023442147.1|1847864_1848458_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|1848469_1848706_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046293.1|1848814_1850140_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 124
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1855715	1866191	5646446	holin	Catovirus(33.33%)	5	NA	NA
WP_001159100.1|1855715_1857386_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_000089072.1|1857399_1858872_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|1858885_1859473_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|1859601_1861635_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001341217.1|1862207_1866191_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	2.5e-124
>prophage 125
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1878184	1882722	5646446		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|1878184_1879669_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|1879661_1880633_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|1880629_1881586_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692744.1|1881672_1882722_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 126
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1891098	1896795	5646446		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010284.1|1891098_1892985_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076236.1|1893323_1894583_+	cytosine permease	NA	NA	NA	NA	NA
WP_001299008.1|1894572_1895856_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_023442150.1|1895895_1896795_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 127
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1900635	1904915	5646446		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177902.1|1900635_1903710_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
WP_000805913.1|1903832_1904915_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	1.8e-191
>prophage 128
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1910325	1912286	5646446		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_023442151.1|1910325_1911276_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|1911272_1912286_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 129
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1915463	1916573	5646446		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|1915463_1916573_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 130
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1921869	1922637	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939341.1|1921869_1922637_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	3.3e-25
>prophage 131
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1926263	1927425	5646446	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948193.1|1926263_1927425_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	8.9e-51
>prophage 132
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1930864	1932022	5646446		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830745.1|1930864_1932022_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 133
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1939359	1940475	5646446		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|1939359_1940475_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 134
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1944764	1954736	5646446		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|1944764_1945676_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219321.1|1945800_1946709_+	fructokinase	NA	NA	NA	NA	NA
WP_001342329.1|1946851_1948036_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698929.1|1948161_1951305_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|1951301_1952504_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|1952693_1953383_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893609.1|1953440_1954736_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
>prophage 135
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1961688	1970663	5646446	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667301.1|1961688_1962816_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	1.4e-88
WP_000007629.1|1962838_1963171_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|1963198_1965046_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1965056_1966028_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|1966156_1966504_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001339235.1|1966680_1967559_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|1967857_1968397_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1968547_1968997_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150472.1|1969000_1970104_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_001021161.1|1970192_1970663_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 136
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	1994495	1999542	5646446	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1994495_1995119_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1995244_1996519_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1996706_1999061_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1999269_1999542_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 137
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2002670	2003366	5646446		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|2002670_2003366_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 138
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2006689	2010236	5646446		Bacillus_phage(100.0%)	2	NA	NA
WP_001235581.1|2006689_2008462_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.0e-49
WP_001256174.1|2008454_2010236_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 139
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2019071	2022221	5646446		Leptospira_phage(100.0%)	1	NA	NA
WP_001132475.1|2019071_2022221_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 140
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2030508	2039070	5646446		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|2030508_2031060_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|2031188_2033120_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|2033172_2033502_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|2033501_2034107_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678194.1|2034216_2036091_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|2036271_2036916_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250125.1|2037151_2038114_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|2038110_2039070_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 141
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2047314	2050274	5646446		Escherichia_phage(50.0%)	2	NA	NA
WP_001342071.1|2047314_2047656_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_106918324.1|2047769_2050274_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	1.4e-114
>prophage 142
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2054813	2055491	5646446		Bacillus_virus(100.0%)	1	NA	NA
WP_001157532.1|2054813_2055491_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
>prophage 143
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2058627	2059314	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|2058627_2059314_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 144
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2071625	2073407	5646446		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001342079.1|2071625_2073407_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 145
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2079596	2080742	5646446		Streptococcus_phage(100.0%)	1	NA	NA
WP_001315307.1|2079596_2080742_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 146
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2092161	2152082	5646446	transposase,capsid,lysis,portal,protease,tRNA,terminase,integrase,head,tail	Enterobacteria_phage(56.9%)	75	2102322:2102368	2152505:2152551
WP_000912342.1|2092161_2093547_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|2093582_2094104_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|2094211_2094424_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|2094425_2095292_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|2095772_2096315_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|2096534_2097227_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|2097257_2099867_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|2099845_2100886_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|2100896_2101412_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|2101414_2102047_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2102322:2102368	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|2102381_2103545_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|2103400_2103772_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|2103743_2104022_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|2104069_2104288_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|2104386_2104668_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|2104678_2104870_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|2104842_2105025_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|2105021_2105702_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_001427106.1|2105698_2106484_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995439.1|2106489_2106786_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|2106861_2107152_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|2107618_2107939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|2108074_2108338_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|2108419_2109109_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|2109213_2109444_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|2109513_2110053_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001342088.1|2110139_2111069_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_000788789.1|2111065_2111767_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|2111971_2112319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|2113071_2113680_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|2113979_2114396_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|2114374_2114776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|2114899_2115001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|2114997_2115453_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|2115452_2115623_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|2115615_2115906_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|2115902_2116265_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|2116261_2116402_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|2116487_2116871_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|2117059_2118142_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|2118730_2118946_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|2118945_2119443_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|2119659_2119842_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|2119932_2120226_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_157825797.1|2120433_2120601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918325.1|2120566_2121777_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.2e-167
WP_001427981.1|2121894_2122089_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|2122477_2123023_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027295.1|2122997_2124923_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|2124919_2125126_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001444138.1|2125122_2126724_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000381395.1|2127196_2128768_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2128787_2129135_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2129134_2129812_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000088640.1|2129852_2130731_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001345004.1|2130740_2131073_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063244.1|2131128_2132154_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|2132195_2132591_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|2132602_2132977_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|2132967_2133546_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|2133542_2133938_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|2133945_2134686_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|2134701_2135124_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|2135105_2135540_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|2135532_2138094_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000847347.1|2138090_2138420_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152557.1|2138419_2139118_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000090884.1|2139803_2140436_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_106918326.1|2140496_2143910_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001230523.1|2143980_2144580_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000279150.1|2144644_2147605_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000239881.1|2148243_2148912_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|2148968_2149274_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|2149457_2150942_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|2151128_2152082_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
2152505:2152551	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 147
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2162631	2172699	5646446		uncultured_Caudovirales_phage(25.0%)	5	NA	NA
WP_001289030.1|2162631_2167431_-	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.9	1.9e-17
WP_001160804.1|2167450_2167912_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103161.1|2167939_2169841_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	3.9e-27
WP_000253805.1|2170577_2172026_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770953.1|2172015_2172699_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 148
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2175969	2179113	5646446		Leptospira_phage(100.0%)	1	NA	NA
WP_000573943.1|2175969_2179113_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
>prophage 149
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2190541	2196584	5646446		Tupanvirus(50.0%)	3	NA	NA
WP_000077704.1|2190541_2194423_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
WP_000096713.1|2194638_2195772_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_001005919.1|2195768_2196584_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 150
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2211124	2212947	5646446		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|2211124_2211754_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029808.1|2211726_2212947_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	6.1e-58
>prophage 151
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2216056	2218171	5646446		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|2216056_2217622_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|2217742_2218171_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 152
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2233596	2234244	5646446		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|2233596_2233806_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|2233860_2234244_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 153
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2239059	2241499	5646446		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|2239059_2240271_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231436.1|2240410_2241499_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 154
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2248509	2251092	5646446	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|2248509_2251092_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 155
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2258030	2261563	5646446		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367892.1|2258030_2259701_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	4.0e-76
WP_001207522.1|2259784_2260720_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|2260837_2261563_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 156
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2269459	2270539	5646446		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|2269459_2270539_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 157
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2274523	2276188	5646446		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|2274523_2276188_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 158
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2280814	2284628	5646446	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|2280814_2282761_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|2282963_2284628_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 159
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2288777	2289542	5646446		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|2288777_2289542_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 160
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2296197	2308918	5646446		Bacillus_phage(25.0%)	8	NA	NA
WP_000186103.1|2296197_2296875_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001427133.1|2296871_2299556_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_001297248.1|2299548_2300121_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087956.1|2300129_2302178_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	1.6e-26
WP_000730096.1|2302200_2303874_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|2303873_2303963_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|2304275_2304482_+	YbfA family protein	NA	NA	NA	NA	NA
WP_032325252.1|2304724_2308918_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
>prophage 161
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2313001	2315943	5646446		Hokovirus(50.0%)	2	NA	NA
WP_000207138.1|2313001_2314420_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	1.1e-61
WP_001032694.1|2314461_2315943_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 162
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2319321	2320113	5646446		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114037.1|2319321_2320113_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	3.7e-08
>prophage 163
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2356141	2359661	5646446		Vibrio_phage(33.33%)	4	NA	NA
WP_000345401.1|2356141_2356861_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	3.2e-22
WP_000951292.1|2356857_2357799_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|2357912_2358293_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109199.1|2358608_2359661_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
>prophage 164
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2364016	2370589	5646446		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|2364016_2365033_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|2365293_2366766_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|2366833_2367622_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|2367750_2367900_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113001.1|2368065_2368839_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|2368838_2369528_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|2369530_2370589_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 165
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2380392	2435357	5646446	transposase,lysis,portal,protease,holin,terminase,integrase,head,tail	Enterobacteria_phage(48.53%)	76	2376140:2376155	2383211:2383226
2376140:2376155	attL	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000533654.1|2380392_2381463_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|2381440_2381659_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|2381765_2382110_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|2382138_2382306_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|2382378_2382663_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_012817743.1|2382655_2382958_-	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000104414.1|2382954_2383572_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
2383211:2383226	attR	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000034231.1|2383573_2384131_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|2384127_2384685_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|2384681_2384846_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|2384856_2385150_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|2385173_2385557_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|2385556_2386162_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_001243354.1|2386418_2386571_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|2386555_2386687_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001341800.1|2386711_2387572_-	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000073663.1|2387935_2388475_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_000088201.1|2388497_2388770_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000193240.1|2389376_2389739_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000428099.1|2390007_2390712_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000064150.1|2390825_2391059_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000438538.1|2391197_2391497_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000185473.1|2391529_2392468_+	replication protein	NA	O48421	Enterobacteria_phage	99.7	1.4e-171
