The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	214326	252410	5411943	terminase,head,tail,plate,capsid,transposase,portal,holin,tRNA	Enterobacteria_phage(86.11%)	45	NA	NA
WP_001144192.1|214326_216255_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|216258_216801_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|216897_217095_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|217147_217504_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|217626_217671_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018594.1|217954_218938_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672378.1|218952_221340_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|221344_221644_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000078923.1|221950_222091_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	95.7	4.5e-18
WP_000488103.1|222281_222542_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001035742.1|222785_224288_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000132811.1|224513_225623_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	9.6e-204
WP_000005431.1|225780_226965_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	8.1e-225
WP_000290445.1|226964_227477_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.2	7.8e-92
WP_000651581.1|227532_227907_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	6.9e-37
WP_000333503.1|227915_228071_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853433.1|228057_230865_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	94.9	0.0e+00
WP_000979957.1|230877_231366_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	3.0e-85
WP_000954196.1|231522_232095_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144026.1|232138_232717_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	1.7e-95
WP_000108519.1|232716_234849_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.7	4.2e-131
WP_000071739.1|234851_235382_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_001111942.1|235374_236271_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.1e-154
WP_001067548.1|236274_236604_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001369311.1|236621_237188_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.8	2.1e-98
WP_000356341.1|237199_237835_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_000920593.1|237827_238295_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000780569.1|238432_238840_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000072327.1|238836_239229_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|239225_239549_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|239551_239752_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063082.1|239751_240246_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000632344.1|240348_241149_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	6.6e-130
WP_001055104.1|241194_242247_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262673.1|242270_243107_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613748.1|243261_245013_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.3	0.0e+00
WP_000087824.1|245012_246059_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	1.9e-201
WP_000236489.1|246073_246598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001390707.1|247160_247430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211267.1|247794_248106_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000686506.1|248110_249070_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	7.1e-179
WP_000165075.1|250642_251524_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	92.6	1.9e-114
WP_000514277.1|251588_251831_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159459.1|251842_252121_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_100206497.1|252131_252410_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.4	6.2e-27
>prophage 2
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	375892	477988	5411943	terminase,protease,head,tail,integrase,capsid,lysis,transposase,portal,holin	Stx2-converting_phage(27.54%)	114	400987:401016	458009:458038
WP_001260840.1|375892_376714_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|376813_376897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|376989_377325_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|377721_378975_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|379081_379975_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|380109_381330_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|381454_382150_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071526378.1|382102_383395_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|383553_384168_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|384210_385065_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|385066_385684_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|385694_388118_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000041554.1|388178_390605_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001307224.1|390803_391109_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|391216_391927_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|391929_392490_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|392524_392866_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|393000_393327_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|393532_394747_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|394758_395778_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|395835_395946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876990.1|395965_397246_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_000005552.1|397280_397532_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048302.1|397604_400076_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|400169_400361_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|400357_400546_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|400961_401249_+	hypothetical protein	NA	NA	NA	NA	NA
400987:401016	attL	TTTTAACCACGTCAGGCGAGGTGGTATCCT	NA	NA	NA	NA
WP_001241298.1|401217_401595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379591.1|401594_401747_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_001003381.1|401939_402347_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|402424_402652_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705364.1|402635_403157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054483.1|403137_404103_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_162832353.1|404441_405654_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.9e-168
WP_001064906.1|405785_406475_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_162829202.1|406741_407955_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001344632.1|408214_408346_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000143036.1|408793_410644_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_029785460.1|411080_411296_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000731236.1|411300_411645_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|411695_412229_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_001082554.1|412526_413021_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	93.8	4.0e-77
WP_000736096.1|413017_413242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|413610_413838_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279803.1|413879_414245_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	96.7	2.9e-64
WP_000958415.1|414534_415098_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	3.8e-79
WP_001369319.1|415094_416756_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	98.9	0.0e+00
WP_000173011.1|416819_418757_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063099.1|418801_419023_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_012817878.1|418968_421548_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
WP_000125990.1|421550_421877_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|421886_422237_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|422233_422680_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|422676_423021_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_024222395.1|423087_423804_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	95.8	1.3e-124
WP_001030041.1|423809_424184_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	5.0e-64
WP_001453698.1|424279_424489_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000937595.1|426597_427785_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|427784_428150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807940.1|429603_429945_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001369426.1|429944_430643_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	7.6e-130
WP_001369422.1|430648_431392_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	1.1e-147
WP_096860308.1|431337_431970_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	2.3e-101
WP_000514718.1|432312_435786_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.1	0.0e+00
WP_001228290.1|435853_436453_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_000216548.1|436604_437909_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	95.4	1.2e-72
WP_001023476.1|437910_438180_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_106409364.1|439294_439417_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|439523_440435_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_162829202.1|440981_442195_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303943.1|443221_443500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|443927_444074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|444210_444858_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144879.1|445041_445632_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|447138_447789_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001261191.1|448137_448491_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000171274.1|448581_449301_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|449340_449739_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|449843_450383_-	septation protein A	NA	NA	NA	NA	NA
WP_000028550.1|450412_451156_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737224.1|451512_452151_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|452196_453327_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|453304_453553_-	excisionase	NA	NA	NA	NA	NA
WP_000048484.1|453617_456089_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.7	5.5e-58
WP_000199480.1|456184_456373_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|456369_456558_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|456957_457125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|457118_457352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|457329_457737_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171894.1|457759_457978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|458050_458350_-	hypothetical protein	NA	NA	NA	NA	NA
458009:458038	attR	TTTTAACCACGTCAGGCGAGGTGGTATCCT	NA	NA	NA	NA
WP_000787428.1|458614_459022_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000705622.1|459308_459860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|459831_460872_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|460783_461326_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|461359_462094_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|462090_462255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053896405.1|462953_463712_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|463990_464203_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|464423_464681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032178572.1|464750_465029_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.8e-11
WP_001265289.1|465030_466086_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|466086_466452_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|466448_467138_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023139.1|468662_470432_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.8	0.0e+00
WP_162829202.1|470483_471696_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023452.1|471786_472056_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|472196_473072_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121225.1|473296_473947_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001345374.1|474274_474424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817881.1|474542_474785_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	81.9	1.3e-25
WP_000347482.1|474916_476200_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527750.1|476288_477749_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000214712.1|477784_477988_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 3
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	617211	736397	5411943	terminase,head,tail,capsid,transposase,holin,tRNA	Escherichia_phage(40.28%)	118	NA	NA
WP_000826406.1|617211_618420_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_001261013.1|618946_619615_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586732.1|619917_620511_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001341359.1|620507_621500_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000140877.1|622597_623134_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|623196_623421_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|623560_625216_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013783.1|625440_626784_-	VOC family protein	NA	NA	NA	NA	NA
