The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	0	4559	5434442		Dickeya_phage(100.0%)	3	NA	NA
WP_044805612.1|617_2105_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_039065206.1|2132_2585_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|3215_4559_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 2
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	8641	11514	5434442	protease	Pandoravirus(50.0%)	2	NA	NA
WP_106883882.1|8641_9490_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.7	3.4e-23
WP_106883883.1|9579_11514_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 3
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	18154	19631	5434442		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|18154_19126_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|19352_19631_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 4
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	23699	37469	5434442		Bacillus_virus(14.29%)	16	NA	NA
WP_000438245.1|23699_24509_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|24718_25696_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|25709_26696_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|26716_27283_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|27279_27855_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|27823_28381_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|28387_29113_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|29160_30594_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|30616_30904_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|31021_31513_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|31558_32413_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|32409_32682_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|32895_33528_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|33524_34253_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|34249_34903_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|35132_37469_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
>prophage 5
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	48420	49911	5434442		Burkholderia_virus(100.0%)	1	NA	NA
WP_044805607.1|48420_49911_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 6
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	53616	54114	5434442	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|53616_54114_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 7
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	58080	60605	5434442	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|58080_59448_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|59537_60605_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 8
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	77098	78142	5434442		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|77098_78142_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 9
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	88184	92697	5434442		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000132907.1|88184_89684_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
WP_001341904.1|89744_90635_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275535.1|90670_91525_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|91866_92697_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 10
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	98034	98919	5434442		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|98034_98919_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 11
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	105422	109602	5434442		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_000738579.1|105422_106448_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_106883888.1|106515_107697_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_044805598.1|108843_109602_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 12
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	120104	121576	5434442	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114986.1|120104_120614_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
WP_000004477.1|120628_121576_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
>prophage 13
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	141453	147027	5434442		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|141453_142638_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|142708_144823_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|144919_145390_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|145486_145861_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|145986_146274_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|146281_146641_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|146640_147027_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 14
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	152597	162138	5434442		Tupanvirus(25.0%)	9	NA	NA
WP_044805017.1|152597_154511_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	34.0	1.9e-74
WP_000057356.1|154510_155533_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|155526_155745_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|155798_156668_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|156722_157127_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|157428_158061_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|158111_160202_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|160268_161489_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601850.1|161574_162138_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	3.5e-61
>prophage 15
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	186359	187196	5434442		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|186359_187196_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 16
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	204171	207938	5434442		Bacillus_phage(66.67%)	3	NA	NA
WP_106883890.1|204171_205794_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	6.9e-142
WP_001253696.1|205869_207222_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|207218_207938_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 17
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	214501	215380	5434442		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|214501_215380_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 18
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	221349	223743	5434442		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|221349_223743_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 19
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	228122	229349	5434442		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105463.1|228122_229349_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 20
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	238578	241026	5434442		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|238578_241026_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 21
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	261036	262847	5434442		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073591.1|261036_261780_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.9e-09
WP_000907789.1|261776_262847_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 22
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	266387	267870	5434442		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|266387_267101_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|267102_267870_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 23
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	273603	276422	5434442		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|273603_274458_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_106883894.1|274702_275761_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|275753_276422_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 24
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	279428	283560	5434442		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|279428_280055_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106580.1|280128_282327_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000130621.1|282428_282674_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|282894_283560_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 25
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	291453	296964	5434442		Bacillus_virus(50.0%)	3	NA	NA
WP_044804994.1|291453_292260_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	3.4e-17
WP_001190062.1|292265_292667_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_106883896.1|292869_296964_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	7.8e-25
>prophage 26
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	322879	323875	5434442		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|322879_323875_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 27
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	328099	328312	5434442		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|328099_328312_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 28
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	331965	334299	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_106883898.1|331965_334299_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.3	3.7e-72
>prophage 29
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	350044	352029	5434442		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196495.1|350044_351028_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
WP_000107031.1|351024_352029_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	6.6e-18
>prophage 30
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	399010	399658	5434442		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|399010_399658_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 31
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	404539	406674	5434442		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|404539_404965_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_000922639.1|404977_406267_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000008957.1|406320_406674_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 32
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	409788	411831	5434442		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|409788_411831_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 33
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	425435	428171	5434442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_044805970.1|425435_428171_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 34
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	431541	435777	5434442		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106883904.1|431541_435777_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.6e-25
>prophage 35
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	441414	445917	5434442		Erwinia_phage(50.0%)	5	NA	NA
WP_044805214.1|441414_442746_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	2.9e-45
WP_000139496.1|442812_443739_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|443831_444317_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|444401_444647_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|445071_445917_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 36
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	457489	462350	5434442		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|457489_458188_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|458184_459558_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270270.1|459663_460338_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|460486_461470_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|461729_462350_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 37
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	478173	481224	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_106910323.1|478173_481224_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	8.5e-08
>prophage 38
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	490097	492877	5434442		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|490097_490883_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|490916_491813_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|491980_492877_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 39
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	509244	511715	5434442		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|509244_510294_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001345123.1|510305_511715_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 40
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	515793	518580	5434442		uncultured_virus(100.0%)	1	NA	NA
WP_044805227.1|515793_518580_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.3e-71
>prophage 41
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	532268	532883	5434442		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|532268_532883_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 42
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	541673	544960	5434442		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|541673_542450_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|542452_542968_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|542971_543241_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|543319_544960_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 43
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	557372	559202	5434442		Catovirus(100.0%)	1	NA	NA
WP_044805249.1|557372_559202_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 44
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	566682	570541	5434442		Bacillus_phage(100.0%)	3	NA	NA
WP_000383411.1|566682_568845_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
WP_001213584.1|568928_569645_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|569644_570541_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 45
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	573577	576378	5434442		Salmonella_phage(100.0%)	2	NA	NA
WP_001300182.1|573577_575056_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
WP_000678272.1|575052_576378_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.3e-07
>prophage 46
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	592654	598798	5434442		Enterobacteria_phage(40.0%)	6	NA	NA
WP_044805240.1|592654_593785_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145196.1|593789_594464_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_044805241.1|594441_595323_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	3.9e-107
WP_044805242.1|595341_596409_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	7.8e-102
WP_000006625.1|596408_597671_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_000866672.1|597667_598798_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 47
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	602840	608252	5434442		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|602840_603170_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047503.1|603300_604566_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_001299253.1|604699_606184_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|606230_608252_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 48
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	616725	618372	5434442		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012624.1|616725_618372_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 49
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	631764	637617	5434442		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|631764_632655_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|632679_633645_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000387752.1|633649_635155_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000715936.1|635162_635582_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|635748_637617_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 50
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	640785	641778	5434442		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|640785_641778_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 51
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	653729	657091	5434442		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|653729_655100_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_106883914.1|655261_657091_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	7.3e-132
>prophage 52
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	662622	666463	5434442		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|662622_663663_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_044805038.1|663749_664709_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|664708_665599_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|665689_666463_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 53
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	677452	678790	5434442		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|677452_678790_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 54
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	688988	696357	5434442		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|688988_689246_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|689209_689569_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|689585_689726_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|689955_690036_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059106.1|690332_691736_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|691740_692841_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|692840_693914_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|693942_696357_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 55
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	701063	702212	5434442		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|701063_702212_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 56
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	706639	707593	5434442		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|706639_707053_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|707164_707593_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 57
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	718957	723107	5434442		Salmonella_phage(50.0%)	4	NA	NA
WP_000828746.1|718957_720142_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|720560_720650_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|721214_721313_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168480.1|721418_723107_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
>prophage 58
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	730529	731864	5434442		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|730529_731864_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 59
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	743980	745372	5434442		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|743980_745372_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 60
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	750493	757244	5434442		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|750493_752602_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|752620_752896_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|752950_753574_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001426185.1|753831_755514_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	4.3e-22
WP_000924289.1|755510_756128_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_044805054.1|756419_757244_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
>prophage 61
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	767324	768584	5434442	integrase	Morganella_phage(100.0%)	1	762209:762221	769204:769216
762209:762221	attL	TGCGACGATAAAG	NA	NA	NA	NA
WP_106883918.1|767324_768584_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	70.7	8.7e-177
WP_106883918.1|767324_768584_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	70.7	8.7e-177
769204:769216	attR	TGCGACGATAAAG	NA	NA	NA	NA
>prophage 62
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	771924	776487	5434442		Xanthomonas_phage(25.0%)	7	NA	NA
WP_001298007.1|771924_772380_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_000050139.1|772360_773581_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001297375.1|773752_774421_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000091955.1|774637_774874_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|774894_775062_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|775159_775969_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|776007_776487_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 63
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	788417	799158	5434442		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|788417_789350_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001307464.1|789638_790511_+	protein YibB	NA	NA	NA	NA	NA
WP_106883922.1|790785_791982_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|791991_793017_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|793267_794302_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|794288_795248_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|795251_796535_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116566.1|796544_798089_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_044805060.1|798333_798765_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|798906_799158_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 64
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	821290	822124	5434442		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_159028789.1|821290_822124_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.2	9.6e-23
>prophage 65
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	829594	831439	5434442		Tupanvirus(100.0%)	1	NA	NA
WP_044805069.1|829594_831439_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
>prophage 66
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	849554	856801	5434442		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|849554_850217_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_106878648.1|850228_852730_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|853038_854118_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|854132_854453_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_044805077.1|854503_856801_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 67
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	873832	875677	5434442		Acinetobacter_phage(100.0%)	1	NA	NA