WP_000788880.1|2392464_2393166_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|2393162_2393453_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|2393749_2394106_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|2394077_2394488_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|2394484_2394661_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|2394663_2395065_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001341811.1|2395024_2395234_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|2395226_2395949_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|2395948_2396239_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|2396235_2396598_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|2396594_2396783_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|2396994_2397954_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|2398292_2398415_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|2398429_2399119_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|2399303_2400047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|2400132_2400291_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000411802.1|2402901_2403108_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|2403107_2403605_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|2403601_2404039_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|2404188_2404806_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|2404993_2405188_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|2405583_2406093_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_009442816.1|2406064_2407993_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000259002.1|2407976_2408183_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001432013.1|2408179_2409772_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_001254029.1|2409761_2409938_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_000839179.1|2410015_2410420_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612622.1|2410416_2410764_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000099160.1|2410812_2412351_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|2412347_2412716_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143013.1|2412723_2413476_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|2413489_2413921_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|2413947_2414361_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|2414341_2416921_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|2416917_2417247_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|2417246_2417945_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_001375575.1|2417950_2418694_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_096844540.1|2418639_2419272_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_096089457.1|2419517_2422994_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001233130.1|2423061_2423661_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_001023459.1|2424942_2425212_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|2425317_2426199_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_000652081.1|2426422_2427250_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_021351651.1|2427373_2427745_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|2428225_2429797_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2429816_2430164_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2430163_2430841_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|2430901_2431477_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001002868.1|2431677_2432058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|2432141_2432363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|2432375_2433029_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767389.1|2433532_2434009_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001443724.1|2434067_2435357_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 166
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2441838	2442747	5646446		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|2441838_2442747_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 167
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2453344	2468157	5646446		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996091.1|2453344_2455081_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_001296990.1|2455073_2456069_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|2456071_2456743_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007094.1|2456971_2458336_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_000443534.1|2458566_2459652_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|2459792_2460755_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218655.1|2460782_2462933_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_001145128.1|2463052_2463535_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000849301.1|2463766_2464027_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146345.1|2464291_2464558_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	2.0e-06
WP_000990177.1|2464631_2465309_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430039.1|2465350_2467633_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|2467896_2468157_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 168
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2471697	2476922	5646446		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|2471697_2472420_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159066.1|2472416_2473076_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|2473214_2473961_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|2474364_2474868_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|2475166_2476054_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|2476288_2476354_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|2476406_2476922_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 169
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2481919	2483512	5646446		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|2481919_2483512_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 170
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2487404	2491535	5646446		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|2487404_2489837_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|2489842_2490742_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001341703.1|2490872_2491535_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	3.3e-26
>prophage 171
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2494750	2496622	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|2494750_2496622_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 172
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2507957	2509160	5646446		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|2507957_2509160_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 173
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2517726	2526876	5646446		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|2517726_2517984_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|2518143_2518431_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|2518414_2519137_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|2519197_2520100_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_106918329.1|2520187_2520664_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126055.1|2521014_2522127_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996018.1|2522221_2523355_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093858.1|2523364_2524318_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|2524314_2525160_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2525219_2525708_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|2525748_2526876_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 174
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2530213	2532951	5646446		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|2530213_2530942_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|2531159_2531675_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160723.1|2531800_2532124_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|2532120_2532951_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 175
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2536538	2538257	5646446		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815356.1|2536538_2538257_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
>prophage 176
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2547554	2571350	5646446	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188180.1|2547554_2549501_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2549573_2549798_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|2550120_2550441_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|2550471_2552748_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|2553431_2553650_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|2553934_2554639_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202168.1|2554680_2556402_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.1e-20
WP_001043619.1|2556402_2558169_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537421.1|2558291_2559257_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|2559800_2560295_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077075.1|2560429_2564536_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|2564690_2565302_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|2565312_2566656_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|2566746_2568039_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|2568277_2570722_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|2570732_2571350_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 177
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2577659	2580874	5646446		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|2577659_2578400_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|2578591_2580874_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 178
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2584972	2586061	5646446		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057151.1|2584972_2586061_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 179
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2591147	2595688	5646446		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|2591147_2591432_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705700.1|2591638_2593903_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|2593939_2595688_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 180
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2610393	2610942	5646446		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|2610393_2610942_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 181
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2614491	2622805	5646446	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_000977920.1|2614491_2615580_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|2616181_2617582_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|2617750_2618953_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|2619218_2621831_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090514.1|2622037_2622805_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 182
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2638727	2640635	5646446		Tupanvirus(100.0%)	1	NA	NA
WP_000053122.1|2638727_2640635_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 183
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2653233	2655288	5646446		Bacillus_phage(100.0%)	1	NA	NA
WP_001297106.1|2653233_2655288_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 184
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2659521	2723187	5646446	transposase,capsid,protease,holin,terminase,integrase,head,tail	Escherichia_phage(37.5%)	82	2660383:2660442	2713174:2713238
WP_000375138.1|2659521_2660181_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2660383:2660442	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_001299351.1|2660588_2661608_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|2661585_2661828_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048499.1|2661895_2664346_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|2664440_2664629_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2664625_2664814_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|2665214_2665379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2665382_2665601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|2665693_2665894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|2666307_2666610_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|2666612_2666972_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|2667018_2667411_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|2667537_2667798_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|2667794_2668232_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|2668318_2669329_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|2669240_2669783_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|2669816_2670542_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|2670557_2670950_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|2670946_2671243_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|2671239_2671701_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|2671678_2672035_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|2672085_2672298_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|2672331_2672514_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|2672679_2673315_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|2673402_2673621_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|2673622_2673988_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000206830.1|2673984_2674329_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_000220601.1|2674533_2674833_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|2674838_2675096_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|2675231_2675504_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265111.1|2675505_2676552_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	3.6e-107
WP_000904103.1|2676564_2676924_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|2676932_2677463_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|2677704_2677902_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|2678036_2678750_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|2679199_2679631_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000023293.1|2680108_2682046_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143463.1|2682181_2682361_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|2682401_2682647_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_106918331.1|2682724_2682940_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	5.9e-33
WP_000087714.1|2682944_2683478_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|2683752_2684322_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|2684321_2684471_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|2684698_2684884_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2685409_2685724_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|2685805_2686030_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001375434.1|2686071_2686437_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
WP_000958380.1|2686729_2687293_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_064460387.1|2687289_2688951_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_044165196.1|2689014_2690952_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_001063096.1|2690996_2691218_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|2693420_2693747_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2693756_2694107_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2694103_2694550_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2694546_2694891_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|2694956_2695673_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030063.1|2695678_2696053_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2696148_2696358_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106918332.1|2696409_2699652_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.9	0.0e+00
WP_000807964.1|2699644_2699986_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001357740.1|2699985_2700684_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404499.1|2700689_2701433_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_064761467.1|2701378_2702008_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_106918333.1|2702253_2705730_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.4	0.0e+00
WP_001230428.1|2705796_2706396_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_032284669.1|2706460_2707774_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.4	9.7e-78
WP_001339397.1|2707829_2708507_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2708506_2708854_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2708873_2710445_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001023483.1|2710482_2710752_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000938124.1|2711206_2712568_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_095585410.1|2712944_2713097_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001058323.1|2713692_2714811_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
2713174:2713238	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|2714807_2716601_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|2716619_2717327_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_023441895.1|2717323_2717911_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063972.1|2717907_2718306_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|2718302_2719160_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_071527988.1|2719342_2720839_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460810.1|2720850_2721987_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|2721999_2722092_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000399648.1|2722206_2723187_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 185
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2733517	2745772	5646446		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|2733517_2733730_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|2733740_2733929_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|2733903_2734134_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2734123_2734297_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|2734344_2735418_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001444338.1|2735489_2738234_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264955.1|2738316_2739345_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|2739317_2740010_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|2740139_2741312_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|2741311_2743858_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|2743854_2744454_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|2744546_2744852_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|2744851_2745772_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 186
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2750078	2752178	5646446		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|2750078_2750252_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|2750334_2751663_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|2751683_2752178_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 187
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2767078	2771097	5646446	integrase	Cronobacter_phage(50.0%)	3	2756056:2756070	2784508:2784522
2756056:2756070	attL	GGGAGAGCGCATGAC	NA	NA	NA	NA
WP_001307105.1|2767078_2768002_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_032244309.1|2768813_2769269_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_023442187.1|2769894_2771097_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	1.2e-42
2784508:2784522	attR	GGGAGAGCGCATGAC	NA	NA	NA	NA
>prophage 188
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2778123	2783547	5646446	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_000233452.1|2778123_2780484_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998026.1|2781240_2782773_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	3.5e-297
WP_000612591.1|2782822_2783170_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2783166_2783547_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 189
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2796463	2796604	5646446		Escherichia_phage(100.0%)	1	NA	NA
WP_001135715.1|2796463_2796604_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
>prophage 190
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2800333	2802750	5646446	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_000435663.1|2800333_2800759_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|2800755_2801106_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|2801136_2802750_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
>prophage 191
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2807270	2819614	5646446	protease	Acinetobacter_phage(42.86%)	12	NA	NA
WP_001182418.1|2807270_2808350_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|2808351_2809125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|2809117_2810260_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|2810269_2811328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|2811650_2812232_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|2812231_2813389_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|2813411_2813867_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|2813889_2814930_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|2814978_2815557_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|2815625_2816201_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|2816623_2817010_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|2817523_2819614_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
>prophage 192
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2835644	2837499	5646446		Flavobacterium_phage(33.33%)	3	NA	NA