WP_001345051.1|627000_627924_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098530.1|627961_629602_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|630000_630150_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|630221_630395_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|630639_631170_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|631358_632360_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|633900_634701_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139621.1|634972_638875_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|639075_639681_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627379.1|639731_641048_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000431813.1|641037_642795_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000890909.1|642810_643707_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000177525.1|643706_644312_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000477179.1|644482_646789_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_000097801.1|646852_647713_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123455.1|647943_648534_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000041176.1|648515_649466_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|649566_650880_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|650906_652112_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|652111_652534_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973362.1|652523_653951_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969777.1|653952_654741_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|654740_655508_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206377.1|655504_656575_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|656582_657080_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072831.1|657094_657841_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|657849_658137_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|658148_659078_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186481.1|659362_661408_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535449.1|661655_663929_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001067510.1|665708_666614_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001345059.1|666785_667115_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|667119_667305_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900925.1|667301_669941_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|670148_671138_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001295716.1|671248_671671_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|671667_671934_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628171.1|672207_675732_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837930.1|676098_677232_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.3	1.2e-116
WP_001295593.1|677372_677807_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|678387_679029_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_106904962.1|679110_679740_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.7e-77
WP_001131659.1|679812_680388_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|680500_680770_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_021351535.1|680771_682085_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	6.3e-77
WP_001230550.1|682149_682749_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|682819_686317_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|686450_686978_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|687168_687801_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|687746_688490_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|688500_689199_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807940.1|689198_689540_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106904963.1|689532_692775_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|692826_693036_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030043.1|693131_693506_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275461.1|693511_694228_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_000133388.1|694294_694639_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|694635_695082_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|695078_695429_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|695438_695765_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|698129_698351_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173011.1|698395_700333_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001411753.1|700396_702058_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|702054_702618_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|702906_703272_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|703313_703514_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|703645_703972_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_012817877.1|704372_704558_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001280923.1|704780_704912_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_000285960.1|705006_705183_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	98.3	3.3e-26
WP_162829202.1|705259_706472_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001344811.1|706475_707015_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	99.4	3.0e-86
WP_000992086.1|707288_707822_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000731221.1|707872_708217_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|708221_708437_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000143077.1|708586_710440_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000466957.1|711010_711442_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000640158.1|712003_712558_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000247761.1|712554_712845_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000940319.1|712844_713444_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000138556.1|713943_715335_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000016656.1|715334_716324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100703.1|716291_717443_-	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000365100.1|717874_718120_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_000208018.1|718198_718360_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000224233.1|718370_718634_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|718885_719098_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_001141110.1|719203_719626_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000450712.1|719641_720403_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788980.1|720425_721172_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_001304174.1|721178_721967_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000693803.1|722044_722467_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001072342.1|722463_722718_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233319.1|722797_723217_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001326317.1|723459_723639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001169151.1|723649_723805_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|723801_724290_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|724731_724953_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|724952_725123_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_001344816.1|725197_725473_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_106904964.1|725574_728175_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_000166313.1|728167_728977_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|729032_729182_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|729219_729408_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|729507_729723_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040839.1|729724_730960_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_001157407.1|731011_731947_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123745.1|732075_733449_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|733926_734910_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|735164_736397_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 4
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	796781	867906	5411943	terminase,protease,holin,tail,transposase,portal	Enterobacteria_phage(45.83%)	75	NA	NA
WP_162829202.1|796781_797994_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001288368.1|800025_800199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088625.1|800288_801038_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|801306_801525_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001295580.1|801650_801977_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176278.1|801976_802714_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|802905_804075_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876286.1|804081_804390_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256539.1|804538_805303_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|805472_806063_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099519.1|806126_808802_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|808965_809061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297116.1|809174_809342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908596.1|809344_809509_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|809803_810778_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001297122.1|810987_813585_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|813964_814216_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|814251_815301_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|815520_816279_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|816275_816866_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|816905_817778_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|817878_818499_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|818495_819377_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|819514_819559_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|819650_821213_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_032349540.1|821212_822808_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|822808_824170_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|824181_825375_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|825374_826181_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|826561_826741_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|826826_827327_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|827372_827879_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000251936.1|828367_828538_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_000692020.1|828915_829506_-	protein kinase	NA	NA	NA	NA	NA
WP_001023476.1|830641_830911_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
WP_000279057.1|830912_832226_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001230455.1|832290_832890_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|832957_836434_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|836680_837313_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001369128.1|837258_838002_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_001152113.1|838007_838706_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_000847298.1|838705_839035_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081781.1|839031_841644_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533440.1|841624_842038_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|842064_842487_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235090.1|842500_843253_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|843260_843659_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|843671_844295_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|844297_844579_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|844571_844898_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|844985_847010_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|846954_848457_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102413.1|848456_848669_-	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_001077625.1|848665_850789_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|850785_851262_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_012816791.1|851737_851923_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_024222375.1|852441_852975_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	9.6e-101
WP_162829202.1|853397_854611_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001344902.1|854636_854882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072901.1|854885_855101_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290214.1|855178_855424_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	3.2e-19
WP_000143458.1|855464_855644_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142980.1|855781_857728_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	99.1	0.0e+00
WP_000483498.1|858322_859381_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.0	1.7e-205
WP_000917735.1|859531_859729_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762902.1|859955_860777_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000904137.1|860773_861148_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001344904.1|861160_862210_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.0e-109
WP_001447497.1|862211_862490_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.9e-10
WP_001260976.1|862625_862883_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	88.0	6.6e-31
WP_000220602.1|862888_863188_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	96.0	1.6e-49
WP_000610381.1|863393_863747_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	65.0	5.5e-36
WP_000137950.1|863743_864115_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.9	2.7e-49
WP_162829202.1|864297_865511_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000268365.1|867357_867906_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.1	2.7e-21
>prophage 5
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	969122	1032444	5411943	terminase,head,tail,integrase,capsid,transposase,holin,tRNA	Stx2-converting_phage(35.56%)	65	977413:977427	1032546:1032560
WP_001297484.1|969122_970229_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|970264_970906_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|970909_972280_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|972447_973119_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|973118_974579_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|974654_975776_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359442.1|975921_977151_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|977400_978537_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
977413:977427	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799400.1|978520_979384_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938117.1|979747_981109_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	4.0e-50
WP_001303921.1|981169_981445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001369471.1|982419_985821_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.0e-219
WP_001301673.1|986411_988760_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|988779_988869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|988975_989245_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_000268887.1|989246_990569_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	99.1	2.4e-76
WP_001230459.1|990633_991233_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_106904965.1|991299_994779_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.6	0.0e+00