WP_044805079.1|873832_875677_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 68
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	884181	887234	5434442		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|884181_885132_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|886049_887234_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 69
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	891350	899679	5434442		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|891350_895379_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|895455_899679_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 70
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	908894	910658	5434442		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|908894_909566_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940105.1|909608_910199_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|910385_910658_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 71
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	916026	917616	5434442		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|916026_917616_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 72
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	932987	936671	5434442		Dickeya_phage(100.0%)	1	NA	NA
WP_000096053.1|932987_936671_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 73
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	948553	949345	5434442		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|948553_949345_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 74
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	965351	966467	5434442		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|965351_966467_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 75
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	975591	976200	5434442		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|975591_976200_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 76
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	980395	1032195	5434442	terminase,tail,head,holin,tRNA,capsid,integrase	Stx2-converting_phage(36.21%)	62	993119:993133	1027873:1027887
WP_000956557.1|980395_980929_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|981346_981628_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_001061339.1|981664_982237_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_106883927.1|982236_982989_-	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	94.0	1.9e-134
WP_001014294.1|982991_983183_-	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_106883928.1|983184_983652_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_000145671.1|983798_984272_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_001242740.1|984268_984619_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|984609_985146_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_000081294.1|985273_986098_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	100.0	3.5e-150
WP_000135680.1|986163_986526_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000917896.1|987126_987423_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000859462.1|987595_988270_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|988360_988561_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_106883929.1|988604_989156_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	98.9	1.7e-100
WP_062863832.1|989152_989989_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	99.3	2.5e-151
WP_001446924.1|989993_990218_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.6	7.0e-37
WP_021568982.1|990214_991033_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.4	4.3e-124
WP_106878645.1|991029_991524_+	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	97.5	6.2e-86
WP_001359044.1|991523_992177_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.8e-126
WP_000210148.1|992173_992500_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_000767105.1|992496_992886_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_001061413.1|992905_993703_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
993119:993133	attL	AGCCAGGGGACGTAT	NA	NA	NA	NA
WP_001428967.1|993710_994700_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
WP_001047110.1|994713_995466_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001339373.1|995775_995928_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_106883930.1|996745_998596_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411802.1|999044_999251_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|999250_999748_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_159028778.1|999744_1000056_+	hypothetical protein	NA	A0A0K2FJD0	Enterobacteria_phage	81.9	3.5e-34
WP_001303878.1|1000675_1000990_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|1001072_1001297_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_106883931.1|1001338_1001704_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	1.7e-64
WP_000958416.1|1001991_1002555_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_106883932.1|1002551_1004213_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_106883933.1|1004276_1006214_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	96.9	0.0e+00
WP_001063023.1|1006258_1006480_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|1008681_1009008_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007911.1|1009017_1009368_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|1009364_1009811_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1009807_1010152_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106883934.1|1010218_1010935_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_001030047.1|1010940_1011315_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001453698.1|1011410_1011620_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106883935.1|1011671_1014914_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.2	0.0e+00
WP_000807940.1|1014906_1015248_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106883936.1|1015247_1015946_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_032316709.1|1015956_1016700_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	96.7	8.0e-146
WP_159028790.1|1016645_1017278_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.1	5.8e-105
WP_106883938.1|1017524_1020920_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.7	0.0e+00
WP_106878638.1|1020987_1021587_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.5e-110
WP_094282965.1|1021651_1022965_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_024243819.1|1022966_1023236_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	3.2e-44
WP_001118000.1|1023347_1023920_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001143816.1|1024704_1025346_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|1025506_1025755_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|1025816_1026914_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_106883939.1|1027002_1028040_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1027873:1027887	attR	AGCCAGGGGACGTAT	NA	NA	NA	NA
WP_000891404.1|1028173_1028416_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|1028581_1029565_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|1029647_1031063_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|1031115_1032195_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 77
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1036402	1040015	5434442		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|1036402_1039225_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|1039478_1040015_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 78
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1043832	1045182	5434442		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|1043832_1045182_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 79
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1050767	1052726	5434442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_044805876.1|1050767_1052726_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	4.3e-90
>prophage 80
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1062008	1064156	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|1062008_1064156_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 81
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1069401	1071387	5434442		Tetraselmis_virus(100.0%)	1	NA	NA
WP_044805870.1|1069401_1071387_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.4	1.6e-148
>prophage 82
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1075372	1076922	5434442		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611428.1|1075372_1076053_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001075526.1|1076163_1076922_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 83
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1082526	1083315	5434442		Cedratvirus(100.0%)	1	NA	NA
WP_001193388.1|1082526_1083315_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 84
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1088156	1089659	5434442		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|1088156_1089659_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 85
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1110855	1114067	5434442	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|1110855_1112373_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_106883945.1|1112609_1114067_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.2	1.2e-47
>prophage 86
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1121630	1122844	5434442	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947772.1|1121630_1122844_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
>prophage 87
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1134162	1135701	5434442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723931.1|1134162_1135701_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
>prophage 88
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1158263	1159425	5434442	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948265.1|1158263_1159425_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
>prophage 89
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1164839	1165829	5434442		Salmonella_phage(100.0%)	1	NA	NA
WP_106883951.1|1164839_1165829_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	3.2e-97
>prophage 90
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1171046	1178264	5434442	transposase,integrase	Stx2-converting_phage(50.0%)	4	1156810:1156824	1181011:1181025
1156810:1156824	attL	TATGGATGATGAGAC	NA	NA	NA	NA
WP_085948265.1|1171046_1172209_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
WP_025380681.1|1174989_1175337_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	5.9e-43
WP_001341423.1|1175333_1176008_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001218766.1|1176998_1178264_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	9.0e-81
1181011:1181025	attR	TATGGATGATGAGAC	NA	NA	NA	NA
>prophage 91
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1186598	1188591	5434442		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|1186598_1186892_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729116.1|1186935_1188591_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 92
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1193110	1193644	5434442		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|1193110_1193644_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 93
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1198564	1199542	5434442		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|1198564_1199542_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 94
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1207524	1208070	5434442		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|1207524_1208070_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 95
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1212106	1225123	5434442	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990321.1|1212106_1213444_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_106883955.1|1213453_1215286_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.7e-60
WP_001280349.1|1215278_1216229_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|1216314_1216623_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|1216699_1217980_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|1218065_1219325_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|1219327_1220332_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|1220413_1220611_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|1220714_1222013_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|1222217_1222643_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|1222681_1225123_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 96
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1229055	1230219	5434442		Ralstonia_phage(100.0%)	1	NA	NA
WP_044805835.1|1229055_1230219_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.8e-80
>prophage 97
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1243888	1245719	5434442	transposase	Helicobacter_phage(50.0%)	2	NA	NA
WP_072098057.1|1243888_1244503_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	4.7e-43
WP_000440544.1|1244510_1245719_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
>prophage 98
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1267719	1274207	5434442		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_044805825.1|1267719_1268250_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	1.2e-55
WP_000265933.1|1268559_1269516_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_106883962.1|1269655_1271158_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|1271171_1272194_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|1272180_1273176_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|1273208_1274207_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 99
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1278516	1281278	5434442		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106238.1|1278516_1278981_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000187778.1|1279139_1281278_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 100
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1284916	1291014	5434442		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181332.1|1284916_1285864_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|1286048_1286102_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|1286242_1288939_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|1289145_1289532_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1289604_1290066_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|1290078_1291014_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 101
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1299293	1304237	5434442	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_044805814.1|1299293_1302149_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001188289.1|1302148_1302631_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1302725_1304237_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
>prophage 102
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1308435	1310646	5434442	integrase	Acanthamoeba_polyphaga_mimivirus(50.0%)	2	1304538:1304552	1326657:1326671
1304538:1304552	attL	TCAAAAGCCAGCTGG	NA	NA	NA	NA
WP_001345322.1|1308435_1309455_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.1	3.5e-43
WP_001219053.1|1309935_1310646_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.7	1.3e-41
1326657:1326671	attR	TCAAAAGCCAGCTGG	NA	NA	NA	NA
>prophage 103
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1331488	1332469	5434442		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991446.1|1331488_1332469_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
>prophage 104
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1335830	1337507	5434442		Escherichia_phage(100.0%)	2	NA	NA
WP_000790592.1|1335830_1336433_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	51.8	1.5e-54
WP_000044711.1|1336910_1337507_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 105
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1347779	1349240	5434442		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208201.1|1347779_1349240_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.3e-50
>prophage 106
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1355807	1356362	5434442		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|1355807_1356362_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 107
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1363863	1364820	5434442	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181112.1|1363863_1364820_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.7e-60
>prophage 108
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1384848	1386513	5434442		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106883969.1|1384848_1386513_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 109
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1393439	1394719	5434442		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|1393439_1394177_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|1394179_1394719_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 110
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1402614	1405490	5434442		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|1402614_1404204_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|1404596_1405202_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|1405328_1405490_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 111
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1411125	1412448	5434442		Geobacillus_virus(100.0%)	1	NA	NA
WP_044805122.1|1411125_1412448_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	4.0e-79
>prophage 112
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1419179	1424534	5434442		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|1419179_1420412_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|1420718_1422386_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|1422596_1424534_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 113
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1435508	1436198	5434442		Bacillus_phage(100.0%)	1	NA	NA
WP_001188659.1|1435508_1436198_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 114
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1441699	1450768	5434442		Cyanophage(20.0%)	9	NA	NA
WP_000130185.1|1441699_1442653_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094682.1|1442767_1443355_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_044805120.1|1443389_1443956_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_044805119.1|1444104_1444818_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|1444843_1445248_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|1445624_1447541_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|1447629_1448760_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|1448863_1449073_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681360.1|1449601_1450768_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 115
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1457809	1460626	5434442	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|1457809_1460626_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 116
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1465032	1466181	5434442		Halovirus(100.0%)	1	NA	NA
WP_044805113.1|1465032_1466181_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 117
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1471651	1477312	5434442		Hepacivirus(50.0%)	4	NA	NA
WP_000351348.1|1471651_1473205_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
WP_106883973.1|1473278_1474496_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|1474624_1475767_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_044805110.1|1475797_1477312_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	4.6e-07
>prophage 118
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1485207	1487960	5434442		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|1485207_1485687_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000998542.1|1485707_1485887_+	antitoxin	NA	NA	NA	NA	NA
WP_000796358.1|1486487_1487087_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_000257163.1|1487111_1487960_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 119
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1495703	1501126	5434442		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_044805107.1|1495703_1498610_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035672.1|1498774_1501126_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	6.0e-38
>prophage 120
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1507458	1508157	5434442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|1507458_1508157_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 121
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1520859	1522584	5434442		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|1520859_1522584_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 122
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1548558	1549602	5434442		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|1548558_1549602_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 123
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1553847	1554399	5434442		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|1553847_1554399_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 124
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1563026	1564451	5434442		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_044805126.1|1563026_1564451_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	7.1e-42
>prophage 125
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1572100	1578568	5434442		Mamastrovirus(33.33%)	5	NA	NA
WP_044805099.1|1572100_1573651_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001341254.1|1573697_1576088_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|1576293_1576830_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|1576870_1577533_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|1577641_1578568_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 126
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1581829	1582732	5434442		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|1581829_1582732_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 127