WP_001368598.1|2835644_2835947_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A218M763	Flavobacterium_phage	50.0	1.5e-10
WP_001341487.1|2836003_2836876_+	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	33.0	6.7e-43
WP_000502849.1|2836860_2837499_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
>prophage 193
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2850430	2850856	5646446		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000422760.1|2850430_2850856_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 194
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2860562	2862733	5646446		Yersinia_phage(33.33%)	4	NA	NA
WP_001234682.1|2860562_2861381_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
WP_000214398.1|2861471_2861957_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001186738.1|2861972_2862449_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2862511_2862733_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 195
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2868750	2869584	5646446		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2868750_2869584_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 196
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2873718	2874252	5646446		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|2873718_2874252_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 197
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2883560	2884481	5646446		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|2883560_2884481_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 198
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2889143	2889389	5646446		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2889143_2889389_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 199
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2905235	2906177	5646446		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|2905235_2906177_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 200
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2918534	2919716	5646446		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008538.1|2918534_2919269_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
WP_000103754.1|2919479_2919716_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 201
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2922988	2924631	5646446		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|2922988_2923630_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|2923626_2924631_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 202
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2936954	2937212	5646446		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2936954_2937212_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 203
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2944501	2948224	5646446		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|2944501_2945203_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|2945202_2946447_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|2946475_2947387_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|2947402_2948224_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 204
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	2952115	3043250	5646446	transposase,capsid,lysis,portal,protease,holin,terminase,integrase,head,tail	Escherichia_phage(21.95%)	116	2999700:2999720	3036840:3036860
WP_001427255.1|2952115_2952460_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	34.7	1.9e-09
WP_000074973.1|2952536_2953655_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_000003742.1|2953623_2953893_-	excisionase	NA	NA	NA	NA	NA
WP_001365098.1|2956454_2956646_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001358566.1|2956642_2956831_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000379610.1|2957320_2957473_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000948454.1|2957791_2958268_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2958392_2958716_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693928.1|2958699_2959125_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262372.1|2959196_2960267_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
WP_000788759.1|2960273_2961020_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	1.4e-113
WP_000451006.1|2961041_2961803_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.9	4.9e-74
WP_000603384.1|2961835_2962117_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2962113_2962341_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001365112.1|2962333_2962669_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.4	2.0e-48
WP_000683607.1|2962771_2962990_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	73.6	6.2e-22
WP_000104474.1|2962991_2963549_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2963782_2963995_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2964114_2964459_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2964580_2964853_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265236.1|2964854_2965904_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	2.2e-109
WP_001217410.1|2965916_2966291_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762928.1|2966287_2967109_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001427258.1|2967674_2968106_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	6.2e-66
WP_001299351.1|2968922_2969942_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|2969919_2970162_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_032317593.1|2970229_2972701_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	3.4e-55
WP_001098307.1|2972794_2972986_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|2972982_2973171_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|2973744_2973930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|2974116_2974506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|2974647_2974803_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|2975079_2975367_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|2975366_2975558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|2975585_2975987_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|2976095_2976368_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|2976351_2976777_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|2976982_2977438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077756695.1|2977516_2978608_+	DNA-binding protein	NA	V5URT9	Shigella_phage	70.0	3.9e-133
WP_000788750.1|2978614_2979361_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450992.1|2979382_2980153_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|2980168_2980582_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|2980933_2981707_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|2982072_2982210_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013636.1|2982254_2982467_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001341388.1|2982634_2982913_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265140.1|2982914_2983964_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001217436.1|2983976_2984348_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|2984337_2984709_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265267.1|2984860_2985679_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|2985965_2986205_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|2986299_2987013_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874393.1|2987780_2989631_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_000411814.1|2990078_2990285_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|2990540_2990813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003120.1|2990972_2991506_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	3.6e-100
WP_032140280.1|2992060_2992147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001427182.1|2992148_2992643_+|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.4e-74
WP_000736096.1|2992639_2992864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|2993232_2993460_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001427183.1|2993501_2993867_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	9.9e-65
WP_001339397.1|2994364_2995042_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2995041_2995389_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2995408_2996980_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_103951664.1|2997427_2999089_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_044165196.1|2999152_3001090_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
2999700:2999720	attL	CAACCGTTTTTCATAAGGAAA	NA	NA	NA	NA
WP_001063096.1|3001134_3001356_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|3003882_3004209_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|3004218_3004569_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|3004565_3005012_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133393.1|3005008_3005353_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_032244183.1|3005418_3006135_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	5.2e-126
WP_000710949.1|3006149_3006524_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|3006619_3006829_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_106918336.1|3006876_3010119_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.4	0.0e+00
WP_000807964.1|3010111_3010453_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001357740.1|3010452_3011151_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_025404499.1|3011156_3011900_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_064761467.1|3011845_3012475_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_106918337.1|3012720_3016197_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.9	0.0e+00
WP_001216290.1|3016265_3016889_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106918338.1|3016954_3018277_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.5	1.2e-75
WP_001023435.1|3018278_3018548_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_001131642.1|3018661_3019237_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|3019527_3020109_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|3020176_3020812_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|3020939_3021998_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|3022072_3022723_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|3022905_3023496_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|3023769_3024633_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|3024616_3025753_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|3026002_3027232_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|3027377_3028499_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085269.1|3028747_3029977_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000953274.1|3030341_3030530_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_001502337.1|3030582_3031860_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|3031856_3032087_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336141.1|3032076_3032301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|3032293_3032659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|3032651_3032873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204967.1|3032874_3033108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|3033113_3033413_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833614.1|3033409_3034807_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	4.3e-116
WP_001080642.1|3035009_3035261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368652.1|3035374_3035563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126670.1|3035572_3035983_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233311.1|3035995_3036268_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|3036393_3036618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137338.1|3036909_3038067_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	8.1e-137
3036840:3036860	attR	TTTCCTTATGAAAAACGGTTG	NA	NA	NA	NA
WP_000504047.1|3038106_3038679_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_001398592.1|3038716_3039892_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_001020669.1|3039888_3040227_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_000134114.1|3040223_3040520_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001145906.1|3040519_3040960_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
WP_000113646.1|3041248_3041605_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	3.6e-51
WP_000127884.1|3041588_3043250_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	2.2e-276
>prophage 205
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3046459	3047830	5646446		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|3046459_3047830_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 206
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3050966	3054695	5646446		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444487.1|3050966_3052217_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|3052319_3052643_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|3053175_3053286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|3053338_3053743_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|3053963_3054695_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 207
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3060562	3062884	5646446		Escherichia_phage(100.0%)	1	NA	NA
WP_001369554.1|3060562_3062884_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
>prophage 208
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3071402	3073090	5646446		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|3071402_3071822_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457626.1|3071821_3073090_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	2.3e-209
>prophage 209
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3099850	3102602	5646446		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|3099850_3101530_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|3101654_3102602_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 210
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3105738	3109746	5646446		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|3105738_3106821_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|3106820_3107654_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|3107650_3108043_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257045.1|3108046_3108856_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|3108891_3109746_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 211
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3112847	3113078	5646446		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|3112847_3113078_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 212
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3124331	3134223	5646446		Escherichia_phage(25.0%)	10	NA	NA
WP_000702668.1|3124331_3125870_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|3125866_3126577_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|3126576_3127254_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555854.1|3127860_3128703_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.4e-13
WP_001307143.1|3128752_3129211_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|3129323_3130229_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|3130320_3131334_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|3131535_3132444_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287380.1|3132587_3133001_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|3133605_3134223_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 213
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3143633	3145648	5646446		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|3143633_3144647_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|3144643_3145648_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 214
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3151061	3151640	5646446		Aeromonas_phage(100.0%)	1	NA	NA
WP_032233336.1|3151061_3151640_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	36.8	8.2e-21
>prophage 215
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3158028	3237380	5646446	transposase,capsid,holin,protease,terminase,integrase,head,tail	Stx2-converting_phage(32.73%)	86	3157865:3157892	3220311:3220338
3157865:3157892	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|3158028_3159159_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|3159136_3159385_-	excisionase	NA	NA	NA	NA	NA
WP_000048478.1|3159449_3161921_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|3162016_3162205_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|3162201_3162390_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|3162789_3162957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|3162950_3163184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3163161_3163569_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|3163591_3163810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|3163882_3164182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|3164446_3164854_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|3164930_3165158_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|3165141_3165693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|3165664_3166705_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|3166616_3167159_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|3167922_3168087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|3168785_3169544_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|3169822_3170035_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|3170255_3170513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|3170582_3170861_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265290.1|3170862_3171918_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|3171918_3172284_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|3172280_3172970_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023141.1|3174493_3176347_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|3176496_3176712_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|3176716_3177061_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|3177111_3177645_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056806.1|3177915_3178485_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|3178484_3178631_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|3178858_3179065_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|3179129_3179354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|3179710_3179851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428130.1|3179980_3180166_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000829192.1|3180207_3180573_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|3180861_3181425_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_033800465.1|3181421_3183083_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000173027.1|3183146_3184925_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	91.6	0.0e+00
WP_001063025.1|3184969_3185191_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|3187717_3188044_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|3188054_3188405_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|3188401_3188848_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|3188844_3189189_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_032244183.1|3189254_3189971_+|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	5.2e-126
WP_000710949.1|3189985_3190360_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|3190455_3190665_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_106918339.1|3190712_3193955_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.1	0.0e+00
WP_000807940.1|3193947_3194289_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|3194288_3194987_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_044863475.1|3194997_3195741_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.6e-149
WP_129593009.1|3195686_3196319_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	4.6e-102
WP_106918340.1|3196661_3199112_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.0	0.0e+00
WP_000839170.1|3199189_3199594_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_000612626.1|3199590_3199938_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|3199986_3201525_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000902073.1|3201547_3202597_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_001228278.1|3202664_3203264_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_106918341.1|3203415_3204729_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	2.0e-75
WP_000381395.1|3204761_3206333_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3206352_3206700_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3206699_3207377_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001023357.1|3207437_3207707_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_106409364.1|3211652_3211775_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|3211881_3212793_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|3212858_3213428_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|3214595_3214874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|3215301_3215448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|3215584_3216232_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|3216415_3217006_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|3219768_3219987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079509.1|3220488_3220995_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