WP_122996286.1|995015_995648_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000967279.1|995593_996331_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	1.9e-147
WP_001154345.1|997378_997552_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|997659_997980_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_024222304.1|997996_998695_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.8	4.0e-131
WP_000807964.1|998694_999036_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212952.1|999028_1002271_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_001453698.1|1002322_1002532_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030043.1|1002627_1003002_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275461.1|1003007_1003724_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_000133388.1|1003790_1004135_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|1004131_1004578_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|1004574_1004925_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|1004934_1005261_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|1007624_1007846_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173088.1|1007890_1009828_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_009453642.1|1009891_1011553_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000958398.1|1011549_1012113_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_001377217.1|1012228_1012759_-	HNH endonuclease	NA	H6WZK7	Escherichia_phage	93.2	1.2e-90
WP_001303878.1|1013012_1013327_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|1013854_1014040_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|1014256_1014754_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|1014753_1014969_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000874287.1|1015408_1017259_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000935544.1|1018055_1019114_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.0	2.0e-198
WP_000917750.1|1019264_1019462_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_024222354.1|1019703_1020234_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.0	1.3e-70
WP_000140024.1|1020242_1020608_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_001369253.1|1020608_1021664_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_012817871.1|1021665_1021938_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_072058819.1|1022105_1022246_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.0	2.2e-12
WP_162829202.1|1022283_1023496_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_023981635.1|1023536_1023953_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.6e-63
WP_000095671.1|1023993_1024956_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_000693943.1|1024978_1025404_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444689.1|1025400_1025703_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.5e-05
WP_001169687.1|1025800_1026172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1026192_1026384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1026385_1026664_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001447517.1|1026959_1027349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1027389_1027608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993436.1|1027611_1027752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1028091_1028280_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1028276_1028468_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048442.1|1028560_1031026_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	8.8e-56
WP_000003742.1|1031087_1031357_+	excisionase	NA	NA	NA	NA	NA
WP_000074981.1|1031325_1032444_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	2.9e-83
1032546:1032560	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	1124298	1180315	5411943	transposase,protease	Escherichia_phage(33.33%)	52	NA	NA
WP_164717614.1|1124298_1125511_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_000256229.1|1126731_1129413_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001345400.1|1129653_1130700_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_000590537.1|1130803_1130953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001287881.1|1131374_1131566_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000124179.1|1131618_1131852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001260386.1|1131947_1132571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001167434.1|1132659_1133169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301456.1|1133626_1134085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231525.1|1135438_1136563_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000958487.1|1137292_1137490_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|1137557_1138770_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001340489.1|1138869_1139085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180465.1|1139444_1139633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001377350.1|1139729_1139903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004881.1|1139954_1140149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310149.1|1140929_1141265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477623.1|1141898_1142117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223350.1|1143569_1145660_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001053349.1|1146173_1146560_-	TerD family protein	NA	NA	NA	NA	NA
WP_000301248.1|1146983_1147559_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|1147627_1148206_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|1148254_1149295_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|1149317_1149773_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054789.1|1149795_1150953_-	TerD family protein	NA	NA	NA	NA	NA
WP_000254140.1|1150952_1151534_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001035166.1|1151855_1152914_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_001280118.1|1152923_1154066_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_032349820.1|1154058_1154832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|1154833_1155913_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|1155912_1156869_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|1156879_1158088_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|1158105_1158573_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|1158833_1159163_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957251.1|1159149_1159491_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|1160433_1162047_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|1162077_1162428_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|1162424_1162850_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_001135715.1|1166731_1166872_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|1167173_1167437_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021388.1|1168648_1169266_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142973.1|1169277_1169952_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|1169952_1170417_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|1170426_1172130_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|1172122_1172443_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|1172451_1172754_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_042352357.1|1172844_1173543_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|1173923_1174199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050925519.1|1174423_1176043_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|1176135_1176495_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_162829202.1|1177351_1178565_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000998045.1|1178776_1180315_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.7e-299
>prophage 7
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	1242360	1273382	5411943	transposase,protease,holin	Escherichia_phage(44.0%)	42	NA	NA
WP_000003671.1|1242360_1242948_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|1242944_1243652_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|1243670_1245464_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|1245460_1246579_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001443410.1|1247196_1247580_+	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_012817858.1|1248025_1248919_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_162829202.1|1249005_1250218_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303940.1|1250268_1250493_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001303878.1|1250574_1250889_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1251415_1251601_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675929.1|1251822_1251936_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	97.3	5.6e-11
WP_001003118.1|1252156_1252690_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1252849_1253122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|1253377_1253593_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_162829202.1|1254175_1255389_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_106904967.1|1255440_1257195_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000261909.1|1257962_1258676_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|1258813_1259011_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|1259297_1260116_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|1260267_1260639_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|1260628_1261000_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|1261012_1262062_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_032280206.1|1262081_1262342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|1262509_1262722_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001278454.1|1262910_1263015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|1263130_1264000_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|1264010_1264274_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000935420.1|1264525_1264738_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|1264788_1265145_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209481.1|1265122_1265584_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266135.1|1265580_1265877_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.7	7.5e-47
WP_001151153.1|1265873_1266296_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_001262389.1|1266336_1267407_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693949.1|1267478_1267904_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|1267900_1268116_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103686.1|1268165_1268882_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000379580.1|1269154_1269307_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000394557.1|1269318_1269693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|1270224_1270413_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|1270409_1270601_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048507.1|1270693_1272118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|1272169_1273382_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 8
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	1503361	1537431	5411943	head,tail,integrase,capsid,transposase,holin	Enterobacteria_phage(56.76%)	42	1511032:1511048	1542823:1542839
WP_021351651.1|1503361_1503733_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_044722167.1|1503856_1504642_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.1	6.5e-146
WP_000950982.1|1504911_1505793_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|1505898_1506168_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000268900.1|1506169_1507483_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_001230465.1|1507547_1508147_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	1.8e-108
WP_000514984.1|1508214_1511691_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
1511032:1511048	attL	CAGCCCCACAATGGCCG	NA	NA	NA	NA
WP_072147834.1|1511931_1512561_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|1512506_1513250_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_000847298.1|1513957_1514287_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082365.1|1514283_1516863_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.4	0.0e+00
WP_000533403.1|1516843_1517257_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479083.1|1517283_1517715_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_001143011.1|1517728_1518481_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.2	3.9e-132
WP_000683071.1|1518488_1518884_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|1518880_1519456_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|1519470_1519824_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|1519816_1520191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|1520242_1521271_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256792.1|1521328_1521676_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001254039.1|1521712_1523218_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000145948.1|1525144_1525435_+	hypothetical protein	NA	K7PH23	Enterobacteria_phage	100.0	2.5e-50
WP_000818841.1|1525507_1525714_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	98.5	7.9e-27
WP_000344554.1|1525731_1526094_+	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	67.9	4.4e-33
WP_000814614.1|1526065_1526476_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	98.5	2.1e-71
WP_001254255.1|1526472_1526649_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000386661.1|1526651_1527011_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	2.7e-62
WP_000950962.1|1527010_1527187_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001286917.1|1527179_1527392_+	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000002251.1|1527384_1527675_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_001008192.1|1527671_1528034_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	98.3	3.5e-62
WP_000994516.1|1528030_1528219_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|1528430_1529390_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032178163.1|1529729_1529852_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1529866_1530556_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1530740_1531484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1531569_1531728_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023272.1|1532026_1533877_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_085948261.1|1534315_1534531_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000075117.1|1534530_1534728_+	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	1.2e-19