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1592639	1599445	5434442	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|1592639_1594058_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|1594096_1595023_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|1595059_1595515_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|1595692_1596397_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|1596411_1596942_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001369168.1|1597015_1599445_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
>prophage 128
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1604624	1605422	5434442		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|1604624_1605422_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 129
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1611333	1611678	5434442		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1611333_1611678_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 130
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1615607	1617032	5434442	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_044805094.1|1615607_1617032_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 131
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1629626	1630385	5434442		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001341242.1|1629626_1630385_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.7	2.2e-26
>prophage 132
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1639213	1643329	5434442		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|1639213_1639810_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294774.1|1639846_1643329_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 133
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1656287	1657319	5434442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|1656287_1657319_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 134
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1663967	1671820	5434442		Indivirus(25.0%)	9	NA	NA
WP_000997040.1|1663967_1664771_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_032257666.1|1664767_1665682_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|1665922_1666723_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000155276.1|1666800_1667571_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|1667618_1668977_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|1669048_1669804_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326291.1|1669837_1670560_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|1670556_1671024_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|1671088_1671820_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
>prophage 135
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1682296	1745118	5434442	transposase,plate	Enterobacteria_phage(11.11%)	55	NA	NA
WP_106883978.1|1682296_1685134_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.7	2.9e-79
WP_000343298.1|1685142_1685904_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246424.1|1685908_1687240_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|1687242_1687767_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|1687763_1689044_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000393844.1|1690114_1691965_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|1691968_1692382_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|1692388_1693864_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1693914_1694139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037389.1|1694173_1694674_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1695370_1695889_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103319.1|1696098_1698240_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_106883979.1|1698315_1702554_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
WP_106883980.1|1702537_1703020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122985282.1|1702934_1703120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118037.1|1705790_1706558_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|1706711_1707185_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973125.1|1707227_1709672_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|1709911_1710490_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|1710695_1711463_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1711433_1712174_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|1712329_1712608_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|1712610_1712871_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543897.1|1713056_1713830_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
WP_001030484.1|1713886_1714243_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000598760.1|1714235_1714514_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_106883981.1|1714618_1716358_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_106883982.1|1716317_1717088_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226183.1|1717158_1718214_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059855.1|1718210_1718663_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001399806.1|1718881_1720048_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
WP_000602099.1|1720044_1720659_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293016.1|1720715_1722173_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1722433_1722892_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189539.1|1722983_1724228_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|1724285_1724687_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|1724725_1725781_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|1726068_1727172_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|1727183_1728437_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001444700.1|1728956_1729616_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000942525.1|1729594_1730665_-	DNA cytosine methyltransferase	NA	A0A1B1IRZ3	uncultured_Mediterranean_phage	29.6	2.6e-20
WP_000692308.1|1731948_1732170_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_001186786.1|1732238_1732715_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214420.1|1732730_1733216_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001234373.1|1733307_1734126_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	6.1e-46
WP_000480477.1|1734215_1735154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000642925.1|1735219_1735630_-	hypothetical protein	NA	G5DES5	Salmonella_phage	42.6	2.1e-26
WP_000508241.1|1735721_1735937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000189397.1|1736099_1736807_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000165865.1|1737020_1737896_-	GTPase family protein	NA	NA	NA	NA	NA
WP_001509364.1|1738963_1741615_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	25.1	5.4e-43
WP_087498070.1|1741636_1742480_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_106883983.1|1742722_1743148_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_000624718.1|1743144_1743495_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.1e-40
WP_106883984.1|1743525_1745118_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	6.1e-175
>prophage 136
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1751653	1752193	5434442		Sodalis_phage(100.0%)	1	NA	NA
WP_000065231.1|1751653_1752193_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.8	1.1e-27
>prophage 137
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1759715	1762669	5434442	transposase	Escherichia_phage(100.0%)	2	NA	NA
WP_001310555.1|1759715_1760732_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_044806060.1|1761955_1762669_+	hypothetical protein	NA	A0A291LAA9	Escherichia_phage	61.9	2.2e-68
>prophage 138
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1765670	1767869	5434442		Acinetobacter_phage(100.0%)	1	NA	NA
WP_106883989.1|1765670_1767869_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	4.3e-38
>prophage 139
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1786767	1790072	5434442		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001299025.1|1786767_1787637_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001299021.1|1787796_1788390_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|1788401_1788638_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046293.1|1788746_1790072_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 140
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1795647	1806122	5434442	holin	Catovirus(33.33%)	4	NA	NA
WP_044806064.1|1795647_1797318_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.4e-60
WP_001295527.1|1798816_1799404_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_044806065.1|1799532_1801566_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_106884275.1|1802138_1806122_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	9.3e-124
>prophage 141
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1818115	1822653	5434442		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|1818115_1819600_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|1819592_1820564_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|1820560_1821517_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_044806067.1|1821603_1822653_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
>prophage 142
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1831029	1836726	5434442		Staphylococcus_phage(50.0%)	4	NA	NA
WP_044806068.1|1831029_1832916_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076236.1|1833254_1834514_+	cytosine permease	NA	NA	NA	NA	NA
WP_044806069.1|1834503_1835787_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_000952485.1|1835826_1836726_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 143
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1840566	1844846	5434442		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_044806071.1|1840566_1843641_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
WP_000805913.1|1843763_1844846_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	1.8e-191
>prophage 144
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1850256	1852217	5434442		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|1850256_1851207_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|1851203_1852217_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 145
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1855394	1856504	5434442		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_106883993.1|1855394_1856504_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 146
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1861799	1862567	5434442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939373.1|1861799_1862567_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 147
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1869537	1870695	5434442		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106883994.1|1869537_1870695_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 148
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1878103	1879219	5434442		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|1878103_1879219_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 149
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1883508	1893480	5434442		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|1883508_1884420_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219321.1|1884544_1885453_+	fructokinase	NA	NA	NA	NA	NA
WP_001306939.1|1885595_1886780_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698929.1|1886905_1890049_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|1890045_1891248_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_044806080.1|1891437_1892127_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	37.6	2.8e-36
WP_000893609.1|1892184_1893480_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
>prophage 150
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1900432	1909413	5434442	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|1900432_1901560_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|1901582_1901915_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|1901942_1903790_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1903800_1904772_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|1904900_1905248_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|1905424_1906309_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|1906607_1907147_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1907297_1907747_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_063109308.1|1907750_1908854_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_001021161.1|1908942_1909413_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 151
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1933244	1938291	5434442	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1933244_1933868_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1933993_1935268_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1935455_1937810_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1938018_1938291_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 152
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1941419	1942115	5434442		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|1941419_1942115_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 153
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1945438	1948985	5434442		Bacillus_phage(100.0%)	2	NA	NA
WP_001235581.1|1945438_1947211_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.0e-49
WP_001256174.1|1947203_1948985_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 154
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1957820	1960970	5434442		Leptospira_phage(100.0%)	1	NA	NA
WP_001132475.1|1957820_1960970_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 155
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1967979	1976541	5434442		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1967979_1968531_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|1968659_1970591_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1970643_1970973_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1970972_1971578_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_044806092.1|1971687_1973562_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|1973742_1974387_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250125.1|1974622_1975585_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|1975581_1976541_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 156
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1984785	1987745	5434442		Escherichia_phage(50.0%)	2	NA	NA
WP_001342071.1|1984785_1985127_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_044806097.1|1985240_1987745_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
>prophage 157
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	1992284	2083841	5434442	terminase,tail,capsid,head,tRNA,protease,portal,transposase,lysis	Enterobacteria_phage(60.98%)	84	NA	NA
WP_001157532.1|1992284_1992962_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
WP_001297299.1|1992948_1993728_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|1993790_1994645_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|1994705_1995515_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|1995504_1996128_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_106883998.1|1996098_1996785_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	1.7e-33
WP_044806099.1|1996781_1999196_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000879787.1|2003816_2004308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|2005309_2006404_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|2006472_2007399_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|2007628_2008111_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|2008188_2009004_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_106883999.1|2009093_2010875_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	1.3e-37
WP_000943558.1|2010887_2011664_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000401100.1|2012810_2014265_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_044806105.1|2014324_2015686_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001298987.1|2015742_2017044_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_000540946.1|2018339_2019125_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_044806106.1|2019135_2020371_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_044806107.1|2020392_2021442_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580836.1|2021758_2023426_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_044806109.1|2023435_2024695_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_044806110.1|2024705_2025521_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_106884000.1|2025517_2026411_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815553.1|2026547_2027615_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|2027611_2028121_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_106884001.1|2028238_2028961_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|2028963_2029458_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912342.1|2029631_2031017_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|2031052_2031574_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|2031681_2031894_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|2031895_2032762_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|2033242_2033785_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|2034004_2034697_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_044806111.1|2034727_2037337_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001255226.1|2038365_2038881_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|2038883_2039516_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001038620.1|2040823_2041240_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|2041218_2041620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|2041743_2041845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044806112.1|2041841_2042297_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	9.2e-60
WP_000224914.1|2042296_2042467_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|2042459_2042750_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|2042746_2043109_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|2043105_2043246_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_044806113.1|2043331_2043715_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	6.3e-54
WP_000737278.1|2043903_2044986_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|2045574_2045790_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135274.1|2045789_2046287_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228695.1|2046503_2046686_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|2046776_2047070_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|2047429_2047624_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|2048012_2048558_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_106884003.1|2048532_2050458_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|2050454_2050661_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_095597335.1|2050657_2052259_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	97.0	1.2e-303
WP_000123322.1|2052239_2053559_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_106884004.1|2053568_2053901_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	8.4e-55
WP_000063244.1|2053956_2054982_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|2055023_2055419_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|2055430_2055805_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|2055795_2056374_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|2056370_2056766_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|2056773_2057514_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|2057529_2057952_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|2057933_2058368_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|2058360_2060922_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000847347.1|2060918_2061248_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152619.1|2061247_2061946_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194780.1|2061951_2062695_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2062631_2063264_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_106878777.1|2063324_2066738_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_001230523.1|2066808_2067408_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_106884276.1|2067472_2070415_+	hypothetical protein	NA	A0A2D1UII2	Escherichia_phage	97.4	8.6e-58
WP_106884005.1|2070414_2070999_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	1.8e-100
WP_000239881.1|2071053_2071722_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|2071778_2072084_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_106884006.1|2072267_2073752_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|2073938_2074892_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|2075404_2076166_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_044806127.1|2076348_2077239_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_106884007.1|2077239_2080212_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383941.1|2080198_2082436_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|2082704_2083841_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 158
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2092142	2094264	5434442		Hokovirus(50.0%)	2	NA	NA
WP_000253805.1|2092142_2093591_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770953.1|2093580_2094264_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 159
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2097534	2100678	5434442		Leptospira_phage(100.0%)	1	NA	NA
WP_000573943.1|2097534_2100678_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	5.7e-60
>prophage 160
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2112107	2118150	5434442		Tupanvirus(50.0%)	3	NA	NA
WP_106884009.1|2112107_2115989_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
WP_000096713.1|2116204_2117338_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_001005919.1|2117334_2118150_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 161
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2132690	2134513	5434442		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|2132690_2133320_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_044806141.1|2133292_2134513_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	30.5	6.7e-57
>prophage 162
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2137622	2139737	5434442		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|2137622_2139188_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|2139308_2139737_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 163