3220311:3220338	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|3221040_3221541_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|3221626_3221806_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|3222186_3222993_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|3222992_3224186_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001342102.1|3224197_3225556_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000763511.1|3225559_3227155_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_023442273.1|3227154_3228717_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3228808_3228853_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|3228990_3229872_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001342101.1|3229868_3230489_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|3230589_3231462_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|3231501_3232092_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|3232088_3232847_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|3233066_3234116_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|3234151_3234403_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|3234782_3237380_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 216
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3242304	3242895	5646446		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3242304_3242895_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 217
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3250710	3256368	5646446		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484968.1|3250710_3252645_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.9	6.9e-32
WP_000437858.1|3252712_3253840_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3253984_3254773_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968850.1|3255140_3255494_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|3255561_3256368_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 218
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3269283	3270549	5646446		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|3269283_3270549_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 219
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3284552	3285635	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|3284552_3285635_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 220
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3303821	3304337	5646446		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945026.1|3303821_3304337_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
>prophage 221
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3310663	3367271	5646446	transposase,capsid,lysis,portal,holin,tRNA,terminase,integrase,head,tail	Escherichia_phage(42.86%)	68	3310783:3310797	3333057:3333071
WP_000628065.1|3310663_3311896_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3310783:3310797	attL	CGGTAAAACGTGGTA	NA	NA	NA	NA
WP_000387388.1|3312150_3313134_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|3313611_3314985_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157401.1|3315113_3316049_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.1e-144
WP_000040851.1|3316100_3317336_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_000079604.1|3317337_3317553_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|3317652_3317841_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|3317878_3318028_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|3318083_3318893_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105150.1|3318885_3321486_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.0e-248
WP_000632297.1|3321587_3321863_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|3321937_3322108_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|3322107_3322329_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001427316.1|3322749_3322902_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000233320.1|3323200_3323620_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072343.1|3323699_3323954_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|3323950_3324373_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000788968.1|3325247_3325994_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450674.1|3326016_3326778_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001151124.1|3326793_3327216_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_001266134.1|3327212_3327509_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|3327505_3327967_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|3327944_3328301_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|3328351_3328564_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|3328649_3328814_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|3328815_3329079_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|3329089_3329959_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|3330074_3330179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|3330368_3330581_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341382.1|3330748_3331027_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265060.1|3331028_3332078_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	6.9e-111
WP_001217413.1|3332090_3332465_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|3332461_3333283_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
3333057:3333071	attR	CGGTAAAACGTGGTA	NA	NA	NA	NA
WP_000143049.1|3334453_3336304_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|3336751_3336958_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|3336957_3337455_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|3337451_3337889_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|3338038_3338656_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|3338843_3339038_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|3339426_3339972_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|3339946_3341872_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|3341868_3342075_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|3342071_3343673_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123251.1|3343653_3344973_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|3344982_3345315_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|3345370_3346396_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|3346437_3346833_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|3346844_3347198_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|3347209_3347788_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683137.1|3347784_3348180_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_032325228.1|3348187_3348940_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000479086.1|3348953_3349385_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|3349411_3349825_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|3349805_3352385_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|3352381_3352711_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|3352710_3353409_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_001375575.1|3353414_3354158_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_106918344.1|3354980_3358457_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.9	0.0e+00
WP_001230496.1|3358523_3359123_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_032284465.1|3359187_3360501_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023998.1|3360502_3360772_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	2.3e-42
WP_122988840.1|3360882_3360960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|3361174_3362188_+	peptidase M85	NA	NA	NA	NA	NA
WP_097451673.1|3362641_3363798_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
WP_096845570.1|3363849_3364140_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	82.0	2.6e-20
WP_000347482.1|3364199_3365483_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|3365571_3367032_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|3367067_3367271_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 222
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3381808	3383938	5646446		Pandoravirus(50.0%)	3	NA	NA
WP_000012618.1|3381808_3383248_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_000803659.1|3383304_3383523_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_106918345.1|3383554_3383938_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	8.1e-09
>prophage 223
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3391683	3393102	5646446		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|3391683_3393102_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 224
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3400308	3401844	5646446		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194888.1|3400308_3401844_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 225
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3419810	3421024	5646446	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_085948178.1|3419810_3421024_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 226
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3428334	3435270	5646446		Bacillus_phage(50.0%)	3	NA	NA
WP_001443745.1|3428334_3430020_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
WP_000832502.1|3430057_3432430_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001345363.1|3432474_3435270_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
>prophage 227
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3440549	3444356	5646446		Bacillus_virus(50.0%)	2	NA	NA
WP_000426272.1|3440549_3441932_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001427328.1|3441956_3444356_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 228
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3448656	3450562	5646446		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193551.1|3448656_3449643_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
WP_001285544.1|3449635_3450562_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
>prophage 229
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3453836	3455278	5646446		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|3453836_3454847_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|3454993_3455278_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 230
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3461290	3461581	5646446		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|3461290_3461581_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 231
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3468466	3470011	5646446		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|3468466_3470011_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 232
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3476405	3482790	5646446		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000014716.1|3476405_3480614_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
WP_000103194.1|3480681_3482790_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-27
>prophage 233
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3487697	3489800	5646446		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|3487697_3489800_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 234
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3494065	3494875	5646446		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|3494065_3494875_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 235
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3498256	3508429	5646446	transposase	Mycoplasma_phage(20.0%)	9	NA	NA
WP_000220396.1|3498256_3499270_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|3499287_3500433_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001270286.1|3502161_3502578_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|3502623_3502800_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|3503021_3503252_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001341357.1|3503343_3505305_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429155.1|3505377_3505914_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001307190.1|3505966_3507181_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000826406.1|3507220_3508429_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
>prophage 236
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3520231	3521180	5646446		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|3520231_3520405_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|3520649_3521180_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 237
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3525119	3529022	5646446		Klosneuvirus(100.0%)	1	NA	NA
WP_000139556.1|3525119_3529022_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 238
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3560308	3561298	5646446		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3560308_3561298_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 239
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3566258	3619497	5646446	transposase,portal,holin,terminase,integrase,head,tail	Enterobacteria_phage(37.29%)	67	3577710:3577725	3628755:3628770
WP_000837924.1|3566258_3567392_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|3567532_3567967_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|3568907_3569549_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|3569630_3570260_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131657.1|3570332_3570908_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001023379.1|3571020_3571290_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_106918347.1|3571291_3572605_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	2.4e-76
WP_001230428.1|3572669_3573269_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106918348.1|3573336_3576813_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_096844540.1|3577058_3577691_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_001375575.1|3577636_3578380_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
3577710:3577725	attL	CGCCAGACAGAATGCG	NA	NA	NA	NA
WP_106918349.1|3578385_3579084_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_000847280.1|3579083_3579413_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_000081793.1|3579409_3582022_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
WP_000533440.1|3582002_3582416_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|3582442_3582865_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|3582878_3583631_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000683124.1|3583638_3584034_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	91.6	3.7e-65
WP_000975096.1|3584030_3584609_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|3584620_3584974_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_001695575.1|3584985_3585381_-	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_106918350.1|3585996_3586977_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001299443.1|3587782_3588115_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|3588124_3589444_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_024026143.1|3589424_3591026_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000198153.1|3591022_3591229_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|3591225_3593151_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867488.1|3593125_3593671_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	2.8e-79
WP_001300236.1|3594065_3594290_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|3594371_3594686_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3595213_3595399_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3595620_3595734_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000992045.1|3595954_3596488_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_071528021.1|3596599_3596860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193281.1|3596807_3597359_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	2.3e-36
WP_000411802.1|3597363_3597570_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032316733.1|3598017_3599868_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001064874.1|3600571_3601240_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	8.7e-59
WP_001217425.1|3601236_3601596_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001265151.1|3601608_3602658_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	3.2e-108
WP_001341388.1|3602659_3602938_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000128514.1|3603105_3603318_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_000787530.1|3603552_3603948_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_052922150.1|3603937_3604483_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	55.2	2.2e-60
WP_000256992.1|3604484_3604703_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_001002668.1|3604830_3605142_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
WP_001018050.1|3605381_3605663_-	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	80.9	1.8e-34
WP_024182342.1|3605659_3605956_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.9	2.3e-48
WP_001141099.1|3605952_3606345_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_000450862.1|3606360_3607131_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_000790459.1|3607160_3607901_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000095674.1|3607907_3608876_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000693888.1|3608898_3609324_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|3609307_3609589_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|3609689_3610109_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379562.1|3610374_3610527_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_000394548.1|3610538_3611177_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3611177_3611387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3611954_3612143_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3612139_3612331_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048585.1|3612424_3614896_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
WP_001368608.1|3614980_3615217_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206148.1|3615236_3616532_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|3616551_3616662_-	transporter	NA	NA	NA	NA	NA
WP_000836079.1|3616719_3617739_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|3617750_3618965_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3619170_3619497_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
3628755:3628770	attR	CGCCAGACAGAATGCG	NA	NA	NA	NA
>prophage 240
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3624378	3628943	5646446		Escherichia_phage(100.0%)	4	NA	NA
WP_001342196.1|3624378_3626802_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|3626812_3627430_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|3627431_3628286_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|3628328_3628943_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 241
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3635782	3652566	5646446	capsid,portal,protease,terminase,integrase,head	uncultured_Caudovirales_phage(90.91%)	24	3641407:3641422	3663745:3663760
WP_001260840.1|3635782_3636604_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|3636642_3636972_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|3636958_3637324_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|3637430_3637601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133423.1|3638637_3638919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127890.1|3638932_3640594_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	5.7e-277
WP_000113645.1|3640577_3640934_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|3641223_3641664_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
3641407:3641422	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|3641663_3641960_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|3641956_3642295_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_001398592.1|3642291_3643467_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504055.1|3643504_3644077_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|3644116_3645274_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_001132080.1|3645565_3645790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|3645915_3646188_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_044863309.1|3646198_3646609_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|3646605_3646851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000710169.1|3647138_3648956_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
WP_001261490.1|3648952_3649252_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113154.1|3649258_3649579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|3649571_3649862_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001496008.1|3649794_3650721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|3650773_3650962_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085277.1|3651336_3652566_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
3663745:3663760	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 242
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3661581	3662883	5646446		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|3661581_3662883_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 243
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3672778	3674590	5646446		Vaccinia_virus(100.0%)	1	NA	NA
WP_106918351.1|3672778_3674590_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 244
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3694465	3695740	5646446	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3694465_3695740_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 245
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3702651	3704150	5646446		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|3702651_3703173_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|3703253_3704150_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 246
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3712953	3721757	5646446		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101183.1|3712953_3713781_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|3713908_3714490_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|3714635_3715805_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|3715970_3716060_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|3716358_3717384_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|3717380_3718313_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|3718425_3719637_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|3719927_3721076_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|3721115_3721757_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 247