WP_162829202.1|1534733_1535946_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000263438.1|1536354_1537431_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	1.8e-199
1542823:1542839	attR	CAGCCCCACAATGGCCG	NA	NA	NA	NA
>prophage 9
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	1756868	1836675	5411943	protease,head,tail,capsid,transposase,tRNA	Escherichia_phage(31.82%)	69	NA	NA
WP_000420935.1|1756868_1758005_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383942.1|1758273_1760511_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001224569.1|1763469_1764360_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177454.1|1764542_1765304_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201824.1|1765816_1766770_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|1766956_1768441_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|1768986_1769655_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_162829202.1|1769724_1770938_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000840226.1|1770943_1773124_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.7	0.0e+00
WP_000459457.1|1773116_1773551_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|1773532_1773955_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|1773970_1774711_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683103.1|1774718_1775114_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	1.4e-69
WP_000985132.1|1775110_1775689_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_085947772.1|1775781_1776995_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000752958.1|1777015_1777315_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.9	8.4e-46
WP_000158868.1|1777326_1777722_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063245.1|1777763_1778789_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	3.1e-188
WP_001345004.1|1778844_1779177_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_001277425.1|1779186_1779759_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.4	6.3e-90
WP_068859082.1|1780387_1781020_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001255226.1|1781022_1781538_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001345007.1|1782589_1785199_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988363.1|1785229_1785922_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|1786141_1786684_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|1787164_1788031_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1788032_1788245_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143540.1|1788352_1788874_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912342.1|1788909_1790295_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_000256002.1|1790468_1790963_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000212252.1|1790965_1791688_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_001295318.1|1791805_1792315_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000815554.1|1792311_1793379_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000855355.1|1793515_1794409_-	carbamate kinase	NA	NA	NA	NA	NA
WP_000152513.1|1794405_1795221_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000495365.1|1795231_1796491_-	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000580836.1|1796500_1798168_-	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000703909.1|1798484_1799534_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001301144.1|1799555_1800791_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_000540946.1|1800801_1801587_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001315307.1|1801715_1802861_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_001298987.1|1802882_1804184_-	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000006887.1|1804240_1805602_-	allantoinase AllB	NA	NA	NA	NA	NA
WP_000401100.1|1805661_1807116_-	putative allantoin permease	NA	NA	NA	NA	NA
WP_000765839.1|1807284_1808163_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000943558.1|1808262_1809039_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001342079.1|1809051_1810833_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
WP_000141275.1|1810922_1811738_-	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000776388.1|1811815_1812298_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000460145.1|1812527_1813454_+	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_001158001.1|1813522_1814617_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_001320180.1|1815765_1816026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106904969.1|1816006_1820218_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.8	8.9e-24
WP_000561841.1|1820646_1823061_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|1823057_1823744_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001295836.1|1823714_1824338_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_000148941.1|1824327_1825137_+	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295322.1|1825197_1826052_+	chaperedoxin	NA	NA	NA	NA	NA
WP_001345010.1|1826114_1826897_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001157532.1|1826883_1827561_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_000904502.1|1827706_1828624_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_000970323.1|1828620_1829079_+	NfeD family protein	NA	NA	NA	NA	NA
WP_001026747.1|1829079_1829487_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000982172.1|1829611_1830904_-	amino acid permease	NA	NA	NA	NA	NA
WP_000883048.1|1830906_1831839_-	glutaminase A	NA	NA	NA	NA	NA
WP_000078269.1|1832100_1834605_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
WP_001342071.1|1834718_1835060_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000365177.1|1835197_1835992_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_000186631.1|1836195_1836675_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	2021359	2068546	5411943	transposase,holin,integrase	Escherichia_phage(25.0%)	43	2043586:2043602	2065992:2066008
WP_000131044.1|2021359_2023393_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|2023521_2024109_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_023981982.1|2024122_2025595_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159100.1|2025608_2027279_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_001209113.1|2027491_2028157_+	membrane protein	NA	NA	NA	NA	NA
WP_000370308.1|2028402_2029098_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023922.1|2029090_2030518_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|2030528_2031248_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339608.1|2031774_2032629_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046293.1|2032854_2034180_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474083.1|2034288_2034516_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|2034555_2035769_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001345033.1|2035849_2036443_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001345034.1|2036602_2037472_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	1.3e-51
WP_001299013.1|2037720_2038578_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|2041229_2042442_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
2043586:2043602	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|2045374_2045476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|2045839_2046103_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|2046102_2046243_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|2046277_2046505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560496.1|2046575_2046965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236873.1|2047959_2048145_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000617443.1|2048819_2049101_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000284450.1|2049702_2050245_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001350215.1|2050237_2050597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444700.1|2051143_2051803_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000942525.1|2051781_2052852_-	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_162829202.1|2053279_2054492_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000692308.1|2055448_2055670_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_001186787.1|2055738_2056215_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214420.1|2056230_2056716_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001234405.1|2056807_2057626_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	4.7e-46
WP_000480477.1|2057715_2058654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000642924.1|2058719_2059130_-	hypothetical protein	NA	G5DES5	Salmonella_phage	41.9	2.1e-26
WP_162829202.1|2059221_2060435_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001019379.1|2060568_2061402_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_001035842.1|2061414_2061846_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	5.1e-28
WP_000083330.1|2061845_2062043_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_000251023.1|2062240_2063122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772642.1|2063264_2064479_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.5e-133
WP_000893251.1|2064834_2066088_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
2065992:2066008	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|2066099_2067203_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|2067490_2068546_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 11
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	2583870	2647729	5411943	transposase,protease,integrase,tRNA	Morganella_phage(12.5%)	60	2580475:2580504	2605966:2605995
2580475:2580504	attL	TGTAGGCCTGATAAGCGTAGCGCATCAGGC	NA	NA	NA	NA
WP_001254202.1|2583870_2584161_-|transposase	transposase	transposase	A0A1W6JP07	Morganella_phage	99.0	7.2e-42
WP_162829202.1|2584254_2585467_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001453071.1|2586860_2587034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000603950.1|2587606_2588155_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_000631719.1|2590476_2590824_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001218841.1|2592485_2593751_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|2594130_2594706_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|2594742_2596440_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|2596415_2596754_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|2596869_2598171_-	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000069437.1|2598288_2599725_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|2600061_2600538_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|2600553_2601810_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|2602085_2602379_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2602422_2604069_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|2604206_2604560_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008073.1|2604763_2605633_-	YjeJ family protein	NA	NA	NA	NA	NA
WP_000940530.1|2606022_2607051_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
2605966:2605995	attR	TGTAGGCCTGATAAGCGTAGCGCATCAGGC	NA	NA	NA	NA
WP_000257278.1|2607092_2607659_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|2607710_2607836_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|2607946_2608093_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|2608274_2608592_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|2608588_2609122_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|2609210_2610344_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|2610406_2610766_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|2610776_2611172_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|2611182_2611917_-	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_001192991.1|2611909_2613718_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|2614042_2615020_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001346081.1|2615238_2616741_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|2616792_2617107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|2617103_2617418_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236850.1|2617446_2620770_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|2620791_2621760_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|2621856_2622909_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|2623003_2623549_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|2624407_2624461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294195.1|2624443_2625583_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|2625581_2627129_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|2627100_2627562_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|2627580_2628918_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122520.1|2628927_2630775_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280349.1|2630767_2631718_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2631803_2632112_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460353.1|2632188_2633469_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2633554_2634814_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2634816_2635821_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2635902_2636100_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2636203_2637502_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|2637706_2638132_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_106904972.1|2638170_2640531_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	1.8e-66
WP_001293281.1|2640710_2641442_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|2641569_2641971_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|2641989_2642688_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012546.1|2642738_2643398_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|2643415_2643814_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|2643823_2644462_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943991.1|2644464_2645628_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_001299838.1|2645711_2647337_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|2647453_2647729_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 12
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	2762365	2807278	5411943	terminase,head,tail,capsid,holin,tRNA	Enterobacteria_phage(34.09%)	48	NA	NA