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2155162	2155810	5434442		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|2155162_2155372_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|2155426_2155810_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 164
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2160625	2163065	5434442		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|2160625_2161837_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231415.1|2161976_2163065_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 165
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2170074	2175269	5434442	transposase,tRNA	Staphylococcus_phage(50.0%)	3	NA	NA
WP_044806145.1|2170074_2172657_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
WP_001044880.1|2172891_2173374_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001310555.1|2174252_2175269_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 166
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2180794	2184327	5434442		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_044806151.1|2180794_2182465_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	1.8e-76
WP_001207522.1|2182548_2183484_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|2183601_2184327_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 167
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2192222	2193302	5434442		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|2192222_2193302_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 168
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2197398	2199063	5434442		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|2197398_2199063_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 169
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2203689	2207503	5434442	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|2203689_2205636_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|2205838_2207503_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 170
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2211652	2212417	5434442		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|2211652_2212417_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 171
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2219072	2231793	5434442		Bacillus_phage(25.0%)	8	NA	NA
WP_000186103.1|2219072_2219750_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_044806161.1|2219746_2222431_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_001297248.1|2222423_2222996_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087956.1|2223004_2225053_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	1.6e-26
WP_000730095.1|2225075_2226749_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_044806164.1|2226748_2226838_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_044806165.1|2227150_2227357_+	YbfA family protein	NA	NA	NA	NA	NA
WP_106884015.1|2227599_2231793_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	1.2e-23
>prophage 172
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2235875	2238817	5434442		Hokovirus(50.0%)	2	NA	NA
WP_044806171.1|2235875_2237294_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	8.9e-61
WP_001032694.1|2237335_2238817_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 173
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2242195	2242987	5434442		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114037.1|2242195_2242987_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	3.7e-08
>prophage 174
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2280734	2287970	5434442	transposase	Vibrio_phage(33.33%)	9	NA	NA
WP_000345401.1|2280734_2281454_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	3.2e-22
WP_106884016.1|2281910_2283098_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|2283097_2283463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044806244.1|2283508_2284084_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	75.8	5.5e-70
WP_106884021.1|2284284_2284671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|2284754_2284976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|2284988_2285642_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767389.1|2286145_2286622_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_071829727.1|2286680_2287970_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.0e-18
>prophage 175
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2294451	2295360	5434442		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|2294451_2295360_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 176
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2305957	2320679	5434442		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_044806184.1|2305957_2307694_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_044806185.1|2307686_2308682_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|2308684_2309356_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_106884024.1|2309584_2310949_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	4.3e-52
WP_001145128.1|2311181_2311664_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001218655.1|2311783_2313934_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_000386551.1|2313961_2314924_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443534.1|2315064_2316150_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|2316289_2316550_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|2316814_2317081_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_044806186.1|2317154_2317832_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	5.2e-19
WP_106884025.1|2317873_2320156_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|2320418_2320679_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 177
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2324219	2329451	5434442		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|2324219_2324942_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159066.1|2324938_2325598_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|2325736_2326483_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|2326886_2327390_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|2327695_2328583_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|2328817_2328883_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|2328935_2329451_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 178
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2334448	2342786	5434442		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|2334448_2336041_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_106884026.1|2336277_2337543_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|2337694_2338510_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_044806188.1|2338655_2341088_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_044806190.1|2341093_2341993_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424890.1|2342123_2342786_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
>prophage 179
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2359207	2360410	5434442		Stx2-converting_phage(100.0%)	1	NA	NA
WP_106884278.1|2359207_2360410_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	6.3e-100
>prophage 180
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2368976	2378126	5434442		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|2368976_2369234_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|2369393_2369681_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|2369664_2370387_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|2370447_2371350_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|2371437_2371914_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126055.1|2372264_2373377_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996018.1|2373471_2374605_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093858.1|2374614_2375568_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_106884028.1|2375564_2376410_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2376469_2376958_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|2376998_2378126_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 181
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2381463	2384201	5434442		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|2381463_2382192_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|2382409_2382925_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160723.1|2383050_2383374_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|2383370_2384201_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 182
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2387788	2389507	5434442		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_001645127.1|2387788_2389507_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 183
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2398804	2422523	5434442	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188180.1|2398804_2400751_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2400823_2401048_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|2401370_2401691_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_044806203.1|2401721_2403998_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	9.6e-166
WP_001040187.1|2404682_2404901_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_044806204.1|2405185_2405890_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202188.1|2405931_2407653_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001043619.1|2407653_2409420_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|2409542_2410508_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|2411051_2411546_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_106884030.1|2411680_2415709_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_024256851.1|2415863_2416475_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|2416485_2417829_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|2417919_2419212_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|2419450_2421895_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|2421905_2422523_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 184
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2428832	2432047	5434442		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|2428832_2429573_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|2429764_2432047_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 185
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2436145	2437234	5434442		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|2436145_2437234_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 186
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2442320	2446861	5434442		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|2442320_2442605_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_044806209.1|2442811_2445076_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|2445112_2446861_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 187
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2461566	2472699	5434442	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|2461566_2462115_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|2462141_2462789_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_106884032.1|2463010_2464201_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|2464385_2465474_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|2466075_2467476_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_106884033.1|2467644_2468847_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|2469112_2471725_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_106884034.1|2471931_2472699_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	2.2e-29
>prophage 188
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2488620	2490528	5434442		Tupanvirus(100.0%)	1	NA	NA
WP_044806219.1|2488620_2490528_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 189
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2495195	2656447	5434442	terminase,tail,lysis,head,holin,bacteriocin,protease,portal,capsid,integrase	Escherichia_phage(37.04%)	191	2527364:2527392	2614923:2614951
WP_000156528.1|2495195_2496956_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|2497141_2497594_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001400178.1|2497669_2498710_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|2499066_2499576_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|2499794_2500424_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|2500386_2502549_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|2502558_2503005_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_044806220.1|2503127_2505182_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|2505213_2505672_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|2505767_2506430_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|2506602_2507016_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|2507060_2507378_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_106884037.1|2507435_2508626_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048244.1|2508720_2508999_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|2508995_2509325_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|2509415_2510075_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299701.1|2510482_2511502_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
WP_000273151.1|2511479_2511722_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_044806223.1|2511789_2514261_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_001090200.1|2514353_2514545_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2514541_2514730_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000394557.1|2515262_2515637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379580.1|2515648_2515801_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_000103686.1|2516073_2516790_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	3.8e-52
WP_000471549.1|2516839_2517055_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693949.1|2517051_2517477_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_106884039.1|2517548_2518607_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.1	4.6e-62
WP_106884040.1|2518647_2519070_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	2.6e-64
WP_001266134.1|2519066_2519363_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|2519359_2519821_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|2519798_2520155_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|2520205_2520418_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|2520503_2520668_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|2520669_2520933_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|2520943_2521813_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|2521928_2522033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902696.1|2522221_2522434_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	1.2e-25
WP_001341388.1|2522601_2522880_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265133.1|2522881_2523931_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001217436.1|2523943_2524315_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000265267.1|2524826_2525645_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917737.1|2525931_2526129_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000261909.1|2526266_2526980_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2527364:2527392	attL	GCATGGTGAATCCCCCTGTGCGGAGGGGC	NA	NA	NA	NA
WP_106884041.1|2527747_2529598_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_000411814.1|2530045_2530252_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000138558.1|2530507_2530780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|2530939_2531473_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|2531693_2531807_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|2532028_2532214_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_044805775.1|2532741_2533068_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106884042.1|2533138_2533363_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_000235436.1|2533758_2534268_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_032205109.1|2534239_2536168_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.2e-262
WP_000258991.1|2536151_2536358_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001430223.1|2536354_2537947_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_106884043.1|2537936_2539442_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	9.3e-101
WP_000256818.1|2539478_2539826_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522623.1|2539883_2540912_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000201512.1|2540963_2541347_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204560.1|2541339_2541693_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000974985.1|2541708_2542242_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_000683079.1|2542238_2542634_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|2542641_2543394_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479116.1|2543407_2543839_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533403.1|2543865_2544279_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_106884044.1|2544259_2546839_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.4	0.0e+00
WP_000847304.1|2546835_2547165_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_044804844.1|2547164_2547863_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_106884045.1|2547868_2548612_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	9.2e-150
WP_123006696.1|2548557_2549190_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	95.7	4.6e-102
WP_000649829.1|2549380_2549908_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106884046.1|2550041_2553521_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.8	0.0e+00
WP_106884047.1|2553587_2554187_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	5.2e-111
WP_106884048.1|2554251_2555565_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.9e-81
WP_001023356.1|2555566_2555836_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_106884049.1|2555960_2556995_-	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001443410.1|2557440_2557824_-	hypothetical protein	NA	Q6H9S1	Enterobacteria_phage	84.3	4.4e-55
WP_106884050.1|2558441_2559560_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|2559556_2561350_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|2561368_2562076_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|2562072_2562660_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_044804867.1|2562656_2563055_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|2563051_2563909_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|2564042_2565587_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_044804868.1|2565598_2566735_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|2566747_2566840_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001300464.1|2566919_2568218_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208650.1|2568332_2570513_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|2570532_2570979_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|2570966_2572106_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742348.1|2572151_2574248_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|2574247_2574994_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|2574990_2575635_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|2575741_2576047_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|2576488_2576701_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|2576986_2577199_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|2577209_2577398_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|2577372_2577603_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|2577592_2577766_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|2577813_2578887_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_106884051.1|2578958_2581733_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	30.4	4.8e-34
WP_001264955.1|2581815_2582844_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|2582816_2583509_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_106884052.1|2584810_2587357_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|2587353_2587953_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|2588045_2588351_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|2588350_2589271_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000097602.1|2589530_2590790_+	YccE family protein	NA	NA	NA	NA	NA
WP_001044313.1|2591081_2592323_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|2592360_2592588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044804873.1|2592608_2593187_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_106884053.1|2593183_2594494_-|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	99.1	3.5e-253
WP_001208773.1|2594546_2594831_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000545734.1|2594865_2595033_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001368678.1|2595068_2595368_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_106884054.1|2595750_2596032_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	5.5e-47
WP_044806858.1|2596024_2596309_-	DUF4752 family protein	NA	G9L657	Escherichia_phage	96.8	2.9e-48
WP_106884055.1|2596308_2596647_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	85.4	3.6e-37
WP_000207903.1|2596643_2597000_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_106884056.1|2597513_2598113_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	99.5	1.2e-110
WP_001214453.1|2598109_2598277_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	100.0	1.7e-24
WP_044806723.1|2598287_2598581_-	DUF2856 family protein	NA	Q9MCT7	Escherichia_phage	97.9	1.6e-49
WP_044806722.1|2598604_2598988_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	97.6	1.2e-65
WP_044806721.1|2598987_2599593_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	1.2e-107
WP_001243355.1|2599849_2600002_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|2599986_2600118_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_021500848.1|2600142_2601111_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
WP_000167589.1|2601254_2601725_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_001450670.1|2601733_2602075_-	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.4	2.5e-30
WP_021568301.1|2602521_2603565_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	26.5	2.3e-13