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3727261	3729528	5646446		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|3727261_3728074_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069997.1|3728077_3728863_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|3728859_3729528_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 248
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3737818	3742902	5646446		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|3737818_3739039_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|3739035_3740307_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948856.1|3740281_3741028_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001297388.1|3741037_3742525_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|3742533_3742902_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 249
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3761492	3781086	5646446	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553698.1|3761492_3763193_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.2e-32
WP_000069375.1|3763249_3765628_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368048.1|3765960_3766794_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082235.1|3766950_3767997_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	7.2e-84
WP_001270809.1|3768128_3768320_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175600.1|3768323_3769760_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001326034.1|3769822_3770536_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|3770782_3771247_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029479.1|3771324_3772074_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|3772073_3772625_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|3772687_3773668_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|3773768_3774068_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|3774072_3776460_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|3776474_3777458_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|3777741_3777786_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3777908_3778265_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3778317_3778515_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|3778611_3779154_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|3779157_3781086_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 250
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3792383	3794645	5646446		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|3792383_3794645_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 251
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3800984	3801812	5646446		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|3800984_3801812_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 252
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3809288	3810509	5646446		Klosneuvirus(100.0%)	1	NA	NA
WP_000081962.1|3809288_3810509_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.1e-27
>prophage 253
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3817273	3817927	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882827.1|3817273_3817927_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.6	8.4e-14
>prophage 254
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3823525	3825487	5646446		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235820.1|3823525_3825487_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 255
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3830413	3831055	5646446		Tupanvirus(100.0%)	1	NA	NA
WP_001120527.1|3830413_3831055_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 256
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3834298	3835153	5646446		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|3834298_3835153_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 257
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3838471	3906434	5646446	transposase,plate,protease,tRNA,integrase,head,tail	Shigella_phage(47.73%)	87	3854677:3854693	3894099:3894115
WP_000219686.1|3838471_3839755_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616411.1|3839901_3841377_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|3841557_3843048_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000138052.1|3843090_3843594_+|tRNA	mischarged aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_000999630.1|3843594_3843699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460707.1|3843868_3844315_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000972250.1|3844271_3845093_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000128477.1|3845189_3846371_+	2-nitroimidazole transporter	NA	NA	NA	NA	NA
WP_001297652.1|3846425_3846773_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000528251.1|3847070_3847808_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|3847761_3847962_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|3848076_3848541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|3848579_3848825_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|3848860_3849043_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|3849189_3851229_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|3851328_3851889_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|3852111_3852315_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|3852394_3852916_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|3852950_3853862_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|3853861_3854422_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|3854412_3855495_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
3854677:3854693	attL	GCTGATTGTCGGCCCAA	NA	NA	NA	NA
WP_000763330.1|3855494_3855932_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|3855924_3856539_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|3856528_3857653_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_032244543.1|3857636_3858986_-	multidrug DMT transporter permease	NA	C9DGQ2	Escherichia_phage	33.1	2.9e-53
WP_000213225.1|3861173_3861650_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|3861664_3862030_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000848437.1|3863536_3863782_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|3863782_3864343_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|3864339_3864759_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002054.1|3864755_3865160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|3865203_3866151_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850811.1|3866150_3867275_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_000094804.1|3867451_3867925_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|3868043_3869369_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|3869352_3870942_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|3870941_3872606_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000360581.1|3872605_3873187_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|3873189_3873480_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|3873476_3873785_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|3873765_3873993_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|3874002_3874221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|3874204_3874633_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|3874667_3875168_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|3875239_3875665_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|3875734_3876244_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|3876240_3876537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|3876526_3876724_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|3876716_3877049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|3877087_3877273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|3877269_3877821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|3877824_3878340_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|3878339_3878873_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|3878876_3879419_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|3879516_3880047_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_023441717.1|3880058_3880352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|3880356_3880629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3880625_3880907_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|3880908_3881163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|3881175_3881397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|3881399_3882332_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|3882402_3884493_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|3884494_3884743_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|3884933_3885464_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001283455.1|3886007_3887033_+	diguanylate cyclase DgcP	NA	NA	NA	NA	NA
WP_001219350.1|3887065_3887164_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|3887166_3887241_+	protein YoaJ	NA	NA	NA	NA	NA
WP_000512153.1|3887299_3887548_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000826412.1|3887775_3888984_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	6.0e-207
WP_000604932.1|3888991_3889423_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|3889438_3889627_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|3889630_3889990_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|3890162_3890801_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|3890927_3891851_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000978494.1|3891953_3893039_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|3893289_3894900_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
3894099:3894115	attR	GCTGATTGTCGGCCCAA	NA	NA	NA	NA
WP_000067805.1|3894931_3896056_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|3896111_3897077_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|3897130_3898246_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|3898327_3900013_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|3900217_3900799_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|3900838_3901534_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|3901591_3903502_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|3903633_3903978_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|3904340_3904700_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|3904819_3904999_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|3905072_3906434_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 258
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3910296	3911853	5646446		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|3910296_3911853_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 259
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3917493	3917703	5646446		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3917493_3917703_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 260
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	3921960	3992228	5646446	transposase,capsid,protease,holin,terminase,integrase,head,tail	Escherichia_phage(35.82%)	82	3927282:3927296	3992231:3992245
WP_000984517.1|3921960_3922842_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001427396.1|3923033_3925082_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|3925101_3925800_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|3925896_3926394_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207284.1|3926523_3927807_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
3927282:3927296	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
WP_001299674.1|3927775_3930409_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|3930488_3931928_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|3932045_3932282_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|3932386_3932578_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|3932578_3933235_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|3934189_3934840_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|3935064_3935940_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|3936080_3936350_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_106918353.1|3936351_3937665_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	2.4e-76
WP_001230428.1|3937729_3938329_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106918354.1|3938396_3941870_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.3	0.0e+00
WP_000649829.1|3942003_3942531_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_072280596.1|3942721_3943354_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.1e-103
WP_009445180.1|3943299_3944043_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.2e-146
WP_001179486.1|3944053_3944752_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.5e-130
WP_000807964.1|3944751_3945093_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_106918332.1|3945085_3948328_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.9	0.0e+00
WP_001453698.1|3948379_3948589_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3948684_3949059_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275471.1|3949064_3949781_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|3949846_3950191_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3950187_3950634_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3950630_3950981_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3950990_3951317_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063110.1|3953843_3954065_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	94.5	1.6e-33
WP_000173079.1|3954109_3956047_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001368653.1|3956110_3957772_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|3957768_3958332_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829190.1|3958620_3958986_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000095741.1|3959027_3959228_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000828068.1|3959359_3959686_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_001109019.1|3960031_3960583_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_071529499.1|3960821_3961007_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001280922.1|3961229_3961361_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000661712.1|3961455_3962151_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000087733.1|3962424_3962958_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001072901.1|3962962_3963178_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290221.1|3963254_3963527_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_000143458.1|3963567_3963747_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106918355.1|3963882_3965820_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_001339397.1|3965925_3966603_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3966602_3966950_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3966969_3968541_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000466957.1|3969098_3969530_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|3969979_3970693_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|3970827_3971025_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000211431.1|3971268_3971850_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	83.1	7.4e-54
WP_000640124.1|3972120_3972675_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	2.2e-71
WP_000228018.1|3972671_3972962_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000940309.1|3972961_3973561_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	3.8e-106
WP_071527992.1|3973632_3973884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001186253.1|3974119_3974272_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	91.8	6.0e-16
WP_000107695.1|3974420_3976250_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000721512.1|3976273_3977314_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.8	3.8e-61
WP_001141109.1|3977347_3977779_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.4	1.0e-60
WP_000450657.1|3977794_3978565_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.5e-88
WP_000788774.1|3978587_3979334_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.1	2.4e-113
WP_001427413.1|3979340_3980129_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.8	1.8e-42
WP_000702028.1|3980206_3980629_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_001033914.1|3980625_3980868_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|3980964_3981384_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|3981690_3981843_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000560218.1|3982263_3982485_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427414.1|3982484_3982655_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_001307773.1|3982728_3983004_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_000105102.1|3983102_3985754_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.7	0.0e+00
WP_000166317.1|3985746_3986556_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|3986612_3986807_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|3986799_3986988_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|3987094_3987376_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189091.1|3987341_3988418_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976492.1|3988810_3989152_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|3989164_3990037_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|3990040_3990415_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3990553_3990784_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|3990885_3991542_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|3991565_3992228_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
3992231:3992245	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 261
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4000284	4001760	5646446		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|4000284_4001760_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 262
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4015338	4016466	5646446		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741722.1|4015338_4016466_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 263
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4023929	4030993	5646446		Bacillus_virus(50.0%)	9	NA	NA
WP_023441833.1|4023929_4025252_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|4025267_4026200_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4026278_4027034_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|4027030_4027816_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4027962_4028973_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580328.1|4028981_4029593_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|4029731_4029797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024917.1|4029867_4030470_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4030471_4030993_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 264
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4035011	4110984	5646446	capsid,portal,plate,holin,tRNA,terminase,integrase,head,tail	Enterobacteria_phage(72.34%)	85	4074593:4074652	4111927:4112047
WP_000639271.1|4035011_4035830_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
WP_000252979.1|4035882_4036278_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|4036318_4037062_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|4037058_4038030_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176770.1|4038194_4040624_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|4040648_4041749_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|4042136_4042883_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|4042896_4043463_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|4043678_4045412_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|4045588_4046077_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|4046196_4046589_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067000.1|4046588_4048667_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|4048659_4049808_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|4050009_4050654_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|4050664_4051054_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|4051068_4052118_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|4052120_4052981_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|4052999_4054604_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|4054649_4056311_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|4056455_4056959_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|4056979_4058944_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|4058948_4059875_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906335.1|4059871_4060759_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|4060885_4061464_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|4061466_4061817_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|4062596_4063025_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|4063031_4064456_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|4064430_4065231_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|4065397_4066384_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|4066398_4067913_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|4067982_4068972_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|4069768_4070272_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082123.1|4070350_4070602_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|4070716_4070803_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|4071065_4071389_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|4071559_4072057_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|4072094_4072334_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|4072524_4073736_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|4073797_4074463_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