WP_000543817.1|2762365_2763403_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001217542.1|2764651_2764900_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132154.1|2765401_2765992_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001117798.1|2766174_2766825_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001345294.1|2766903_2767962_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|2768091_2768514_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023417.1|2768674_2768944_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_000279033.1|2768945_2770259_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	3.3e-78
WP_001216290.1|2770323_2770947_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000514845.1|2771015_2774492_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.1	0.0e+00
WP_126303346.1|2774727_2775360_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.5	1.2e-97
WP_000194763.1|2775305_2776049_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152209.1|2776059_2776758_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	3.1e-131
WP_000807964.1|2776757_2777099_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212952.1|2777091_2780334_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_001453698.1|2780385_2780595_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030043.1|2780690_2781065_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275461.1|2781070_2781787_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.3	2.1e-127
WP_000133388.1|2781853_2782198_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2782194_2782641_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2782637_2782988_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2782997_2783324_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2785687_2785909_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173088.1|2785953_2787891_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	98.4	0.0e+00
WP_009453642.1|2787954_2789616_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	98.7	0.0e+00
WP_000958398.1|2789612_2790176_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	7.3e-83
WP_001303878.1|2791076_2791391_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|2791918_2792104_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|2792320_2792818_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|2792817_2793033_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_106904973.1|2793472_2795323_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.8	0.0e+00
WP_001339373.1|2796140_2796293_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_001047110.1|2796602_2797355_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_000515862.1|2798867_2799419_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	9.9e-101
WP_001191679.1|2799411_2799672_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	7.8e-40
WP_001345148.1|2799769_2800462_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135680.1|2801165_2801528_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081302.1|2801593_2802418_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.0e-149
WP_000008211.1|2802545_2803082_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|2803072_2803423_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145671.1|2803419_2803893_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_171844465.1|2804177_2804456_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.4	1.2e-30
WP_001014294.1|2804508_2804700_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001094871.1|2804702_2805437_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001061339.1|2805436_2806009_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093918.1|2806045_2806327_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000654815.1|2806374_2806548_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|2806744_2807278_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 13
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	4069837	4125847	5411943	transposase,protease,integrase,tRNA	Escherichia_phage(33.33%)	49	4072926:4072941	4090967:4090982
WP_085948265.1|4069837_4070999_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
WP_001358534.1|4071486_4072632_+	type III secretion system LEE effector EspG	NA	NA	NA	NA	NA
WP_000823907.1|4072759_4073578_+	YjiK family protein	NA	NA	NA	NA	NA
4072926:4072941	attL	ATAAAGAGGATGATTT	NA	NA	NA	NA
WP_000609741.1|4075494_4076169_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953028.1|4076217_4077207_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
WP_001121747.1|4077815_4079465_-	type III secretion system effector EspL2	NA	NA	NA	NA	NA
WP_162829202.1|4081503_4082717_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001218764.1|4083160_4084420_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	8.4e-79
WP_000234516.1|4084798_4085506_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839773.1|4085903_4088039_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|4088088_4089345_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|4089546_4090626_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|4090690_4090966_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001321419.1|4090993_4092046_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
4090967:4090982	attR	AAATCATCCTCTTTAT	NA	NA	NA	NA
WP_000786911.1|4092206_4092926_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|4092925_4093252_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|4093435_4094155_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394117.1|4094330_4095377_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745216.1|4095493_4096501_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_162832353.1|4097676_4098890_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.9e-168
WP_000577033.1|4099170_4099674_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000784004.1|4099718_4100705_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000239919.1|4101016_4102153_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174743.1|4102145_4102739_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|4102746_4103037_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|4103033_4103600_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|4103617_4104322_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001055633.1|4104339_4105320_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|4105495_4105912_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|4105911_4106475_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|4106583_4107534_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222508.1|4107546_4108278_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|4108357_4109065_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|4109159_4109657_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|4109733_4111128_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|4111563_4112718_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|4113021_4113237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001338822.1|4113372_4113504_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001344776.1|4113512_4115489_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758903.1|4115634_4116366_+	membrane protein	NA	NA	NA	NA	NA
WP_000105566.1|4116501_4117422_+	agmatinase	NA	NA	NA	NA	NA
WP_001252647.1|4117680_4120479_+	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_000214203.1|4120597_4121026_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001284302.1|4121036_4121522_+	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000380263.1|4121547_4122297_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_160333632.1|4122293_4123154_+	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_023982313.1|4123157_4124303_+	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_001169551.1|4124289_4125033_+	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001297457.1|4125088_4125847_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 14
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	4361645	4368785	5411943		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|4361645_4362284_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590389.1|4362280_4363543_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|4363539_4364448_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|4364643_4365411_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141347.1|4365461_4366118_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272924.1|4366223_4368785_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 15
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	4442033	4526909	5411943	terminase,protease,tail,transposase,portal,tRNA	Enterobacteria_phage(75.0%)	88	NA	NA
WP_000214990.1|4442033_4443782_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|4443854_4444271_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_162829202.1|4445335_4446548_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001289947.1|4446900_4447500_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	100.0	1.8e-111
WP_001214463.1|4447496_4447664_-	DUF2737 family protein	NA	Q687G8	Enterobacteria_phage	100.0	3.0e-24
WP_001111331.1|4447674_4447968_-	DUF2856 family protein	NA	Q687G7	Enterobacteria_phage	100.0	8.5e-51
WP_000532424.1|4447981_4448494_-	single-stranded DNA-binding protein	NA	Q8VNQ1	Enterobacteria_phage	100.0	1.8e-75
WP_000335772.1|4448494_4449118_-	hypothetical protein	NA	Q8VNQ0	Enterobacteria_phage	99.5	6.8e-122
WP_001177653.1|4449993_4450272_+	transcriptional regulator	NA	Q8VNP9	Enterobacteria_phage	100.0	3.6e-43
WP_000166207.1|4450306_4450453_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000065668.1|4450445_4451345_+	hypothetical protein	NA	Q8VNP8	Enterobacteria_phage	100.0	1.6e-164
WP_000131492.1|4451334_4452771_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_001036037.1|4452770_4453040_+	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_001000130.1|4453109_4453388_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|4453520_4453736_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|4453746_4453983_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|4453939_4454386_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|4454382_4454910_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|4454906_4455089_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211413.1|4455363_4456068_+	phage antirepressor Ant	NA	Q8VNP5	Enterobacteria_phage	100.0	9.6e-133
WP_001108006.1|4456865_4457471_+	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	100.0	1.9e-97
WP_000144764.1|4457467_4457662_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|4457654_4458089_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|4458595_4459543_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|4459552_4459822_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_012816791.1|4460825_4461011_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|4461485_4461962_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077625.1|4461958_4464082_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102413.1|4464078_4464291_+	hypothetical protein	NA	Q687G1	Enterobacteria_phage	98.6	2.3e-29
WP_000974564.1|4464290_4465793_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|4465737_4467762_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|4467849_4468176_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281348.1|4468168_4468450_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	100.0	2.1e-46
WP_000974958.1|4468452_4469076_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_032271655.1|4469088_4469481_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	97.7	1.8e-67
WP_000235090.1|4469488_4470241_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|4470254_4470677_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|4470703_4471012_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918243.1|4471055_4473701_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|4473697_4474027_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001152113.1|4474026_4474725_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_106904977.1|4474730_4475474_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	3.8e-148
WP_122996286.1|4475419_4476052_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_106895295.1|4476288_4479765_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.6	0.0e+00
WP_001230455.1|4479832_4480432_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279058.1|4480496_4481819_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	99.1	3.7e-77
WP_001023452.1|4481820_4482090_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_001217540.1|4482457_4482706_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	100.0	2.4e-38
WP_000162574.1|4483554_4484037_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|4484168_4484645_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|4484634_4484925_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|4484986_4485328_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|4485476_4487138_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|4487223_4488102_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|4488224_4488818_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|4488872_4490159_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|4490179_4490971_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460032.1|4491137_4492499_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|4492747_4492996_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|4493014_4493563_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264774.1|4493593_4494361_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|4494402_4494750_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589821.1|4494826_4495309_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969032.1|4495324_4496551_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|4496540_4497059_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|4497208_4497574_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|4497783_4498854_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225214.1|4498864_4499986_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|4500028_4501189_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4501287_4501335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|4501438_4501780_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|4502050_4502788_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079107.1|4502922_4503903_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|4503899_4504631_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|4504760_4507334_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|4513188_4514487_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|4514483_4514807_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|4514852_4516208_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|4516321_4518982_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001341635.1|4519013_4519712_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|4519780_4520200_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4520406_4521444_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|4521491_4522181_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|4522484_4522868_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|4522923_4523511_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|4523614_4524496_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|4524705_4526040_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|4526171_4526909_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	4756595	4816342	5411943	terminase,bacteriocin,holin,tail,integrase,capsid,portal	Escherichia_phage(77.33%)	76	4756377:4756401	4815311:4815335