WP_106884058.1|2603821_2604535_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.6	3.1e-131
WP_001560905.1|2604635_2604836_+	regulatory protein cro	NA	A4KWW0	Enterobacteria_phage	98.5	4.3e-30
WP_000438527.1|2604942_2605239_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	99.0	1.5e-47
WP_000166207.1|2605271_2605418_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_106884059.1|2605410_2606310_+	DNA replication protein	NA	Q8VNP8	Enterobacteria_phage	99.7	1.0e-163
WP_000131492.1|2606299_2607736_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	100.0	6.1e-275
WP_001036037.1|2607735_2608005_+	hypothetical protein	NA	Q687G4	Enterobacteria_phage	100.0	8.4e-45
WP_001000130.1|2608074_2608353_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2608485_2608701_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2608711_2608948_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000814576.1|2608904_2609351_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|2609347_2609875_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|2609871_2610054_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|2610328_2611063_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|2611137_2611860_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|2611859_2612465_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|2612461_2612656_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_000691354.1|2613588_2614536_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|2614545_2614815_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_106884060.1|2615314_2617252_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.2	0.0e+00
2614923:2614951	attR	GCATGGTGAATCCCCCTGTGCGGAGGGGC	NA	NA	NA	NA
WP_000143458.1|2617386_2617566_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|2617606_2617879_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|2617955_2618171_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|2618175_2618709_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|2618983_2619553_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|2619552_2619702_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|2619709_2620174_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|2620205_2620499_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001086069.1|2620907_2621714_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|2621694_2623401_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|2623400_2625545_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_096844509.1|2625702_2626710_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	99.7	5.2e-180
WP_000214474.1|2626733_2627948_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|2628003_2628393_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|2628442_2628904_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|2628887_2629451_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|2629450_2630101_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_106884061.1|2630097_2631927_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001024006.1|2631928_2632198_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|2632336_2632525_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|2632819_2634445_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|2634441_2635710_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|2635724_2636003_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_106884062.1|2636008_2636626_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	99.5	1.5e-121
WP_000835359.1|2636716_2637451_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	99.6	2.2e-135
WP_000078907.1|2637683_2637824_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|2637880_2638282_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|2638375_2639032_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|2639034_2639481_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|2639490_2639742_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|2639752_2641018_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_106884063.1|2641087_2649469_+	hypothetical protein	NA	A0A0P0ZCD0	Stx2-converting_phage	99.7	0.0e+00
WP_000756595.1|2650019_2650364_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|2650483_2650696_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|2650929_2651325_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_001024844.1|2652209_2652494_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000763353.1|2652490_2652712_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_106884064.1|2652759_2653389_-	phage antirepressor Ant	NA	A0A0N6WET9	Escherichia_phage	98.6	1.2e-110
WP_001273658.1|2654348_2654522_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|2654603_2655932_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|2655952_2656447_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 190
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2671351	2672275	5434442		Cronobacter_phage(100.0%)	1	NA	NA
WP_001307105.1|2671351_2672275_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
>prophage 191
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2682036	2687466	5434442	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_000233452.1|2682036_2684397_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_044804944.1|2685153_2686692_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
WP_000612591.1|2686741_2687089_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2687085_2687466_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 192
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2700384	2700525	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_001135715.1|2700384_2700525_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
>prophage 193
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2704405	2706822	5434442	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_000435663.1|2704405_2704831_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_106884067.1|2704827_2705178_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	8.9e-39
WP_000088522.1|2705208_2706822_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
>prophage 194
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2711342	2723688	5434442	protease	Acinetobacter_phage(42.86%)	12	NA	NA
WP_001182418.1|2711342_2712422_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|2712423_2713197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106884069.1|2713189_2714332_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	5.9e-31
WP_001035166.1|2714341_2715400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|2715722_2716304_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|2716303_2717461_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_044805736.1|2717483_2717939_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|2717961_2719002_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|2719050_2719629_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|2719697_2720273_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|2720697_2721084_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|2721597_2723688_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
>prophage 195
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2739717	2741573	5434442		Mycobacterium_phage(50.0%)	2	NA	NA
WP_001285507.1|2739717_2740950_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.1	5.0e-60
WP_106884070.1|2740934_2741573_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	3.6e-54
>prophage 196
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2754504	2754930	5434442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000422760.1|2754504_2754930_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 197
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2765539	2766801	5434442		Pseudomonas_phage(50.0%)	3	NA	NA
WP_106884075.1|2765539_2766025_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	4.0e-13
WP_001186738.1|2766040_2766517_+	RadC family protein	NA	NA	NA	NA	NA
WP_001220314.1|2766579_2766801_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
>prophage 198
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2772817	2773651	5434442		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|2772817_2773651_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 199
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2777783	2778317	5434442		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|2777783_2778317_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 200
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2787625	2788546	5434442		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|2787625_2788546_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 201
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2793208	2793454	5434442		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|2793208_2793454_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 202
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2809304	2810246	5434442		Brevibacillus_phage(100.0%)	1	NA	NA
WP_106884076.1|2809304_2810246_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	32.0	9.6e-11
>prophage 203
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2822603	2823785	5434442		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008538.1|2822603_2823338_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
WP_000103754.1|2823548_2823785_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 204
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2827057	2828700	5434442		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|2827057_2827699_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_044805755.1|2827695_2828700_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 205
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2841023	2841281	5434442		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|2841023_2841281_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 206
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2848569	2852292	5434442		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|2848569_2849271_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_024168809.1|2849270_2850515_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|2850543_2851455_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|2851470_2852292_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 207
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2855738	2942827	5434442	terminase,tail,head,holin,tRNA,protease,portal,capsid,integrase	Stx2-converting_phage(32.84%)	100	2850832:2850846	2857313:2857327
2850832:2850846	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074981.1|2855738_2856857_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
WP_000003742.1|2856825_2857095_-	excisionase	NA	NA	NA	NA	NA
WP_106878764.1|2857156_2859628_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	2.5e-58
2857313:2857327	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|2859720_2859912_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2859908_2860097_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2860497_2860662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2860665_2860884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2860955_2861255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2861607_2861886_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2861887_2862079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|2862099_2862471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106884078.1|2862568_2862871_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2862867_2863293_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095671.1|2863315_2864278_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.2	2.1e-69
WP_001151120.1|2864318_2864741_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	1.3e-63
WP_000004322.1|2864737_2864992_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002672.1|2864984_2865296_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|2865601_2866180_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|2866139_2867237_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_000882662.1|2867737_2867950_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_012817871.1|2868117_2868390_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_106884079.1|2868391_2869447_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|2869447_2869813_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640048.1|2869821_2870352_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2870593_2870791_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_106884080.1|2870941_2872000_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_106884081.1|2872796_2874647_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_000411802.1|2875094_2875301_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000731236.1|2875305_2875650_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_106878762.1|2875700_2876234_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	9.6e-101
WP_106884082.1|2876504_2877074_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	97.4	6.4e-103
WP_000539792.1|2877073_2877220_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2877447_2877633_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2878057_2878285_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_025380422.1|2878326_2878692_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000958392.1|2878980_2879544_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_106884083.1|2879540_2881202_+|terminase	terminase large subunit	terminase	H6WZK9	Escherichia_phage	99.6	0.0e+00
WP_106884084.1|2881265_2883206_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001063096.1|2883250_2883472_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000126019.1|2886148_2886475_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007911.1|2886484_2886835_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|2886831_2887278_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2887274_2887619_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106883934.1|2887685_2888402_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_001030047.1|2888407_2888782_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001453698.1|2888877_2889087_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807940.1|2892374_2892716_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106883936.1|2892715_2893414_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_001302649.1|2893430_2893751_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2893858_2894032_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_106884279.1|2894102_2895026_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.7	1.1e-176
WP_106878694.1|2895080_2895818_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	9.4e-147
WP_159028791.1|2895763_2896396_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	9.3e-103
WP_106884086.1|2896644_2900124_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.6	0.0e+00
WP_106884047.1|2900190_2900790_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	5.2e-111
WP_106884087.1|2900854_2902168_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	3.3e-78
WP_106878697.1|2902169_2902439_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.7e-43
WP_115801847.1|2902545_2902635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2902654_2905003_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2905593_2908995_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_159028781.1|2909163_2909739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301834.1|2909761_2909887_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_044806029.1|2909966_2910242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024228725.1|2910302_2911664_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	5.2e-50
WP_000799400.1|2912027_2912891_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|2912874_2914011_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|2914260_2915490_+	peptidase T	NA	NA	NA	NA	NA
WP_044806027.1|2915635_2916757_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000953272.1|2918598_2918787_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|2918844_2919588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|2919613_2919811_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|2919803_2919989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|2919988_2920180_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|2920169_2920412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770148.1|2920417_2920717_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761781.1|2920713_2922846_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000198852.1|2923216_2923468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|2923464_2923875_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001132080.1|2924282_2924507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|2924799_2925957_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504050.1|2925996_2926569_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_000171117.1|2926606_2927782_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	2.4e-184
WP_001020660.1|2927778_2928117_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|2928113_2928410_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145903.1|2928409_2928850_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000113645.1|2929139_2929496_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127893.1|2929479_2931141_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_000133425.1|2931154_2931436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|2932292_2933753_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2933752_2934424_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2934591_2935962_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|2935965_2936607_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|2936642_2937749_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2937802_2938264_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|2938273_2938927_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|2939098_2940349_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|2940451_2940775_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|2941307_2941418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|2941470_2941875_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|2942095_2942827_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 208
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2959502	2961190	5434442		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|2959502_2959922_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457626.1|2959921_2961190_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	2.3e-209
>prophage 209
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2987939	2990691	5434442		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|2987939_2989619_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|2989743_2990691_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 210
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	2993827	2997835	5434442		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|2993827_2994910_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|2994909_2995743_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|2995739_2996132_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257045.1|2996135_2996945_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|2996980_2997835_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 211
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3000936	3001167	5434442		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_044806014.1|3000936_3001167_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	38.7	2.5e-05
>prophage 212
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3012420	3022608	5434442		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|3012420_3013959_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|3013955_3014666_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|3014665_3015343_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|3016246_3017089_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|3017138_3017597_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|3017709_3018615_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|3018706_3019720_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|3019921_3020830_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287380.1|3020972_3021386_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|3021990_3022608_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 213
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3032018	3034033	5434442		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|3032018_3033032_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|3033028_3034033_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 214
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3042000	3133927	5434442	terminase,tail,head,holin,tRNA,protease,transposase,capsid,integrase	Escherichia_phage(32.65%)	99	3040989:3041003	3082013:3082027
3040989:3041003	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_000113674.1|3042000_3043131_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|3043108_3043357_-	excisionase	NA	NA	NA	NA	NA
WP_106884093.1|3043421_3045809_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|3045904_3046093_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|3046089_3046278_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_143208743.1|3046677_3046845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|3046838_3047072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3047049_3047457_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|3047479_3047698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|3047770_3048070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|3048334_3048742_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|3048818_3049046_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000020556.1|3049551_3050592_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|3050503_3051046_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450683.1|3051079_3051814_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.3	2.9e-108
WP_001505071.1|3051810_3051975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|3052673_3053432_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|3053710_3053923_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|3054143_3054401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|3054470_3054749_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265289.1|3054750_3055806_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_000140002.1|3055806_3056172_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|3056168_3056858_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001434745.1|3057477_3057906_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.5	2.6e-64