4074593:4074652	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|4074819_4075821_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_106918356.1|4075826_4076174_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|4076203_4076854_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|4076869_4077274_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|4077363_4077501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|4077572_4077776_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|4077797_4078148_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|4078158_4078437_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|4078448_4078691_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021647.1|4078687_4078801_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000985152.1|4078887_4079091_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000564224.1|4079414_4079804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272086.1|4079800_4082641_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.5	0.0e+00
WP_106918357.1|4082717_4083677_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.3e-180
WP_000211289.1|4083681_4083993_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289965.1|4084056_4084647_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	6.8e-31
WP_000087812.1|4085136_4086183_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_032317643.1|4086182_4087934_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262635.1|4088088_4088925_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	1.3e-149
WP_001055094.1|4088948_4090001_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632311.1|4090046_4090847_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|4090948_4091443_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|4091442_4091643_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_001342221.1|4091645_4091969_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072339.1|4091965_4092358_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.4e-69
WP_000780555.1|4092354_4092762_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202144.1|4092900_4094778_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_001342220.1|4094801_4095269_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000356324.1|4095261_4095897_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271909.1|4095893_4096475_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000213447.1|4096471_4096822_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111967.1|4096825_4097722_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|4097714_4098245_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_000108516.1|4098247_4100380_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
WP_000144010.1|4100379_4100958_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000954196.1|4101001_4101574_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979948.1|4101730_4102219_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	2.6e-84
WP_000853453.1|4102231_4105039_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.6	0.0e+00
WP_000763327.1|4105025_4105154_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|4105189_4105555_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|4105609_4106122_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005439.1|4106121_4107306_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000132847.1|4107463_4108564_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_001317900.1|4108963_4110103_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|4110392_4110653_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|4110843_4110984_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
4111927:4112047	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 265
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4117239	4117992	5646446		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4117239_4117992_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 266
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4129792	4130461	5646446		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334596.1|4129792_4130461_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
>prophage 267
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4144479	4154679	5646446		Bacillus_phage(40.0%)	8	NA	NA
WP_001375614.1|4144479_4146174_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	7.7e-19
WP_000009307.1|4146411_4146594_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001443725.1|4146672_4147590_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212225.1|4147762_4148683_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228683.1|4148671_4149142_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001157256.1|4149122_4150541_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000826783.1|4152649_4154008_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001339045.1|4154007_4154679_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 268
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4163581	4184167	5646446		Bacillus_phage(50.0%)	5	NA	NA
WP_001342205.1|4163581_4165384_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	4.6e-22
WP_000098402.1|4165370_4167173_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	28.2	4.1e-34
WP_000140404.1|4167339_4168299_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623060.1|4168489_4174597_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	8.9e-33
WP_000369479.1|4174684_4184167_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 269
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4213366	4214647	5646446	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_085953785.1|4213366_4214579_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_071998452.1|4214545_4214647_+|transposase	transposase	transposase	A0A0N7BTS3	Escherichia_phage	83.9	3.4e-07
>prophage 270
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4221931	4224547	5646446	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001339397.1|4221931_4222609_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4222608_4222956_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4222975_4224547_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 271
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4231357	4233516	5646446		Yersinia_phage(33.33%)	4	NA	NA
WP_106918360.1|4231357_4232179_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	1.0e-45
WP_000860060.1|4232260_4232740_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	2.0e-12
WP_001186773.1|4232755_4233232_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|4233294_4233516_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 272
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4246668	4247568	5646446		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|4246668_4247568_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 273
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4254921	4258876	5646446		Paramecium_bursaria_Chlorella_virus(33.33%)	3	NA	NA
WP_000704888.1|4254921_4256088_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	2.5e-109
WP_000043458.1|4256335_4257742_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_000996555.1|4257847_4258876_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.7	4.3e-81
>prophage 274
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4262503	4272463	5646446		Enterobacteria_phage(33.33%)	10	NA	NA
WP_001298834.1|4262503_4263394_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	33.6	2.2e-09
WP_000587272.1|4263396_4264383_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000413393.1|4264386_4265652_-	O103 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000564885.1|4265639_4266746_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.0	3.2e-42
WP_001245217.1|4266757_4267291_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001064117.1|4267283_4267691_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000676085.1|4267683_4268556_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.7e-110
WP_000699446.1|4268552_4269629_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.3e-101
WP_000183032.1|4270000_4270894_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_001115979.1|4271068_4272463_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.9	2.8e-19
>prophage 275
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4278466	4285260	5646446		Bacillus_phage(25.0%)	6	NA	NA
WP_001313977.1|4278466_4279837_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000079309.1|4280029_4281466_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.7e-46
WP_000699750.1|4281468_4282692_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001298845.1|4282688_4283168_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|4283170_4284136_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_000048190.1|4284138_4285260_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 276
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4289013	4300157	5646446		Streptococcus_virus(16.67%)	9	NA	NA
WP_000888737.1|4289013_4289502_-	colanic acid biosynthesis acetyltransferase WcaB	NA	A0A191KBJ5	Streptococcus_virus	37.0	1.8e-08
WP_000654503.1|4289504_4290344_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137152.1|4290521_4292684_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|4292686_4293130_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978085.1|4293135_4294275_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000454701.1|4294933_4296517_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252325.1|4296967_4298821_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|4298842_4299424_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|4299515_4300157_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 277
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4304821	4306174	5646446		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469759.1|4304821_4306174_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 278
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4319615	4326489	5646446	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675146.1|4319615_4321019_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137873.1|4321015_4321738_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|4321928_4322261_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|4322469_4322766_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|4322767_4323064_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|4323166_4324528_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|4324857_4325175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|4325589_4326489_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 279
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4335712	4339269	5646446		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|4335712_4336717_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|4336713_4337679_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|4337652_4338399_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|4338450_4339269_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
>prophage 280
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4349916	4351950	5646446	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|4349916_4351950_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 281
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4364516	4376254	5646446	transposase	Enterobacteria_phage(55.56%)	12	NA	NA
WP_001292774.1|4364516_4365653_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001342301.1|4365649_4367650_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|4367981_4368362_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4368358_4368706_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|4368755_4370141_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|4370572_4371043_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|4371089_4371809_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4371805_4373491_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4373712_4374444_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|4374503_4374611_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4374591_4375323_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|4375327_4376254_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 282
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4396587	4398108	5646446		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_106918361.1|4396587_4398108_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 283
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4401802	4405588	5646446		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|4401802_4402471_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425428.1|4402728_4403565_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|4403596_4405588_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 284
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4409657	4410515	5646446		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4409657_4410515_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 285
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4425010	4429311	5646446		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848223.1|4425010_4426477_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_000198822.1|4426594_4427581_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001296828.1|4427619_4428333_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|4428744_4429311_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 286
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4435065	4558915	5646446	transposase,capsid,lysis,portal,protease,holin,terminase,integrase,head,tail	Enterobacteria_phage(32.58%)	133	4482424:4482442	4556703:4556721
WP_000194876.1|4435065_4436655_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|4436658_4437003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213360.1|4437335_4438526_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|4438553_4439249_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|4439397_4441158_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|4441282_4441567_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|4441705_4442713_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135667.1|4442894_4443122_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256200.1|4443141_4444902_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000101718.1|4445271_4446513_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|4447009_4447216_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|4447899_4448460_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_001342316.1|4448449_4448692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|4448664_4448898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205000.1|4448890_4449124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|4449129_4449429_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|4449425_4450826_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_001080641.1|4451027_4451273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391151.1|4451403_4451598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|4451601_4451763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229488.1|4451890_4452379_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
WP_001369202.1|4452541_4453465_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001113637.1|4456843_4457491_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001211567.1|4457525_4458578_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000824439.1|4458574_4459132_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|4459128_4461072_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|4461068_4461548_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|4461544_4461754_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|4461750_4462488_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|4462529_4463192_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000888560.1|4463188_4463806_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000528376.1|4463824_4464427_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|4464436_4464886_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|4464882_4465746_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|4465732_4466428_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|4466434_4468921_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|4468917_4469181_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000686723.1|4469170_4469665_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001296837.1|4469773_4469938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000849214.1|4470073_4470562_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|4470710_4472357_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|4472574_4474218_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|4474293_4474944_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|4474943_4476008_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|4476081_4477137_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|4477248_4478340_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|4479078_4481751_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|4481767_4482418_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
4482424:4482442	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876014.1|4482503_4485353_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|4485627_4486404_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|4486408_4488058_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|4488058_4492453_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|4493254_4494577_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001023380.1|4496143_4496413_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_000279018.1|4496414_4497728_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001228241.1|4497792_4498392_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_001230644.1|4498459_4498675_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_000099160.1|4498737_4500276_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612622.1|4500324_4500672_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000839179.1|4500668_4501073_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_032284631.1|4501101_4504401_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000090884.1|4504461_4505094_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000194778.1|4505030_4505774_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_001152619.1|4505779_4506478_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|4506477_4506807_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_000082375.1|4506803_4509365_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|4509345_4509759_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|4509785_4510217_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|4510230_4510983_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|4510990_4511386_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|4511382_4511958_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|4511972_4512326_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|4512318_4512693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|4512744_4513629_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|4513686_4514034_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|4514070_4515576_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000827572.1|4515565_4517158_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_000258991.1|4517154_4517361_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001238637.1|4517344_4517551_-|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_001444182.1|4517563_4519273_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.9e-239
WP_000235436.1|4519244_4519754_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|4520148_4520343_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|4520702_4520996_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4521086_4521269_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|4521485_4521983_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|4521982_4522198_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|4522340_4522739_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|4522819_4522978_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_106918377.1|4523063_4523717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|4524058_4524682_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|4524678_4525344_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|4525340_4525943_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|4525917_4526484_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|4527025_4528861_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|4529364_4529547_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|4529543_4530071_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|4530067_4530514_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|4530521_4530728_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|4530800_4531091_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|4531087_4531789_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185462.1|4531785_4532724_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000035947.1|4532756_4533053_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|4533162_4533348_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|4533428_4534079_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|4534392_4534698_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|4534700_4535039_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|4535172_4535643_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|4535792_4536161_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|4536233_4536398_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|4536366_4536531_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|4536585_4536882_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|4536887_4537673_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|4537669_4538347_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|4538346_4538529_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|4538501_4538693_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|4538703_4538985_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|4539083_4539305_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|4539301_4539907_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|4539903_4540254_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|4540328_4540571_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|4540689_4541034_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|4541139_4541358_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|4541335_4542406_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|4542420_4543026_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|4543022_4544711_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|4544859_4547487_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|4547633_4548356_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001427555.1|4548483_4552218_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_001075177.1|4552913_4555199_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|4555287_4556418_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|4556417_4556672_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|4556725_4557376_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