4756377:4756401	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|4756595_4757765_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|4757748_4757931_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|4758009_4758387_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_001291844.1|4758422_4758635_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|4758594_4759221_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000809302.1|4759217_4759649_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211992.1|4759704_4760382_-	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_001260980.1|4760706_4760964_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	8.6e-39
WP_001451755.1|4761092_4761290_+	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001302866.1|4761378_4761684_+	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451754.1|4761726_4762296_-	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_001304084.1|4762288_4762465_-	hypothetical protein	NA	A0A0N7C151	Escherichia_phage	100.0	2.5e-26
WP_000206752.1|4762558_4763182_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_000212746.1|4763185_4763473_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|4763474_4763693_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000951705.1|4763694_4763910_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_000797281.1|4763911_4764100_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_001289936.1|4764251_4765025_-	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000774248.1|4765021_4765243_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001444000.1|4765341_4765623_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548534.1|4765633_4765825_-	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_000682306.1|4765797_4765980_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000187065.1|4765976_4766657_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	99.6	6.0e-132
WP_000459724.1|4766653_4767604_-	recombinase RecT	NA	A0A2R2Z324	Escherichia_phage	100.0	1.4e-179
WP_000995346.1|4767622_4767904_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	100.0	1.7e-48
WP_000934195.1|4767924_4768206_-	hypothetical protein	NA	A0A2R2Z322	Escherichia_phage	100.0	1.3e-45
WP_000917253.1|4768217_4768430_-	hypothetical protein	NA	A0A2R2Z321	Escherichia_phage	100.0	3.4e-33
WP_000201269.1|4768500_4769148_-	Rha family transcriptional regulator	NA	A0A2R2Z320	Escherichia_phage	100.0	1.5e-119
WP_001064714.1|4770008_4770962_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|4770958_4772428_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|4772522_4773236_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|4773331_4773535_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|4773705_4773900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|4774066_4774444_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_106904980.1|4774437_4775958_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	99.8	3.2e-306
WP_001193567.1|4775947_4776919_+	toprim domain-containing protein	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402093.1|4776918_4777368_+	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	100.0	1.3e-82
WP_001187434.1|4777375_4777939_+	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000144764.1|4777935_4778130_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204844.1|4778122_4778557_+	antitermination protein	NA	A0A2R2Z331	Escherichia_phage	100.0	5.6e-83
WP_000649753.1|4779340_4780300_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|4780311_4780581_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_106904981.1|4781067_4783005_+	SASA family carbohydrate esterase	NA	A0A2R2Z342	Escherichia_phage	99.7	0.0e+00
WP_000143458.1|4783139_4783319_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290210.1|4783359_4783605_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_001072901.1|4783682_4783898_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087728.1|4783902_4784436_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|4784706_4785276_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4785275_4785422_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_015971382.1|4785649_4785835_+	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000738505.1|4785925_4786219_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|4786368_4786572_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|4786627_4787434_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|4787414_4789121_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|4789120_4791265_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|4791422_4792430_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|4792453_4793668_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|4793723_4794113_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|4794162_4794624_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|4794607_4795171_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207924.1|4795170_4795821_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_001024006.1|4797646_4797916_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|4798055_4798244_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|4798538_4800164_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|4800160_4801429_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|4801443_4801722_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|4801727_4802345_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|4802435_4803170_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|4803402_4803543_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|4803599_4804001_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|4804094_4804751_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|4804753_4805200_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|4805209_4805461_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|4805471_4806737_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331692.1|4806806_4815188_+	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	100.0	0.0e+00
WP_000368131.1|4815409_4816342_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4815311:4815335	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
>prophage 17
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	4917337	4978901	5411943	protease,integrase,lysis,transposase,holin	Enterobacteria_phage(20.0%)	47	4934587:4934622	4966467:4966502
WP_000140560.1|4917337_4918240_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.3e-68
WP_001000358.1|4918433_4919624_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209922.1|4919620_4920880_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|4920869_4922498_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|4922770_4924129_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|4924133_4925210_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|4925672_4926323_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000179250.1|4926376_4926631_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4926630_4927761_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|4927849_4930135_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001345213.1|4930830_4934565_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.6e-19
4934587:4934622	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACG	NA	NA	NA	NA
WP_000990754.1|4934692_4935415_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|4935561_4938189_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012296.1|4938337_4940026_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215757.1|4940022_4940649_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|4940643_4941714_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|4941691_4941910_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|4942015_4942360_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001254228.1|4942516_4942699_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001345214.1|4943202_4944030_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.6	1.6e-150
WP_042352449.1|4944068_4945001_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	6.1e-151
WP_001108084.1|4945542_4946109_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|4946083_4946686_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|4946682_4947348_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|4947344_4947968_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_000499454.1|4949060_4949219_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|4949299_4949698_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|4949840_4950056_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075144.1|4950055_4950553_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000092247.1|4950549_4950987_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	5.0e-71
WP_000881316.1|4951136_4951661_+	Rha family transcriptional regulator	NA	A0A0N7CEE8	Salmonella_phage	89.7	1.2e-84
WP_162829202.1|4951700_4952914_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_072145680.1|4952951_4953590_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.0	2.4e-34
WP_001025665.1|4954283_4955606_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.5	9.7e-227
WP_122993426.1|4956407_4960802_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|4960802_4962452_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|4962456_4963233_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000876014.1|4963507_4966357_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|4966556_4967207_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
4966467:4966502	attR	CGTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001249151.1|4967223_4969896_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|4970634_4971726_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|4971837_4972893_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|4972966_4974031_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|4974030_4974681_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422230.1|4974756_4976400_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758043.1|4976617_4978264_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|4978412_4978901_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 18
NZ_CP027573	Escherichia coli strain 2013C-4081 chromosome, complete genome	5411943	5198893	5369200	5411943	terminase,protease,head,tail,coat,integrase,plate,capsid,lysis,transposase,portal,holin	Enterobacteria_phage(31.71%)	218	5201164:5201223	5344460:5345769
WP_001007947.1|5198893_5200072_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|5200052_5200244_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_158709213.1|5200325_5200625_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	96.0	6.7e-51
WP_000002108.1|5200696_5200981_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	98.9	9.1e-50
5201164:5201223	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|5201205_5202419_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000951710.1|5203086_5203296_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_000797282.1|5203297_5203486_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_001261535.1|5203482_5203659_-	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	96.6	4.5e-23
WP_001033097.1|5203658_5204213_-	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	87.7	1.0e-57
WP_000109677.1|5204214_5204514_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.1e-56
WP_001214466.1|5204510_5204678_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	4.7e-22
WP_001111307.1|5204688_5204982_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	3.2e-50
WP_000951320.1|5205005_5205389_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	1.9e-66
WP_000031374.1|5205388_5205994_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	99.5	2.1e-107
WP_000050554.1|5206004_5206175_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001183771.1|5206250_5206421_-	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000167579.1|5206615_5207086_-	hypothetical protein	NA	G9L670	Escherichia_phage	99.4	8.2e-88
WP_000214161.1|5207151_5207352_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	97.0	6.0e-32
WP_000088201.1|5207480_5207753_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_016242500.1|5208098_5208794_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.1	8.3e-129
WP_000067727.1|5208869_5209085_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438527.1|5209226_5209523_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_000166207.1|5209555_5209702_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_106904985.1|5209694_5210528_+	DNA replication protein	NA	Q37929	Escherichia_phage	91.3	1.5e-156
WP_000131499.1|5210517_5211954_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	99.8	1.4e-274
WP_001036037.1|5211953_5212223_+	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_001000130.1|5212292_5212571_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|5212703_5212919_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|5212929_5213166_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|5213122_5213569_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153271.1|5213565_5214093_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	3.6e-100
WP_001254257.1|5214089_5214272_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000566872.1|5214268_5214439_+	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	1.2e-25