WP_106878699.1|3058383_3060321_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.1	0.0e+00
WP_000143458.1|3060456_3060636_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|3060676_3060922_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|3060999_3061215_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|3061219_3061753_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_106884094.1|3062027_3062597_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	97.9	2.2e-103
WP_000455406.1|3062596_3062746_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001208681.1|3062973_3063159_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001302717.1|3063685_3064000_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_097586089.1|3064081_3064306_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	6.6e-19
WP_000279796.1|3064347_3064713_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958416.1|3065001_3065565_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_106883932.1|3065561_3067223_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_106884096.1|3067286_3069224_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	97.1	0.0e+00
WP_001063023.1|3069268_3069490_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|3071690_3072017_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007911.1|3072026_3072377_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|3072373_3072820_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|3072816_3073161_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106883934.1|3073227_3073944_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_001030047.1|3073949_3074324_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001453698.1|3074419_3074629_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807940.1|3077916_3078258_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106883936.1|3078257_3078956_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_159028792.1|3079649_3080279_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	1.1e-100
WP_106884098.1|3080519_3083996_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.8	0.0e+00
3082013:3082027	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
WP_078194555.1|3084063_3084663_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	6.3e-109
WP_106884099.1|3084727_3086050_+|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	99.1	7.0e-76
WP_044805465.1|3086051_3086321_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_122988840.1|3086431_3086509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159028793.1|3086723_3087737_+	peptidase M85	NA	NA	NA	NA	NA
WP_000812724.1|3088469_3089126_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|3089126_3089318_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|3089422_3089659_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|3089776_3091216_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_044805467.1|3091295_3093929_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|3093897_3095181_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|3095310_3095808_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|3095904_3096603_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001315679.1|3096622_3098671_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|3098862_3099744_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127216.1|3099789_3101163_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|3101339_3102131_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|3102273_3102513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|3102671_3102815_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|3102889_3103177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|3103845_3103989_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|3104001_3104211_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|3104376_3105186_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|3105182_3105749_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|3106177_3106636_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|3106690_3107542_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|3107554_3108355_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|3108417_3109389_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_001295494.1|3111410_3113009_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|3113139_3114504_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|3114687_3115266_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|3115269_3116631_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|3116704_3116884_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|3117003_3117363_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|3117725_3118070_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|3118201_3120112_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220987.1|3120169_3120865_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044805469.1|3120904_3121486_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|3121690_3123376_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_001323996.1|3123457_3124573_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001287005.1|3124626_3125592_-	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_000067822.1|3125647_3126772_-	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_044805471.1|3128663_3129749_-	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_106884280.1|3129851_3130775_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000457202.1|3130901_3131540_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000939317.1|3131712_3132072_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000513743.1|3132075_3132264_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000604932.1|3132279_3132711_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_106884101.1|3132718_3133927_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	4.1e-208
>prophage 215
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3139878	3144455	5434442		Bacillus_phage(100.0%)	3	NA	NA
WP_106884102.1|3139878_3141369_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	31.7	2.2e-09
WP_000616411.1|3141549_3143025_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_106884103.1|3143171_3144455_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
>prophage 216
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3147773	3148628	5434442		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|3147773_3148628_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 217
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3151871	3152513	5434442		Tupanvirus(100.0%)	1	NA	NA
WP_044805475.1|3151871_3152513_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	3.8e-19
>prophage 218
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3157439	3159401	5434442		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235820.1|3157439_3159401_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 219
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3164999	3165653	5434442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882826.1|3164999_3165653_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
>prophage 220
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3173007	3173637	5434442		Klosneuvirus(100.0%)	1	NA	NA
WP_089624643.1|3173007_3173637_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	27.2	8.1e-14
>prophage 221
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3181112	3181940	5434442		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|3181112_3181940_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 222
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3188278	3190540	5434442		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|3188278_3190540_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 223
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3201204	3202221	5434442	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001310555.1|3201204_3202221_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 224
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3207248	3208238	5434442		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3207248_3208238_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 225
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3239522	3243425	5434442		Klosneuvirus(100.0%)	1	NA	NA
WP_000139567.1|3239522_3243425_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 226
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3247364	3247895	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_001307188.1|3247364_3247895_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 227
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3260114	3270288	5434442	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_064755930.1|3260114_3261323_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	4.6e-207
WP_001307190.1|3261362_3262577_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_106884108.1|3262629_3263166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001307191.1|3263238_3265200_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000494244.1|3265291_3265522_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|3265743_3265920_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|3265965_3266382_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_044805955.1|3266460_3267867_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_044805956.1|3268111_3269257_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|3269274_3270288_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 228
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3273669	3274479	5434442		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|3273669_3274479_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 229
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3278744	3280847	5434442		Salmonella_phage(100.0%)	1	NA	NA
WP_106884110.1|3278744_3280847_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.0	4.4e-133
>prophage 230
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3285754	3292139	5434442		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103195.1|3285754_3287863_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-27
WP_106884111.1|3287930_3292139_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
>prophage 231
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3298546	3300091	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|3298546_3300091_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 232
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3306976	3307267	5434442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|3306976_3307267_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 233
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3313279	3314721	5434442		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|3313279_3313564_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|3313710_3314721_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 234
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3317995	3319901	5434442		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285539.1|3317995_3318922_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193551.1|3318914_3319901_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
>prophage 235
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3324217	3328024	5434442		Klosneuvirus(50.0%)	2	NA	NA
WP_001427328.1|3324217_3326617_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|3326641_3328024_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 236
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3333303	3340239	5434442		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001345363.1|3333303_3336099_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
WP_044805975.1|3336143_3338516_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_106884114.1|3338553_3340239_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.9e-10
>prophage 237
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3356838	3358239	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_032146824.1|3356838_3358239_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	48.8	4.5e-105
>prophage 238
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3365661	3367197	5434442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194888.1|3365661_3367197_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 239
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3375078	3376497	5434442		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|3375078_3376497_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 240
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3384242	3386372	5434442		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|3384242_3384626_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|3384657_3384876_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|3384932_3386372_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
>prophage 241
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3393866	3394757	5434442		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|3393866_3394757_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 242
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3400123	3466749	5434442	terminase,tail,head,holin,portal,transposase,capsid,integrase	Escherichia_phage(43.94%)	76	3403241:3403300	3454018:3455220
WP_000214712.1|3400123_3400327_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|3400362_3401823_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|3401911_3403195_-	MHS family MFS transporter	NA	NA	NA	NA	NA
3403241:3403300	attL	CTAAGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATGGA	NA	NA	NA	NA
WP_001310555.1|3403276_3404293_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_016241229.1|3404453_3404768_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_033805042.1|3404929_3405571_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.2	1.5e-103
WP_001356599.1|3405652_3406282_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|3406354_3406930_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023455.1|3407043_3407313_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_106884119.1|3407314_3408628_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	3.1e-76
WP_001426435.1|3408692_3409292_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	7.5e-110
WP_106884120.1|3409359_3412839_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.7	0.0e+00
WP_149015260.1|3413085_3413718_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	1.0e-104
WP_053895436.1|3413663_3414407_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	99.6	1.1e-150
WP_106884122.1|3414417_3415116_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	4.7e-132
WP_106884123.1|3415115_3415445_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	1.2e-58
WP_106884124.1|3415441_3418054_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	92.0	0.0e+00
WP_000533440.1|3418034_3418448_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|3418474_3418897_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235090.1|3418910_3419663_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_033805061.1|3419670_3420066_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	1.5e-58
WP_000975020.1|3420062_3420596_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|3420610_3420964_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158897.1|3420975_3421371_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_044806118.1|3421412_3422438_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.5	7.3e-190
WP_001365129.1|3422493_3422826_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_033805059.1|3422835_3424155_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001415980.1|3424135_3425737_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000198153.1|3425733_3425940_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_106884125.1|3425936_3427862_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_033805057.1|3427836_3428382_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.3	5.6e-80
WP_012578895.1|3428883_3429069_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000992167.1|3429587_3430121_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000731236.1|3430171_3430516_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411809.1|3430520_3430727_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_052933949.1|3431172_3433023_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_044805529.1|3433594_3434026_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	98.6	6.0e-69
WP_044805527.1|3434468_3435527_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	88.5	1.2e-184
WP_000917749.1|3435677_3435875_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000640048.1|3436116_3436647_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_044805525.1|3436655_3437015_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	1.5e-36
WP_001342259.1|3438077_3438350_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|3438485_3438743_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220596.1|3438748_3439048_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	97.0	2.5e-50
WP_033804843.1|3439253_3439598_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	93.0	3.3e-54
WP_032163038.1|3440111_3441059_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	97.5	4.1e-179
WP_033804989.1|3441500_3441857_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	2.5e-57
WP_044805535.1|3441834_3442245_-	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	92.9	2.0e-69
WP_033804987.1|3442291_3442591_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	96.0	2.8e-49
WP_001141097.1|3442587_3442980_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.7e-38
WP_033804986.1|3442995_3443721_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.2	4.1e-86
WP_074156321.1|3443754_3444297_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	7.3e-80
WP_044805521.1|3444208_3445252_-	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	65.1	3.0e-82
WP_000693878.1|3445320_3445746_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001416688.1|3446362_3446701_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3446993_3447146_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3447157_3447796_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000449175.1|3448570_3448759_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3448755_3448944_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102122.1|3449036_3451499_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
WP_001368608.1|3451586_3451823_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206147.1|3451842_3453138_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
WP_072095801.1|3453157_3453268_-	transporter	NA	NA	NA	NA	NA
WP_001310555.1|3454053_3455070_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_159028782.1|3455178_3455544_-	alcohol dehydrogenase catalytic domain-containing protein	NA	E3SJ82	Synechococcus_phage	38.8	7.7e-09
3454018:3455220	attR	CTAAGGAAGGTGCGAACAAGTCCCTGATATGAGATCATGTTTGTCATCTGGAGCCATGGAACAGGGTTCATCATGAGTCATCAACTTACCTTCGCCGACAGTGAATTCAGCAGTAAGCGCCGTCAGACCAGAAAAGAGATTTTCTTGTCCCGCATGGAGCAGATTCTGCCATGGCAAAACATGGTGGAAGTCATCGAGCCGTTTTACCCCAAGGCTGGTAATGGCCGGCGACCTTATCCGCTGGAAACCATGCTACGCATTCACTGCATGCAGCATTGGTACAACCTGAGCGATGGCGCGATGGAAGATGCTCTGTACGAAATCGCCTCCATGCGTCTGTTTGCCCGGTTATCCCTGGATAGCGCCTTGCCGGACCGCACCACCATCATGAATTTCCGCCACCTGCTGGAGCAGCATCAACTGGCCCGCCAATTGTTCAAGACCATCAATCGCTGGCTGGCCGAAGCAGGCGTCATGATGACTCAAGGCACCTTGGTCGATGCCACCATCATTGAGGCACCCAGCTCGACCAAGAACAAAGAGCAGCAACGCGATCCGGAGATGCATCAGACCAAGAAAGGCAATCAGTGGCACTTTGGCATGAAGGCCCACATTGGTGTCGATGCCAAGAGTGGCCTGACCCACAGCCTAGTCACCACCGCGGCCAACGAGCATGACCTCAATCAGCTGGGTAATCTGCTGCATGGAGAGGAGCAATTTGTCTCAGCCGATGCCGGCTACCAAGGGGCGCCACAGCGCGAGGAGCTGGCCGAGGTGGATGTGGACTGGCTGATCGCCGAGCGCCCCGGCAAGGTAAGAACCTTGAAACAGCATCCACGCAAGAACAAAACGGCCATCAACATCGAATACATGAAAGCCAGCATCCGGGCCAAGGTGGAGCACCCATTTCGCATCATCAAGCGACAGTTCGGCTTCGTGAAAGCCAGATACAAGGGGTTGCTGAAAAACGATAACCAACTGGCGATGTTATTCACGCTGGCCAACCTGTTTCGGGCGGACCAAATGATACGTCAGTGGGAGAGATCTCACTAAAAACTGGGGATAACGCCTTAAATGGCGAAGAAACGGTCTAAATAGGCTGATTCAAGGCATTTACGGGAGAAAAAATCGGCTCAAACATGAAGAAATGAAATGACTGAGTCAGCCGAGAAGAATTTCCCCGCTTATTCGCACCTTCCCTAA	NA	NA	NA	NA
WP_001295394.1|3455555_3456770_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|3456975_3457302_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|3457436_3457778_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|3457812_3458373_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|3458375_3459086_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|3459193_3459499_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_044805519.1|3459697_3462124_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	7.7e-214
WP_106884282.1|3462184_3464608_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.4	1.8e-207
WP_000213028.1|3464618_3465236_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|3465237_3466092_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|3466134_3466749_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 243
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3484510	3485812	5434442		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|3484510_3485812_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 244
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3495707	3497519	5434442		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945880.1|3495707_3497519_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 245
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3517392	3518667	5434442	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3517392_3518667_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 246
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3525577	3527076	5434442		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|3525577_3526099_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_044805500.1|3526179_3527076_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 247
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3535878	3544676	5434442		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101183.1|3535878_3536706_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|3536833_3537415_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|3537560_3538730_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|3538895_3538985_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|3539283_3540309_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|3540305_3541238_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|3541350_3542562_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|3542846_3543995_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|3544034_3544676_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 248