4556703:4556721	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_000779084.1|4557838_4558915_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 287
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4564808	4565711	5646446	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|4564808_4565711_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 288
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4568863	4573867	5646446		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|4568863_4569466_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001427556.1|4569773_4570913_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	5.0e-30
WP_000461661.1|4570916_4571885_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_000860259.1|4571884_4573867_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 289
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4610199	4613427	5646446		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|4610199_4610799_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|4610857_4612690_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|4612776_4613427_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 290
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4623986	4625847	5646446		Sodalis_phage(50.0%)	2	NA	NA
WP_000156114.1|4623986_4624877_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	4.0e-67
WP_001293612.1|4625073_4625847_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 291
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4630058	4631576	5646446		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4630058_4631576_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 292
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4638052	4639189	5646446		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|4638052_4639189_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 293
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4647744	4648830	5646446		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|4647744_4648830_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 294
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4666702	4667635	5646446		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|4666702_4667635_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 295
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4676377	4678993	5646446	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001339397.1|4676377_4677055_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4677054_4677402_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4677421_4678993_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 296
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4691320	4692582	5646446		Pseudomonas_phage(50.0%)	3	NA	NA
WP_000214413.1|4691320_4691806_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	4.0e-13
WP_001186773.1|4691821_4692298_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|4692360_4692582_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 297
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4696052	4697486	5646446		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|4696052_4697486_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 298
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4704139	4711716	5646446		Hokovirus(50.0%)	4	NA	NA
WP_001443604.1|4704139_4707733_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|4707788_4708934_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|4709007_4709952_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|4710021_4711716_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 299
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4715407	4716328	5646446		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|4715407_4716328_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 300
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4720146	4720881	5646446		Clostridioides_phage(100.0%)	1	NA	NA
WP_001341597.1|4720146_4720881_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	2.7e-13
>prophage 301
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4746575	4761945	5646446		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|4746575_4748591_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|4748661_4749648_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|4749877_4750639_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|4750823_4751795_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|4752178_4752436_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|4752480_4754208_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|4754248_4754758_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|4754799_4755651_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|4755755_4756124_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|4756126_4757038_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|4757171_4758269_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852685.1|4758258_4759134_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|4759133_4759967_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|4759966_4760983_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517439.1|4761153_4761945_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
>prophage 302
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4765423	4770361	5646446		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|4765423_4766728_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|4766785_4767685_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|4767780_4768356_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001325675.1|4768416_4768866_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|4768852_4769278_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|4769491_4770361_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 303
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4788915	4789866	5646446		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4788915_4789866_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 304
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4807913	4808627	5646446		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4807913_4808627_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 305
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4829878	4833880	5646446		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|4829878_4831168_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|4831253_4831880_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001341612.1|4832204_4833242_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|4833241_4833880_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 306
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4840314	4846611	5646446		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|4840314_4840488_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669403.1|4840801_4841317_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755172.1|4841332_4841872_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
WP_000138282.1|4841966_4843544_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|4843612_4845079_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937895.1|4845240_4846611_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
>prophage 307
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4855440	4855872	5646446		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|4855440_4855872_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 308
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4865757	4872214	5646446		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|4865757_4867041_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|4867218_4867419_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|4867430_4867766_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|4867767_4869618_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|4869634_4870150_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|4870245_4870569_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|4870585_4870972_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|4870999_4872214_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 309
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4887507	4889019	5646446		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493455.1|4887507_4889019_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	9.6e-13
>prophage 310
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4894777	4906085	5646446		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|4894777_4896031_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|4896358_4897549_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|4897593_4897932_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|4897992_4899327_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215888.1|4899316_4900030_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001341630.1|4900194_4901622_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_000970107.1|4902197_4906085_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	9.1e-132
>prophage 311
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4910204	4910465	5646446		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4910204_4910465_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 312
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4913923	4917666	5646446		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|4913923_4914604_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|4914876_4915851_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|4915866_4917666_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 313
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	4922568	5027538	5646446	capsid,holin,tRNA,terminase,integrase,head,tail	Stx2-converting_phage(35.29%)	105	5011761:5011775	5023803:5023817
WP_001298974.1|4922568_4923306_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|4923437_4924772_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|4924980_4925862_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|4925964_4926552_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4926607_4926991_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|4927295_4927985_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|4928032_4929070_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4929276_4929696_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|4929764_4930463_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|4930494_4933155_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4933268_4934624_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|4934669_4934993_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|4934989_4936288_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|4942141_4944715_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|4944844_4945576_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|4945572_4946553_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4946687_4947425_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4947695_4948037_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4948140_4948188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|4948286_4949447_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|4949489_4950611_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|4950621_4951692_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|4951901_4952267_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4952416_4952935_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|4952924_4954151_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4954166_4954649_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4954725_4955073_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4955114_4955882_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4955912_4956461_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4956479_4956728_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|4956976_4958338_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4958504_4959296_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|4959316_4960603_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|4960657_4961251_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|4961373_4962252_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|4962337_4963999_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4964147_4964489_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|4964550_4964841_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4964830_4965307_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4965438_4965921_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000938111.1|4967674_4969036_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_001370486.1|4969412_4972814_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_001301673.1|4973405_4975754_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|4975773_4975863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|4975969_4976239_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_106918366.1|4976240_4977518_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	90.6	2.7e-77
WP_001230441.1|4977582_4978182_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	1.2e-110
WP_106918367.1|4978249_4981723_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.5	0.0e+00
WP_064761467.1|4981968_4982598_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_025404499.1|4982543_4983287_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_001357740.1|4983292_4983991_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|4983990_4984332_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_106918336.1|4984324_4987567_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.4	0.0e+00
WP_001513217.1|4987614_4987824_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|4987919_4988294_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_032244183.1|4988308_4989025_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	99.2	5.2e-126
WP_000133393.1|4989090_4989435_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|4989431_4989878_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|4989874_4990225_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|4990235_4990562_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063106.1|4993088_4993310_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.2e-35
WP_032284581.1|4993354_4995292_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001457603.1|4995355_4997017_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|4997013_4997577_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001365481.1|4997867_4998233_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000095736.1|4998274_4998502_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|4998870_4999095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047091958.1|4999180_4999366_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|4999884_5000418_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|5000468_5000813_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284519.1|5000817_5001033_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_001290231.1|5001109_5001382_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143462.1|5001422_5001602_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_032212763.1|5001737_5003675_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000868396.1|5004794_5005721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131907.1|5005707_5006256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|5006268_5006610_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001427606.1|5006627_5007617_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001061413.1|5007624_5008422_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767105.1|5008441_5008831_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210162.1|5008827_5009154_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_001427609.1|5009150_5009804_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_001447905.1|5009803_5010298_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	1.2e-86
WP_000061512.1|5010294_5011113_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	95.6	3.0e-117
WP_001444024.1|5011109_5011334_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	2.5e-34
WP_001087337.1|5011338_5012175_-	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.6	8.7e-149
5011761:5011775	attL	ATATCGCCTTGATCA	NA	NA	NA	NA
WP_000521508.1|5012171_5012723_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|5012766_5012967_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|5013057_5013732_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135680.1|5014398_5014761_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|5014826_5015651_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000008174.1|5015779_5016316_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000335005.1|5016306_5017185_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000158004.1|5017181_5017385_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000476199.1|5017377_5017617_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000034210.1|5017613_5017943_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000206753.1|5017944_5018808_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000457722.1|5018892_5019135_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|5019138_5019285_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|5019457_5020633_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_001431537.1|5021115_5022024_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_001427612.1|5022322_5023543_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.3	3.5e-231
WP_000448925.1|5023581_5023998_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
5023803:5023817	attR	TGATCAAGGCGATAT	NA	NA	NA	NA
WP_000214985.1|5024069_5025818_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000577251.1|5025819_5027538_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
>prophage 314
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5034110	5038235	5646446		Klosneuvirus(50.0%)	4	NA	NA
WP_001087606.1|5034110_5035391_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001325764.1|5035701_5037102_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|5037122_5037785_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|5037785_5038235_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 315
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5042170	5047466	5646446		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|5042170_5042416_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|5042412_5042823_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246514.1|5042795_5044940_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	7.1e-195
WP_000777938.1|5044949_5045909_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000985494.1|5046263_5047466_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 316
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5060143	5065703	5646446	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|5060143_5060329_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|5060563_5063194_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140519.1|5063321_5063822_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|5064064_5065126_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|5065205_5065703_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 317
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5071169	5072135	5646446		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|5071169_5072135_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 318
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5079708	5080722	5646446		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001341827.1|5079708_5080722_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	3.9e-26
>prophage 319
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5100189	5107329	5646446		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|5100189_5102751_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|5102856_5103513_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|5103563_5104331_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|5104526_5105435_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|5105431_5106694_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|5106690_5107329_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 320
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5112543	5116256	5646446		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_032343032.1|5112543_5113533_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	1.9e-30