WP_001108084.1|5214431_5214998_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223932.1|5214972_5215575_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	96.6	9.8e-94
WP_000144614.1|5215571_5215778_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271131.1|5215755_5216427_+	serine/threonine protein phosphatase	NA	K7P7K6	Enterobacteria_phage	98.2	2.1e-129
WP_000512813.1|5216417_5216936_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.7	5.0e-94
WP_000783734.1|5217397_5217721_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229402.1|5217704_5218181_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	98.7	4.9e-88
WP_000092296.1|5218177_5218615_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_162829202.1|5219006_5220220_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000999693.1|5220884_5221265_+	hypothetical protein	NA	Q716B1	Shigella_phage	96.8	6.7e-64
WP_000807789.1|5221368_5221611_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	3.7e-36
WP_000139136.1|5221614_5221902_+	hypothetical protein	NA	I1TQD4	Pseudomonas_phage	33.3	1.6e-06
WP_000205033.1|5221911_5222091_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	93.2	2.1e-23
WP_001436504.1|5222114_5222537_+	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_000200766.1|5222533_5223949_+|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_023981516.1|5223950_5226149_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.3	0.0e+00
WP_000372576.1|5226239_5227133_+	scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	98.7	3.7e-129
WP_000013275.1|5227151_5228405_+|coat	coat protein	coat	A5VW72	Enterobacteria_phage	98.6	1.7e-233
WP_001444886.1|5228446_5228635_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	3.2e-27
WP_001140510.1|5228615_5229077_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_023982401.1|5229086_5230505_+	Packaged DNA stabilization protein gp10	NA	A0A088CQ70	Enterobacteria_phage	91.3	1.2e-254
WP_000947776.1|5230526_5231060_+	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	48.3	1.1e-35
WP_000785561.1|5231052_5231754_+	hypothetical protein	NA	A5VW68	Enterobacteria_phage	97.0	5.1e-118
WP_000627632.1|5231753_5232209_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	100.0	1.8e-87
WP_000964882.1|5232211_5232904_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000382045.1|5232913_5234320_+	phage DNA ejection protein	NA	I6RSG0	Salmonella_phage	55.2	1.2e-126
WP_001345269.1|5234319_5236158_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	74.6	4.7e-248
WP_001214103.1|5236182_5236497_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	98.1	9.8e-53
WP_162829202.1|5236600_5237813_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000821222.1|5238001_5238421_+	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.8	1.5e-72
WP_164717614.1|5238472_5239686_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	6.5e-169
WP_000090241.1|5239749_5240001_-	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	98.8	1.3e-39
WP_000677939.1|5240091_5240253_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_001084290.1|5240321_5241257_+	phage antirepressor Ant	NA	A0A2H4FRZ6	Salmonella_phage	99.0	2.2e-177
WP_000129903.1|5241435_5243373_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A140G5Z9	Enterobacteria_phage	88.9	1.9e-271
WP_001345271.1|5243413_5244322_-	acyltransferase	NA	NA	NA	NA	NA
WP_044862420.1|5246175_5246760_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	3.2e-17
WP_001310454.1|5246927_5247176_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_106904986.1|5247177_5249268_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.5	6.8e-166
WP_000129790.1|5249338_5250271_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|5250273_5250495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|5250507_5250762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032156282.1|5250779_5251046_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	3.5e-11
WP_000049431.1|5251042_5251315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049303.1|5251319_5251613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044860928.1|5251623_5252154_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	56.6	4.2e-48
WP_106904987.1|5252251_5252794_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.2e-28
WP_000564281.1|5252797_5253331_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000465562.1|5253330_5253846_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000977058.1|5253849_5254401_+	SANT/Myb domain-containing protein	NA	NA	NA	NA	NA
WP_000633434.1|5254397_5254727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904988.1|5254723_5255074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904989.1|5255089_5255422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|5255414_5255612_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|5255601_5255898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904990.1|5255894_5256404_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.8	1.7e-25
WP_000852377.1|5256473_5256899_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|5256970_5257471_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_141079094.1|5257505_5257934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122256.1|5257917_5258136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|5258145_5258373_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|5258353_5258662_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|5258658_5258949_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|5258951_5259533_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|5259532_5261197_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_044805865.1|5261196_5262786_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	4.2e-168
WP_106904991.1|5262769_5264095_+|capsid	minor capsid protein	capsid	A0A0C4UQY9	Shigella_phage	59.7	1.9e-153
WP_106904992.1|5264213_5264687_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_106904993.1|5264862_5265996_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	52.7	6.0e-92
WP_001142976.1|5265995_5266943_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	65.9	7.4e-120
WP_106904994.1|5266986_5267340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106904995.1|5267336_5267756_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	6.1e-34
WP_021499914.1|5267752_5268313_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	4.8e-42
WP_000848437.1|5268313_5268559_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606748.1|5268555_5270058_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.5	1.5e-138
WP_000015474.1|5270066_5270432_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	1.5e-25
WP_000213225.1|5270446_5270923_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_106904996.1|5271049_5273119_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	38.1	1.9e-72
WP_000146120.1|5273105_5274455_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098808.1|5274438_5275563_+	hypothetical protein	NA	C9DGQ3	Escherichia_phage	48.5	7.7e-92
WP_000980532.1|5275552_5276167_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|5276159_5276597_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|5276596_5277679_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301578.1|5277669_5278230_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469163.1|5278229_5279141_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	47.5	2.2e-36
WP_000420351.1|5279175_5279697_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|5279776_5279980_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|5280202_5280763_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_106905000.1|5280892_5282911_+	sialate O-acetylesterase	NA	H6WZJ9	Escherichia_phage	58.9	1.4e-200
WP_000221106.1|5282968_5283148_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	55.3	6.0e-07
WP_001114107.1|5283183_5283429_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_032164298.1|5284047_5284233_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000527073.1|5284201_5285254_+	DNA cytosine methyltransferase	NA	H9C177	Pectobacterium_phage	63.7	4.1e-119
WP_001105393.1|5285974_5286448_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_000450409.1|5287876_5288206_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|5288306_5288489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|5288977_5289091_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988599.1|5289103_5289298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285585.1|5289756_5290125_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692345.1|5290198_5290420_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186773.1|5290488_5290965_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860076.1|5290980_5291460_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001234505.1|5291541_5292363_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.1	1.0e-45
WP_000846711.1|5292583_5292994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|5293009_5293693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096861628.1|5293828_5294590_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_000973176.1|5296887_5297433_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|5297429_5298173_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193804.1|5298184_5299264_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986337.1|5299325_5300261_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011461.1|5300718_5301636_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011007.1|5301737_5302688_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532913.1|5305077_5305794_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|5306136_5307591_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000722538.1|5310473_5311004_+	lipoprotein	NA	NA	NA	NA	NA
WP_000429746.1|5311014_5311290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000405068.1|5311375_5312518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173829380.1|5313847_5315060_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071526359.1|5315203_5316403_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_157847362.1|5316513_5316786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157847361.1|5316763_5317147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089719.1|5317157_5317430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246637.1|5317433_5318429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000042272.1|5319131_5319383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001345280.1|5319452_5320727_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.9	1.4e-76
WP_001300307.1|5321082_5321880_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000048405.1|5322115_5324503_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	63.8	5.9e-81
WP_001090200.1|5324595_5324787_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|5324783_5324972_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|5325542_5325752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394546.1|5325752_5326391_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001345283.1|5326402_5326555_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.7e-07
WP_000362152.1|5326820_5327240_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391948.1|5327339_5327621_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|5327604_5328030_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262366.1|5328101_5329172_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.7e-64
WP_000788760.1|5329178_5329925_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	3.6e-114
WP_023981780.1|5329946_5330663_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.6	2.8e-71
WP_000603384.1|5330695_5330977_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|5330973_5331201_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000034815.1|5331193_5331505_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000683609.1|5331632_5331851_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|5331852_5332410_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|5332643_5332856_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|5332975_5333320_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|5333441_5333714_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|5333715_5334765_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|5334777_5335137_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640033.1|5335145_5335700_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	8.0e-66
WP_000917764.1|5335923_5336121_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_000301789.1|5336255_5336969_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000080194.1|5337454_5339068_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	4.4e-181
WP_000624722.1|5339098_5339449_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|5339445_5339871_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000466957.1|5339958_5340390_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000023159.1|5340868_5342806_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143458.1|5342943_5343123_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_162829202.1|5343263_5344476_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001092858.1|5344907_5345441_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_012817896.1|5345958_5346144_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	83.6	4.0e-22
5344460:5345769	attR	GATGATCTGGCAGCCTGAGTTCACAGATAAAACACTCTCCAGGAAACCCGGGGCGGTTCAATGGGAGTGTAACCGGCCATCCTTTGTTGTATCCGGTGATGCTGGGAAAATAACCATCTCAGAAAATGGAAAAGTAACACCGCCATCGCACCAGCATAGTGAGGTGCTCATTGAATTTGCCATTGATTACCTGAAGAACAATAAAAAGCAGGGGCTGATGAAGTGCATTGGTCGTTGCATGGGATATCTGCAGATAGCTGCTGAGATTGAAGCGCTGGCCAGTGGTGCGGACAAGGATGCAGTTGTGCGGGAGGCTCTTCTTCGTGAGTTTGACAACCCGCCCTTTAAAAAAGTGCCGGCTTACTGGTTTCATCCAGGACTGACTTATCTTAAAGGACGTATATAAGCTGGCTCGTTATCTGTTGCCGATAAATCCTGATAAATATCCATGAACACCAAAATCAAATACGGCCTGTCGGCTGCCGTTCTGGCGCTGATTGCCGCTGGTGCGCCTGCGCCTGACATTCTCGACCAGTTTCTGGATGAAAAGGAAGGTAACCACACCACGGCATACCGTGATGGTGCGGGTATCTGGACCATCTGCCGAGGTGCCATCATGGTGGATGGTAAGCCTGTGATTCCTGGCATGAAGCTGTCGAAGGAAAAATGCGACCAGGTTAACGCCATTGAACGTGATAAGGCGCTGGCATGGGTGGAGAAAAACATCAGAGTGCCACTGACCGAACCCCAGAAAGCGGGGATTGCGTCATTCTGTCCGTACAACATTGGCCCCGGTAAGTGTTTCCCGTCGACGTTTTACAGACGGATTAATGCTGGTGACCGCAGGGGAGCATGCGAGGCGATTCGCTGGTGGATTAAGGACGGTGGCAGAGACTGCCGTATTCGCTCAAACAACTGCTACGGTCAGGTCTCACGGCGTGACCAGGAGAGCGCGCTGGCGTGCTGGGGAATTGACAGATAAGCAGAATATTTTGCTGAAAAATGCGGTTTGCTCACACGGGCGGATAACACGAAATCCTGCGAACTGGCAAAAACTAAGTGAATAAAAGTAAAACCCCGTTTGTTGGCCGCAAGTGGGGTTTTGTGTTTCCTGACTCCGGAAAAGTCAAAGGAGAAAGTGTGTTTGATTTTAGCAAACTGATTCGGGAGATTCGAATGATGGCTGAAAAATTATCCACCTGGAAGTTCATCCTTATCTGGCTGGTGTTTGTGATTATGGCTTCCGGTTATTTCATTGGTCAGATACGCTGGTGGTGAAATGAACCGCGTACTGTGCGTGGTCATCATTG	NA	NA	NA	NA