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3550180	3552447	5434442		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|3550180_3550993_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069997.1|3550996_3551782_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|3551778_3552447_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 249
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3560737	3565821	5434442		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|3560737_3561958_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_044805496.1|3561954_3563226_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948855.1|3563200_3563947_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001297388.1|3563956_3565444_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|3565452_3565821_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 250
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3584398	3613206	5434442	transposase,tRNA	Bacillus_phage(13.33%)	27	NA	NA
WP_140430949.1|3584398_3586099_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.1e-32
WP_044805490.1|3586155_3588534_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	7.2e-172
WP_000368046.1|3588866_3589700_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082226.1|3589856_3590903_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|3591034_3591226_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_106884132.1|3591229_3592666_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001209780.1|3593687_3594152_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029479.1|3594229_3594979_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|3594978_3595530_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|3595592_3596573_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|3596673_3596973_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_106884133.1|3596977_3599365_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|3599379_3600363_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|3600646_3600691_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3600813_3601170_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3601222_3601420_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|3601516_3602059_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|3602062_3603991_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_106884134.1|3604514_3604697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310555.1|3604805_3605822_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_044805927.1|3605936_3607070_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.8e-117
WP_001295593.1|3607210_3607645_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000081418.1|3607820_3608756_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123745.1|3608884_3610258_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|3610287_3610461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|3610735_3611719_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|3611973_3613206_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 251
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3619532	3620048	5434442		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945026.1|3619532_3620048_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
>prophage 252
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3638228	3639311	5434442		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|3638228_3639311_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 253
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3653314	3654580	5434442		Klosneuvirus(100.0%)	1	NA	NA
WP_000069226.1|3653314_3654580_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
>prophage 254
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3667495	3722257	5434442	transposase,tail,protease	Enterobacteria_phage(31.58%)	54	NA	NA
WP_000573407.1|3667495_3668302_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000968850.1|3668369_3668723_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3669090_3669879_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000437858.1|3670023_3671151_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|3671218_3673153_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001310555.1|3673266_3674283_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000221855.1|3674429_3674534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859947.1|3674587_3676573_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001288368.1|3676720_3676894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088625.1|3676982_3677732_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|3678000_3678219_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001295580.1|3678344_3678671_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176278.1|3678670_3679408_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|3679599_3680769_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876286.1|3680775_3681084_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256538.1|3681232_3681997_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|3682166_3682757_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099519.1|3682820_3685496_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|3685659_3685755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297116.1|3685868_3686036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295577.1|3686038_3686167_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|3686497_3687472_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001297122.1|3687681_3690279_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|3690658_3690910_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|3690945_3691995_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|3692214_3692973_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|3692969_3693560_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3693599_3694472_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|3694572_3695193_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|3695189_3696071_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3696208_3696253_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|3696344_3697907_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_044805910.1|3697906_3699502_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_106884284.1|3699505_3700864_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	3.3e-36
WP_000209520.1|3700875_3702069_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|3702068_3702875_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3703255_3703435_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3703520_3704021_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|3704066_3704573_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000147167.1|3705074_3705293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|3708055_3708646_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3708829_3709477_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3709613_3709760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044804821.1|3710187_3710466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|3711633_3712203_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3712268_3713180_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3713286_3713409_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106884136.1|3713584_3713740_+	hypothetical protein	NA	K7PHK0	Enterobacteria_phage	87.8	1.4e-15
WP_106884137.1|3714048_3715362_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	4.6e-80
WP_001228290.1|3715513_3716113_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_106884138.1|3716180_3719654_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_159028792.1|3719894_3720524_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.2	1.1e-100
WP_101972849.1|3721217_3721916_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.7	8.1e-132
WP_000807954.1|3721915_3722257_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
>prophage 255
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3725544	3766069	5434442	terminase,tail,head,holin,capsid,integrase	Escherichia_phage(39.13%)	54	3734896:3734910	3772811:3772825
WP_001453698.1|3725544_3725754_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030047.1|3725849_3726224_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_106883934.1|3726229_3726946_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_000133388.1|3727012_3727357_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3727353_3727800_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_106884139.1|3727796_3728147_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	99.1	4.6e-59
WP_106884140.1|3728156_3728483_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	2.0e-53
WP_001063023.1|3730846_3731068_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_106884141.1|3731112_3733050_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	98.9	0.0e+00
WP_106884142.1|3733113_3734775_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.6	0.0e+00
WP_000958416.1|3734771_3735335_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
3734896:3734910	attL	TGGTGCGTGAACTGC	NA	NA	NA	NA
WP_001302977.1|3736020_3736206_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3736335_3736476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3736832_3737057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3737121_3737328_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3737555_3737702_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_106884143.1|3737701_3738271_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.0e-104
WP_106884144.1|3738541_3739075_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	6.9e-99
WP_000731241.1|3739125_3739470_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3739474_3739690_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_106884145.1|3739839_3741693_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000301785.1|3743051_3743765_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001369585.1|3743899_3744097_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.0e-27
WP_000211416.1|3744339_3744921_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	97.6	8.7e-63
WP_000640148.1|3745194_3745749_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.6	7.5e-72
WP_000228019.1|3745745_3746036_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	5.7e-47
WP_000940348.1|3746035_3746635_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.0	1.6e-104
WP_000967408.1|3747120_3747333_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|3747521_3747626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001014289.1|3749165_3749357_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	1.6e-26
WP_044805253.1|3749358_3749826_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_044805254.1|3749972_3750446_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.2	6.8e-66
WP_044805255.1|3750442_3750865_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	1.1e-64
WP_044805256.1|3750880_3751642_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.8	1.7e-111
WP_044805258.1|3751664_3752411_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	9.0e-113
WP_044805259.1|3752417_3753200_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	66.0	7.1e-44
WP_044805260.1|3753277_3753700_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	4.5e-69
WP_001033914.1|3753696_3753939_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|3754035_3754455_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|3754761_3754914_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000560219.1|3755334_3755556_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.5e-36
WP_000358365.1|3755555_3755726_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.9	2.0e-15
WP_044805262.1|3755800_3756076_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	4.4e-41
WP_096317506.1|3756176_3759326_+	exonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	74.2	0.0e+00
WP_010989194.1|3760453_3760648_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	4.5e-32
WP_024177035.1|3760640_3760829_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.7	3.9e-17
WP_005127484.1|3760935_3761217_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	9.8e-12
WP_001189085.1|3761182_3762259_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_000976492.1|3762651_3762993_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|3763005_3763878_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|3763881_3764256_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3764394_3764625_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|3764726_3765383_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|3765406_3766069_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
3772811:3772825	attR	GCAGTTCACGCACCA	NA	NA	NA	NA
>prophage 256
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3774125	3775601	5434442		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|3774125_3775601_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 257
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3788401	3791096	5434442		Bacillus_virus(50.0%)	3	NA	NA
WP_000202996.1|3788401_3789157_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|3789153_3789939_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|3790085_3791096_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
>prophage 258
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3794123	3794645	5434442		Bacillus_virus(100.0%)	1	NA	NA
WP_001295503.1|3794123_3794645_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 259
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3798663	3895521	5434442	terminase,tail,head,holin,tRNA,plate,transposase,portal,capsid,integrase	Enterobacteria_phage(64.71%)	106	3840069:3840128	3875719:3875842
WP_000639271.1|3798663_3799482_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
WP_000252979.1|3799534_3799930_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|3799970_3800714_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|3800710_3801682_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001185741.1|3805787_3806534_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|3806547_3807114_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|3807329_3809063_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|3809239_3809728_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|3809847_3810240_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066997.1|3810239_3812318_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000091308.1|3812857_3813223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937595.1|3813222_3814410_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000983609.1|3815488_3816133_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3816143_3816533_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|3816547_3817597_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|3817599_3818460_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|3818478_3820083_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|3820128_3821790_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|3821934_3822438_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_077787581.1|3822458_3824423_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3824427_3825354_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|3825350_3826238_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3826364_3826943_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|3826945_3827296_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_044805276.1|3828075_3828504_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3828510_3829935_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|3829909_3830710_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|3830876_3831863_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_106884149.1|3831877_3833392_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	9.6e-13
WP_000548675.1|3833461_3834451_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3835247_3835751_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|3835829_3836081_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3836195_3836282_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|3836544_3836868_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|3837038_3837536_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3837573_3837813_-	YecH family protein	NA	NA	NA	NA	NA
WP_044805279.1|3838003_3839215_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|3839276_3839942_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
3840069:3840128	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_024245123.1|3840298_3841300_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	3.2e-105
WP_106884150.1|3841305_3841653_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290355.1|3841682_3842333_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|3842348_3842753_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|3842842_3842980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3843051_3843255_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3843276_3843627_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159466.1|3843637_3843916_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	6.2e-35
WP_106884151.1|3843927_3844170_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	4.9e-36
WP_000021668.1|3844183_3844297_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985146.1|3844383_3844587_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	85.1	1.1e-25
WP_000153684.1|3844583_3844829_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000599413.1|3844970_3845336_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.1e-60
WP_044805281.1|3845342_3848165_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.6	0.0e+00
WP_000686557.1|3848241_3849201_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	8.4e-180
WP_106884152.1|3849205_3849520_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	2.7e-18
WP_000201254.1|3849539_3849971_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	43.3	4.7e-21
WP_000224220.1|3849972_3850236_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_095597302.1|3850747_3851788_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.1	6.9e-204
WP_000613804.1|3851787_3853539_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262681.1|3853693_3854530_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	3.0e-149
WP_001055082.1|3854553_3855606_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.0	1.9e-188
WP_106884153.1|3855651_3856452_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	86.1	1.5e-121
WP_000063074.1|3856555_3857050_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_000864893.1|3857049_3857250_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	3.0e-31
WP_000104351.1|3857252_3857576_+|holin	phage holin, lambda family	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	3.6e-50
WP_000072319.1|3857572_3857965_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	3.2e-69
WP_000780566.1|3857961_3858369_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
WP_106884154.1|3858507_3860418_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	81.0	2.1e-291
WP_095597304.1|3860410_3860878_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	3.0e-82
WP_000356335.1|3860870_3861506_+|tail	phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_001271912.1|3861502_3862084_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.0e-100
WP_000213447.1|3862080_3862431_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_106884155.1|3862434_3863331_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.5e-154
WP_000071727.1|3863323_3863932_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.4	7.6e-86
WP_137531705.1|3863928_3865716_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.2	2.0e-94
WP_000885636.1|3865942_3866521_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	90.1	2.7e-96
WP_000954200.1|3866564_3867137_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_044805293.1|3867293_3867782_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.4e-84
WP_000333503.1|3870587_3870743_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|3870751_3871126_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000005386.1|3871692_3872877_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	1.8e-224
WP_000132825.1|3873034_3874144_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	9.0e-194
WP_000488112.1|3874186_3874447_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3874638_3874779_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001303543.1|3874967_3875249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160187.1|3876241_3876790_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
3875719:3875842	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
WP_001283424.1|3876846_3878679_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000611335.1|3878675_3879332_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_000590347.1|3879627_3879804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000106474.1|3879790_3880015_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001154271.1|3880081_3880804_-	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_001272994.1|3881033_3881786_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001158220.1|3881782_3882451_-	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001128215.1|3882465_3883452_-	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001295643.1|3883556_3884357_-	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001344677.1|3884444_3884996_-	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001087467.1|3885041_3885761_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_000079816.1|3885925_3887404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146093.1|3887658_3889071_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287769.1|3889085_3889496_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_001015023.1|3889495_3889861_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_001245704.1|3889938_3891426_+	alpha-amylase	NA	NA	NA	NA	NA
WP_001344676.1|3891459_3891873_-	lipoprotein	NA	NA	NA	NA	NA
WP_000118907.1|3892059_3893265_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790498.1|3893261_3893495_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_044805302.1|3893601_3894273_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_106884156.1|3894312_3895521_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	4.1e-208