WP_001272590.1|5113595_5114735_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|5114874_5115501_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|5115494_5116256_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 321
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5119368	5121401	5646446		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|5119368_5119974_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090394.1|5119973_5121401_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	3.7e-30
>prophage 322
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5150450	5155370	5646446		Vibrio_phage(33.33%)	5	NA	NA
WP_001199970.1|5150450_5151122_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|5151260_5151401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268451.1|5151414_5152287_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|5152346_5153645_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|5153732_5155370_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 323
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5159402	5163517	5646446		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046800.1|5159402_5160704_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|5160760_5163517_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 324
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5171051	5171900	5646446		Vibrio_phage(100.0%)	1	NA	NA
WP_000100393.1|5171051_5171900_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 325
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5176758	5177514	5646446		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|5176758_5177514_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 326
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5189040	5209919	5646446	tRNA	Bacillus_phage(22.22%)	14	NA	NA
WP_001299897.1|5189040_5190246_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
WP_000184265.1|5190245_5190689_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|5190739_5191546_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|5191622_5192720_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001341841.1|5193304_5194252_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.9	6.9e-17
WP_001066231.1|5194323_5194920_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_000350900.1|5194888_5196097_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810575.1|5196096_5197677_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_000582832.1|5197708_5198533_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|5198791_5200045_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|5200276_5201608_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_106918368.1|5201669_5203496_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.9	4.1e-26
WP_106918369.1|5203495_5207038_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	2.6e-08
WP_001138193.1|5207030_5209919_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	6.9e-68
>prophage 327
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5215395	5222168	5646446		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|5215395_5216190_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|5216196_5217072_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|5217222_5219469_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|5219481_5220012_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|5220696_5221386_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|5221454_5222168_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 328
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5231799	5234294	5646446		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|5231799_5233218_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603508.1|5233532_5234294_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 329
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5259014	5266963	5646446	transposase,integrase	Stx2-converting_phage(42.86%)	7	5256971:5256987	5266056:5266072
5256971:5256987	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000381395.1|5259014_5260586_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5260605_5260953_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5260952_5261630_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000082600.1|5262024_5262753_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000852869.1|5263661_5264321_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000935135.1|5264313_5265921_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_001272558.1|5266207_5266963_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
5266056:5266072	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
>prophage 330
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5291242	5306634	5646446	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|5291242_5292643_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|5292660_5293977_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|5294012_5295380_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|5295415_5295904_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001345944.1|5295903_5297823_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|5298258_5299707_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|5299708_5299834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|5299830_5299902_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192827.1|5299956_5300505_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003086.1|5300547_5302065_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001701073.1|5302074_5303173_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813220.1|5303263_5304997_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|5305002_5305713_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|5305737_5306634_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 331
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5310558	5315926	5646446		Pandoravirus(50.0%)	3	NA	NA
WP_001341859.1|5310558_5311992_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.3e-30
WP_000951964.1|5312048_5312792_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195029.1|5313052_5315926_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
>prophage 332
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5324454	5325687	5646446		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|5324454_5325687_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 333
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5343693	5344371	5646446		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|5343693_5344371_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 334
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5365372	5366527	5646446		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|5365372_5366527_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 335
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5392355	5399612	5646446	transposase,integrase	Pseudomonas_phage(33.33%)	3	5384881:5384894	5394319:5394332
5384881:5384894	attL	ATTTTGAACGCTTT	NA	NA	NA	NA
WP_001218848.1|5392355_5393621_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	5.3e-81
WP_001223345.1|5394646_5396737_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
5394319:5394332	attR	ATTTTGAACGCTTT	NA	NA	NA	NA
WP_085948183.1|5398398_5399612_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	8.7e-166
>prophage 336
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5414150	5415323	5646446		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524974.1|5414150_5415323_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	2.5e-40
>prophage 337
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5438816	5439701	5646446		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|5438816_5439701_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 338
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5445777	5456600	5646446		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|5445777_5446605_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|5446804_5447731_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|5447781_5448039_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|5448081_5450301_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|5450411_5451824_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|5451898_5452636_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281899.1|5452868_5455127_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.1e-84
WP_000183500.1|5455672_5456155_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|5456207_5456600_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 339
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5460427	5471389	5646446		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|5460427_5462320_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|5462348_5462930_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444756.1|5462929_5463757_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|5463781_5464204_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|5464204_5464834_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|5465038_5466520_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|5466667_5467339_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|5467344_5468505_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188373.1|5468542_5469358_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|5469473_5470247_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|5470304_5470475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|5470735_5471389_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 340
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5480904	5482338	5646446		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|5480904_5482338_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 341
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5487475	5488714	5646446	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708470.1|5487475_5488714_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.7e-92
>prophage 342
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5495096	5511281	5646446	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|5495096_5496110_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|5496347_5496563_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918826.1|5496673_5498419_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|5498613_5500455_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|5500533_5501040_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065885.1|5501293_5502058_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018000.1|5502334_5502958_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|5503111_5504632_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000627213.1|5504938_5506429_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|5506470_5506803_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|5507021_5508005_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082888.1|5508188_5511281_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	6.5e-157
>prophage 343
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5523698	5524664	5646446		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|5523698_5524664_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 344
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5550666	5552961	5646446		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861738.1|5550666_5552961_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	1.1e-156
>prophage 345
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5560950	5562096	5646446		Streptococcus_phage(100.0%)	1	NA	NA
WP_001297158.1|5560950_5562096_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 346
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5585105	5592898	5646446		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809253.1|5585105_5585966_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249157.1|5586029_5588066_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|5588023_5588419_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|5588438_5589029_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|5589038_5589614_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147635.1|5589727_5590768_-	permease	NA	NA	NA	NA	NA
WP_001298741.1|5590840_5591476_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|5591603_5592122_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449041.1|5592101_5592545_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|5592595_5592898_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 347
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5598727	5600617	5646446		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|5598727_5600617_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 348
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5606098	5612737	5646446		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|5606098_5608771_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|5608795_5610283_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|5610310_5610763_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|5611393_5612737_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 349
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5616819	5619692	5646446	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|5616819_5617668_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|5617757_5619692_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 350
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5626320	5627797	5646446		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|5626320_5627292_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|5627518_5627797_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 351
NZ_CP027577	Escherichia coli strain 2013C-4225 chromosome, complete genome	5646446	5631865	5645635	5646446		Bacillus_virus(14.29%)	16	NA	NA
WP_000438246.1|5631865_5632675_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|5632884_5633862_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|5633875_5634862_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030018.1|5634882_5635449_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	6.5e-55
WP_000030537.1|5635445_5636021_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|5635989_5636547_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|5636553_5637279_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|5637326_5638760_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|5638782_5639070_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|5639187_5639679_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|5639724_5640579_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|5640575_5640848_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|5641061_5641694_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|5641690_5642419_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|5642415_5643069_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_023442118.1|5643298_5645635_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
>prophage 1
NZ_CP027578	Escherichia coli strain 2013C-4225 plasmid unnamed	87714	4449	86327	87714	transposase,protease,integrase	Stx2-converting_phage(48.0%)	56	11987:12046	69602:72306
WP_096071227.1|4449_5663_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_136138333.1|5661_6075_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001034100.1|6878_10781_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136139077.1|11718_12138_-	DUF1449 family protein	NA	NA	NA	NA	NA
11987:12046	attL	GTAAGCGCCCCATCTGCGACGTCTTGTGAAAATTGTCCTGTCTGGCAACAATCGCGCCCA	NA	NA	NA	NA
WP_001341423.1|12068_12743_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|12739_13087_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|13090_14659_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000937603.1|14937_16125_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|16124_16490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|16726_17074_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_012917688.1|17123_18662_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_012680945.1|18965_19964_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000975743.1|21851_22958_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|22957_23779_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000839950.1|26428_26944_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217745.1|26945_29942_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987096.1|29991_32112_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_001213545.1|32115_33555_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000864810.1|33967_34321_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001164205.1|34493_35276_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465041.1|35277_35691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|36476_36893_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001165114.1|37054_37600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704534.1|38357_39218_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|39345_39732_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|39785_40460_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|40456_40804_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|40807_42376_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000154135.1|43035_43701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335839.1|43842_44484_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000907857.1|45185_46217_+	replication initiation protein	NA	NA	NA	NA	NA
WP_106918379.1|47176_56677_-	toxin B	NA	NA	NA	NA	NA
WP_001443774.1|56791_57022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000422675.1|60149_60626_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_000937603.1|64612_65800_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|65799_66165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012917687.1|66988_68557_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|68560_68908_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|68904_69579_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|69632_69860_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|70022_71000_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_158000298.1|71603_71828_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	4.4e-07
WP_097586315.1|71793_73007_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
69602:72306	attR	TGGGCGCGATTGTTGCCAGACAGGACAATTTTCACAAGACGTCGCAGATGGGGCGCTTACTTCCCTCGCGCCATTGTTGTCGCCATTTGAACAACAGATTGGCGTTAATGCCATTTTCAAGAGCAAGTTTTGAGATGGATATCCCGGGTTCACAGGAGGCAGCAACGAGCTGCTGTTTAAATTCGGGAGGATAATTAGGGCAGCCTTTTCGCCTGCCGGGAGTCACATTTTTCTGCATATCTGACACTTTGGTTCCCACTACTTATTTGGTGGACACCACTTTGTCTAATTCGTCAGATTCTGACCAGACGGTTCAGGCTGTACGCTTACATATAAACTGCAGTGAGCAGACCACTCACTGCACCTGATAATATAAGCTGTAGTCAGTAAAGGAGCACTCTTCACTGACTACAGTTTATGTTCAGCGGGATTTGAAGAGTTTTTCCAGGTCATCCAGCGTGATGCCCAGTTTTTCAAGCAGGGCAAGTTTCTCCGCCATCTCCGGACTGACTTTTTCCGCAGGTGAAGGTGGCAACGGATTTTCCTTACTCTCATCATTCGGCGCTTTTAACCGGGGACGCCGGTAGTGAATACAGAAGAATTTTGTCCGCCCCCGCTGGATCTCCGTGTAATCAAGATATCCAATCTCGCGCAACTGCTCCATTGCCCGTCTGACCGTCTGGTTCTGGGAAAATACAGGAGACTTCAGATTGAGGCGGGCACGCAGCCGCGCCAGCGATATCGGTGCCGGATCCCGGGGCAGGCTCTCTATAAAGGTGTAAAGTGCCTGGGCGGACTCCCGTCGCTTCAGGGCATTGATGGCCTTGAGCTGCAGCAGCACTTTCCGGTCAAACTGGTACAGTTCAAAAAGGCGGGGATCAGCCTGTAACTGAACAATATCCCGTTCAGTATCGTAGTAGGCTGACTGTACCAGATGGGTGATATATTCCCGGGTGTGCTTCTCATCGGTGCGGGAAAAGGAGATCACGGTACCGGCAATGCGTTTCAGGGAAGGGCTGATGCGCTCACGCAGCCTGCGGGATGACTGGCTTGAAGGTATACCACACAGTTTTGCAAACTCGACAAAAGGCAGTTCAACTTTGTCACCAATTACGTTATGGCGGGCAAAGGAATGAATGATTCCCACCCAGGTCTTGAAATCGTTATCCATATCCAGGCGGGGGCCGGTGATCTCAACCTTATCAAATCCCTCAGCACGGGCCAGGGAAAGACGTGTCAGCTCTTCCGTGGCATCAGTACGTGACAGTGTATTTTTTTTACTGTTCTTCAGTGATTTAAGGGTCGGTACAAAAACGCCCAGACGCATCAGCGCCACAGGTTGTACGGTGTTGTTATTGTTTGGTGTCAGTGTCACCAGCTCACCGGACGACTTATCCACCTCGCCGAACAGTTTTTTGATGTCTGAATTTTCGTTTTCCAGAAAGCCTCCTGCCTGTGGACAGTAAAAGAATAAACAGAAAATTGAGTGTCAGAACCCCGTCAACTGACTGAAGAAAAACCTGCAGTCTGTATTTAACAGCTGAGCCTGGCGTACTGACCATAATTTATGTCATTAACTTACTACAGTATATACATTACTGAATACAGCTTATCATGATCCTGCTACAGTTTATCAGAAACATGCCACAGCTTATGTGATCGTGGTCCCGGAGCATGAGTGACAAGGTTTGCAGCGATATGGGGATCTTTAATGGATCATTTCTTGATCATTTATGGATCTGTTTACTGGATCGGGCCGCCGGATATGTGGATAAATCATTCCGGGAAAACAGTTTACACAACTGTTTTATGAGGAAGCTTCAGGGCGTATCTGCTCACTGTAACTACAGATACATTGCGCTTCCTCGCCGGTTCGCGGGCTTCGCCCGGTCACCGGTCTGCGGCGAGCACCGACAACATACAGACAGAAGTCGCCTGATATACCGATAATGTATATATACCCCTCCTATACTGCGTACTCTCTGAGGATGTGCAATGTGATTTATGCAGTGGCGTTCGTCAGGAATGTGTAGTGGATCATAAAATCAGGACACCGGAATAACCTGTTTCCATTTTTCTTCATGCGGCAAGGCGATAAACCACCATTGTTTGTATGAGGTCGATAAACGTTGTAATAAGCATTTATCCACTGAACCGCCCCGGTTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCTGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGGATATGACCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCACCTGTACTCCCTGTTGATGCCAGCAGTTTTGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGATACATACTGAGAACCTTTATCACTGTGATGGACTGTGCCGGACGGCCGACGGGCCCACAACGCCTGCTCCAGTGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACTCGCCACCCCACGATACATCCGGCAAACACATCAATGATGAACGCCACACAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGACGTTC	NA	NA	NA	NA
WP_000592771.1|73191_75402_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|75445_75835_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445934.1|76795_77191_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|77190_78150_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_077249722.1|78422_79325_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086167.1|79708_80392_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_001443814.1|80391_80610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|80621_81056_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|81100_81583_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_032313270.1|82574_82892_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000218854.1|84578_85013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|85105_85372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|85436_86327_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