WP_001302717.1|5346670_5346985_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444498.1|5347066_5347291_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001426432.1|5347717_5348224_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.3	7.4e-34
WP_001426431.1|5348195_5350124_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_000259002.1|5350107_5350314_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001369121.1|5350310_5351903_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_001253979.1|5351892_5353398_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256823.1|5353434_5353782_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|5353839_5354868_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|5354919_5355303_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|5355295_5355649_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|5355664_5356198_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|5356194_5356590_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235098.1|5356597_5357350_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479043.1|5357363_5357786_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|5357812_5358121_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918236.1|5358164_5360810_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|5360806_5361136_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001152113.1|5361135_5361834_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	4.7e-132
WP_001369128.1|5361839_5362583_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	3.3e-147
WP_122996286.1|5362528_5363161_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|5363407_5366884_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|5366951_5367551_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000279057.1|5367615_5368929_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023476.1|5368930_5369200_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.7e-43
>prophage 1
NZ_CP027575	Escherichia coli strain 2013C-4081 plasmid unnamed2	95952	94	95095	95952	plate,tail,integrase,terminase	Escherichia_phage(65.26%)	99	41316:41332	87433:87449
WP_000988652.1|94_469_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	100.0	1.2e-68
WP_000267997.1|475_769_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	97.9	1.6e-49
WP_000002123.1|792_1074_-	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	97.8	1.4e-47
WP_023442318.1|1073_1661_-	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	99.5	1.7e-114
WP_100008979.1|1657_2296_-	hypothetical protein	NA	A0A077SK54	Escherichia_phage	93.5	1.7e-91
WP_157847308.1|2292_2625_-	hypothetical protein	NA	V5URG6	Shigella_phage	98.2	6.5e-63
WP_100033942.1|2809_3478_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	95.2	1.7e-94
WP_032271980.1|3470_3815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024220560.1|4705_5212_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	4.1e-93
WP_032271979.1|5284_6547_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.5	1.7e-233
WP_000684846.1|6848_7550_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	5.4e-144
WP_024231213.1|7546_8224_-	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	99.6	8.4e-134
WP_032271978.1|8220_8847_-	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	99.5	1.8e-122
WP_000095381.1|9348_9504_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_000943609.1|9570_10149_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	100.0	1.5e-107
WP_000840930.1|10151_10397_-	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_000235786.1|10543_10921_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_001141910.1|10930_12148_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.3	4.6e-223
WP_000896793.1|12151_12880_+	hypothetical protein	NA	A0A077SK19	Escherichia_phage	98.3	4.3e-136
WP_015974270.1|12866_13652_+	hypothetical protein	NA	Q71T90	Escherichia_phage	100.0	9.4e-145
WP_000212023.1|13653_14670_+	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	5.9e-192
WP_000535209.1|14662_15295_+	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_001198654.1|15341_16340_-	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.1	3.7e-194
WP_001276599.1|16339_17704_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_000751806.1|18087_18915_-	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	99.6	2.8e-131
WP_100033945.1|20924_23513_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	87.8	0.0e+00
WP_023352076.1|23509_24415_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	2.0e-159
WP_001177860.1|24407_24692_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_000890203.1|25154_25943_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	89.3	9.2e-108
WP_106905002.1|25982_26405_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	99.3	1.4e-57
WP_000336812.1|26430_26571_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_106905003.1|26582_26975_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	98.5	4.9e-70
WP_000888906.1|27308_28193_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	99.7	1.4e-160
WP_001285362.1|29463_30660_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038868.1|30676_31678_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	3.7e-178
WP_000067713.1|31902_33609_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_106905004.1|33669_35259_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	99.4	2.8e-305
WP_097333139.1|35268_36084_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	1.3e-112
WP_000035251.1|36119_36701_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_106905005.1|36712_37222_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	98.8	3.3e-90
WP_015974255.1|38232_38937_-	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	100.0	4.6e-135
WP_047655136.1|39105_39951_-	hypothetical protein	NA	Q71TB9	Escherichia_phage	99.3	5.0e-152
WP_001187871.1|39980_40781_-	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_106905006.1|40945_41983_-	phage antirepressor KilAC domain-containing protein	NA	Q71TN2	Escherichia_phage	93.1	2.8e-173
41316:41332	attL	TCGGCAGCCAGGCGTAG	NA	NA	NA	NA
WP_000245710.1|41979_42201_-	host cell division inhibitor Icd-like protein	NA	Q38414	Enterobacteria_phage	100.0	5.6e-39
WP_032325264.1|42628_43267_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	90.2	3.1e-13
WP_032283228.1|43296_44079_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	33.9	3.9e-34
WP_032283230.1|44224_44791_+	hypothetical protein	NA	A0A077SK12	Escherichia_phage	97.9	1.2e-98
WP_000523978.1|44801_45413_+	hypothetical protein	NA	A0A077SLH8	Escherichia_phage	100.0	5.8e-110
WP_000926352.1|45427_46309_+	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	2.8e-174
WP_106905007.1|46390_49765_+	lytic transglycosylase domain-containing protein	NA	A0A077SK38	Escherichia_phage	85.5	0.0e+00
WP_000002800.1|49764_50121_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000047923.1|50117_51551_+	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_001189831.1|51550_52387_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.7e-152
WP_001286326.1|52465_52900_+	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_106905008.1|52911_55362_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	85.2	1.4e-250
WP_000144016.1|55361_55940_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	7.7e-96
WP_001369353.1|55983_56556_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_077625665.1|57046_57544_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	63.1	1.4e-24
WP_001312286.1|57524_57641_+	hypothetical protein	NA	Q37876	Escherichia_phage	100.0	8.0e-13
WP_000580770.1|57637_58081_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_001345482.1|58067_58670_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000434672.1|58671_60591_+	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	95.5	0.0e+00
WP_000175486.1|60587_60953_+	hypothetical protein	NA	A0A077SK35	Escherichia_phage	100.0	7.9e-46
WP_001165934.1|63940_64261_+	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.0e-41
WP_000413423.1|64464_64752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100005518.1|64998_65781_-	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	99.2	3.5e-144
WP_001376650.1|65787_66465_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
WP_106905010.1|66662_67151_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	5.5e-87
WP_106905011.1|67320_67878_+	lysozyme	NA	Q71TF3	Escherichia_phage	99.5	3.6e-106
WP_001038141.1|67870_68122_+	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	6.0e-37
WP_071802376.1|68465_68687_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	83.6	3.3e-31
WP_060552919.1|68683_69796_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SLR9	Escherichia_phage	86.0	4.7e-174
WP_060552920.1|69871_70891_-	hypothetical protein	NA	Q71TR6	Escherichia_phage	99.4	7.8e-184
WP_000774708.1|70883_72593_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_096854036.1|72668_79436_+	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.5	0.0e+00
WP_000224043.1|79469_79910_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747846.1|79906_80155_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_032271833.1|80206_81514_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	27.1	1.3e-05
WP_032324614.1|81570_82212_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	99.1	6.3e-115
WP_024222310.1|82400_82961_-	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	94.6	2.8e-95
WP_001224234.1|83206_83518_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	100.0	1.0e-46
WP_024222309.1|83568_84600_-|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	98.8	5.4e-193
WP_000481733.1|84596_84992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000542341.1|85011_85233_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	94.5	1.0e-32
WP_000874157.1|85837_86047_+	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	3.1e-31
WP_000611655.1|86157_87009_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	2.3e-157
WP_001260629.1|87041_88160_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	88.2	7.0e-178
87433:87449	attR	TCGGCAGCCAGGCGTAG	NA	NA	NA	NA
WP_000908421.1|88156_88633_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	3.4e-25
WP_000124153.1|88716_90201_-	hypothetical protein	NA	Q71T61	Escherichia_phage	99.8	2.1e-291
WP_000219603.1|90200_91394_-|terminase	terminase	terminase	A0A077SL59	Escherichia_phage	95.7	5.0e-174
WP_001448129.1|91479_91932_-	hypothetical protein	NA	Q71T63	Escherichia_phage	99.3	6.7e-79
WP_000648823.1|92020_93064_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	2.2e-205
WP_000113018.1|93091_93271_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216034.1|93275_93656_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|93655_93877_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506726.1|93949_94339_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001133672.1|94513_94849_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	98.2	6.5e-63
WP_001048304.1|94879_95095_+	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	97.2	4.2e-31
>prophage 1
NZ_CP027576	Escherichia coli strain 2013C-4081 plasmid unnamed3, complete sequence	78427	6877	63920	78427	transposase	Stx2-converting_phage(30.77%)	42	NA	NA
WP_162829202.1|6877_8091_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000628099.1|9807_10317_+	conjugal transfer entry exclusion protein TraS	NA	NA	NA	NA	NA
WP_000850424.1|10330_11062_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_001369365.1|11314_13468_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000986985.1|13467_18738_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205714.1|18757_19504_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	7.1e-09
WP_000704529.1|19562_20423_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000139321.1|20525_21086_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001282151.1|21226_21616_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
WP_106905012.1|22010_23549_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	2.5e-298
WP_001302181.1|23852_24851_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550555.1|24924_26646_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|26739_27846_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|27845_28667_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000937595.1|30479_31667_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|31666_32032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839950.1|33141_33657_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217744.1|33658_36655_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987096.1|36704_38825_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_001213544.1|38828_40268_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_106905012.1|41086_42625_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	2.5e-298
WP_001282151.1|43019_43409_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
WP_001369432.1|44142_44355_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233838.1|44599_45061_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001369435.1|45106_45316_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766809.1|45353_45941_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083826.1|46180_46438_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365571.1|46672_46747_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130993.1|46739_47597_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001344604.1|48299_48560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859016.1|48572_48812_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000937595.1|49015_50203_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|50202_50568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997720.1|50706_50961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034091.1|51467_55433_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	39.9	1.1e-230
WP_162829242.1|55752_56966_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_001172748.1|57991_58381_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445936.1|59340_59736_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000921961.1|59735_60695_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	40.6	6.0e-61
WP_077629034.1|60967_61870_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086162.1|62254_62626_+	restriction endonuclease subunit M	NA	A0A2I7RE86	Vibrio_phage	33.9	1.4e-10
WP_000937595.1|62732_63920_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