>prophage 260
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3912746	3925218	5434442		Bacillus_phage(28.57%)	12	NA	NA
WP_077787583.1|3912746_3914441_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|3914611_3914794_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|3914872_3915790_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001210913.1|3915962_3916883_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|3916871_3917342_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_044805307.1|3917322_3918741_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.4	1.0e-101
WP_000365565.1|3918807_3919503_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_077787584.1|3919542_3919908_-	permease	NA	NA	NA	NA	NA
WP_106884158.1|3920474_3921638_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	4.2e-109
WP_000218209.1|3922229_3923081_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_044805311.1|3923188_3924547_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	5.1e-05
WP_001362894.1|3924546_3925218_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
>prophage 261
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3928757	3929288	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|3928757_3929288_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 262
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3955022	3960163	5434442	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_106884161.1|3955022_3956174_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	4.0e-43
WP_001310555.1|3959146_3960163_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 263
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3978554	3980724	5434442		Yersinia_phage(33.33%)	4	NA	NA
WP_044805320.1|3978554_3979373_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	3.0e-45
WP_044805322.1|3979463_3979949_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	3.1e-13
WP_159028785.1|3979963_3980440_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000692323.1|3980502_3980724_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 264
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3985067	3986234	5434442		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001320295.1|3985067_3986234_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	5.5e-226
>prophage 265
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	3993878	3994778	5434442		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|3993878_3994778_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 266
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4002131	4019746	5434442		Enterobacteria_phage(27.27%)	16	NA	NA
WP_097508393.1|4002131_4003298_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	2.5e-109
WP_032223505.1|4003545_4004952_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	8.0e-38
WP_032223506.1|4005070_4006090_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.6	4.6e-83
WP_032208178.1|4006103_4006913_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_157848876.1|4006909_4007953_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_032223509.1|4007967_4008912_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_047091193.1|4008898_4009699_-	glycosyltransferase	NA	A0A2P1ELT8	Moumouvirus	26.9	3.4e-09
WP_032223511.1|4009691_4011014_-	O107/O117 family O-antigen polymerase wzy_O107/O117	NA	NA	NA	NA	NA
WP_032223512.1|4011006_4012224_-	O107/O117 family O-antigen flippase	NA	NA	NA	NA	NA
WP_032208168.1|4012223_4012766_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.5	4.6e-50
WP_032223514.1|4012770_4013649_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	5.1e-107
WP_032223515.1|4013706_4014606_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	9.7e-29
WP_106884167.1|4014605_4015691_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_000183060.1|4016062_4016956_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|4017198_4018194_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_032223520.1|4018351_4019746_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	8.3e-19
>prophage 267
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4025458	4032252	5434442		Bacillus_phage(25.0%)	6	NA	NA
WP_001358507.1|4025458_4026829_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.0	1.4e-31
WP_000079285.1|4027021_4028458_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699701.1|4028460_4029684_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479827.1|4029680_4030160_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043615.1|4030162_4031128_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	3.8e-87
WP_000048190.1|4031130_4032252_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 268
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4036495	4047443	5434442		uncultured_marine_virus(16.67%)	10	NA	NA
WP_000654516.1|4036495_4037335_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.3e-06
WP_106884168.1|4037512_4039675_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_001602873.1|4039677_4040121_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_044805338.1|4040126_4041266_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_044805339.1|4041924_4043508_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_044805340.1|4043582_4043921_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_044805342.1|4043910_4044201_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	37.2	3.6e-09
WP_044805343.1|4044253_4046107_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|4046128_4046710_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|4046801_4047443_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 269
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4052107	4053460	5434442		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469759.1|4052107_4053460_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
>prophage 270
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4058026	4109235	5434442	terminase,tail,lysis,head,holin,portal,transposase,protease,capsid,integrase	Enterobacteria_phage(38.33%)	67	4068359:4068374	4118112:4118127
WP_024233391.1|4058026_4059409_+	type III secretion system effector NleA	NA	Q6H9S2	Enterobacteria_phage	92.2	1.1e-220
WP_001310555.1|4060244_4061261_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001023380.1|4062145_4062415_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_106884170.1|4062416_4063730_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	1.5e-78
WP_001228241.1|4063794_4064394_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_106884171.1|4064461_4067941_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_000090891.1|4068001_4068634_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
4068359:4068374	attL	AATCTGGAATACGCCA	NA	NA	NA	NA
WP_106878745.1|4068570_4069314_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.0e-146
WP_106884172.1|4069319_4070018_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	4.4e-130
WP_000847413.1|4070017_4070347_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_096961651.1|4070343_4072905_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.7	0.0e+00
WP_000533431.1|4072885_4073299_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|4073325_4073757_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_106884173.1|4073770_4074523_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.4	9.0e-129
WP_000683071.1|4074530_4074926_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|4074922_4075498_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|4075512_4075866_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|4075858_4076233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|4076284_4077313_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|4077370_4077718_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_106884043.1|4077754_4079260_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	9.3e-101
WP_001430223.1|4079249_4080842_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|4080838_4081045_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000235436.1|4082927_4083437_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_106884174.1|4083832_4084027_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	9.7e-27
WP_000881326.1|4084214_4084832_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092318.1|4084981_4085419_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|4085415_4085913_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|4085912_4086119_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000023271.1|4086566_4088417_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000499454.1|4088715_4088874_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|4088959_4089703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|4089887_4090577_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|4090591_4090714_-	YlcG family protein	NA	NA	NA	NA	NA
WP_106884175.1|4091053_4092013_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|4092224_4092890_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001591711.1|4092886_4093498_-	recombination protein NinG	NA	Q716C3	Shigella_phage	98.0	9.6e-97
WP_033804992.1|4093490_4093661_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	1.8e-24
WP_001254218.1|4093657_4093840_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736913.1|4093836_4094277_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145926.1|4094350_4094641_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788871.1|4094637_4095339_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000442609.1|4096267_4096564_-	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000067727.1|4096704_4096920_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096002361.1|4096993_4097689_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.6	3.3e-133
WP_001062368.1|4097728_4098286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968517.1|4098282_4099035_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|4099311_4099494_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088203.1|4099471_4099744_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_001066173.1|4099760_4100342_-	superinfection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
WP_106884177.1|4100509_4102102_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	6.7e-182
WP_106884178.1|4102478_4102904_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	100.0	6.8e-49
WP_000213978.1|4103073_4103274_+	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	95.5	2.5e-30
WP_106884179.1|4103456_4103825_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	1.7e-64
WP_001198860.1|4103897_4104062_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372924.1|4104030_4104174_+	host cell division inhibitory peptide Kil	NA	A0A0N7C011	Escherichia_phage	100.0	1.2e-18
WP_000995439.1|4104249_4104546_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|4104551_4105337_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_024243933.1|4105333_4106011_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.3e-130
WP_000682316.1|4106007_4106190_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|4106162_4106354_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_106878750.1|4106364_4106646_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	1.6e-46
WP_024238365.1|4106744_4106966_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	2.1e-33
WP_024238366.1|4106965_4107250_+	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	91.5	2.6e-44
WP_001281774.1|4107517_4107862_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|4107968_4108187_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|4108164_4109235_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
4118112:4118127	attR	AATCTGGAATACGCCA	NA	NA	NA	NA
>prophage 271
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4118945	4125518	5434442		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891685.1|4118945_4120004_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
WP_000604034.1|4120006_4120696_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000113001.1|4120695_4121469_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|4121634_4121784_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|4121912_4122701_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000096869.1|4122768_4124241_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001265438.1|4124501_4125518_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
>prophage 272
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4129873	4130926	5434442		Klebsiella_phage(100.0%)	1	NA	NA
WP_001109199.1|4129873_4130926_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
>prophage 273
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4143816	4150689	5434442	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675146.1|4143816_4145220_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137873.1|4145216_4145939_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|4146128_4146461_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|4146669_4146966_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|4146967_4147264_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|4147366_4148728_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|4149057_4149375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|4149789_4150689_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 274
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4159908	4163465	5434442		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|4159908_4160913_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|4160909_4161875_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|4161848_4162595_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|4162646_4163465_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
>prophage 275
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4174113	4176147	5434442	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|4174113_4176147_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 276
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4189843	4198151	5434442		Enterobacteria_phage(83.33%)	9	NA	NA
WP_106884185.1|4189843_4191844_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_004982296.1|4191968_4192430_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.1e-75
WP_000950404.1|4192469_4192940_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_044805392.1|4192986_4193706_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4193702_4195388_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4195609_4196341_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|4196400_4196508_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4196488_4197220_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|4197224_4198151_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 277
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4218484	4220005	5434442		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_044805399.1|4218484_4220005_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	3.4e-10
>prophage 278
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4223699	4227485	5434442		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|4223699_4224368_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425428.1|4224625_4225462_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|4225493_4227485_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 279
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4231554	4232412	5434442		Catovirus(100.0%)	1	NA	NA
WP_044805404.1|4231554_4232412_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 280
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4246907	4251208	5434442		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_044805407.1|4246907_4248374_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	1.7e-43
WP_044805409.1|4248491_4249478_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_044805410.1|4249516_4250230_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|4250641_4251208_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 281
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4256962	4264610	5434442		Vibrio_phage(50.0%)	7	NA	NA
WP_000194876.1|4256962_4258552_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|4258555_4258900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213360.1|4259232_4260423_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|4260450_4261146_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|4261294_4263055_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|4263179_4263464_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|4263602_4264610_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 282
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4276215	4276833	5434442		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|4276215_4276833_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 283
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4285601	4291367	5434442		Bacillus_phage(25.0%)	5	NA	NA
WP_000422230.1|4285601_4287245_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_044805418.1|4287320_4287971_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_106884188.1|4287970_4289035_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|4289108_4290164_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|4290275_4291367_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
>prophage 284
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4295530	4298380	5434442		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|4295530_4298380_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 285
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4308080	4322136	5434442		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281242.1|4308080_4310708_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|4310854_4311577_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001427555.1|4311704_4315439_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_001075177.1|4316134_4318420_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_044805424.1|4318508_4319639_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	4.3e-175
WP_000135040.1|4319638_4319893_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|4319946_4320597_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|4321059_4322136_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 286
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4328029	4328932	5434442	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|4328029_4328932_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 287
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4332084	4337088	5434442		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|4332084_4332687_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_106884288.1|4332994_4334134_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	6.5e-30
WP_000461661.1|4334137_4335106_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_106884192.1|4335105_4337088_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
>prophage 288
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4373416	4376644	5434442		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|4373416_4374016_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|4374074_4375907_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|4375993_4376644_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 289
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4387203	4389064	5434442		Sodalis_phage(50.0%)	2	NA	NA
WP_000156114.1|4387203_4388094_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	4.0e-67
WP_001293612.1|4388290_4389064_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 290
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4393275	4394793	5434442		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4393275_4394793_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 291
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4399378	4496603	5434442	terminase,tail,lysis,head,holin,tRNA,transposase,protease,capsid,integrase	Stx2-converting_phage(40.0%)	110	4430982:4430999	4491964:4491981
WP_001283576.1|4399378_4400191_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|4400190_4401204_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|4401269_4402406_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|4402504_4403500_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|4403496_4404675_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|4404958_4406179_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|4406337_4408344_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|4408464_4408743_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089232.1|4408776_4409325_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_044805439.1|4409324_4410134_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043815.1|4410133_4410958_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|4410961_4412047_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|4412081_4413014_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4413179_4413731_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_044805443.1|4413803_4414655_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000844750.1|4414656_4415196_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714139.1|4415192_4415681_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|4415677_4416187_-	fimbrial protein	NA	NA	NA	NA	NA
WP_106884198.1|4416202_4416955_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112824.1|4416974_4419620_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|4419701_4420265_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4420948_4421434_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_044805445.1|4421636_4423781_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_044805446.1|4423780_4425091_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|4425270_4425555_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|4425926_4427267_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_106884199.1|4427632_4428691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|4428872_4429628_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|4429921_4430854_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
4430982:4430999	attL	TTCGATTCCTGCAGGGGA	NA	NA	NA	NA
WP_044805449.1|4431165_4432323_+|integrase	prophage integrase IntS	integrase	K7P7E1	Enterobacteria_phage	99.0	9.1e-221
WP_001121225.1|4433001_4433652_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|4433876_4434752_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_106878697.1|4434892_4435162_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.7e-43
WP_000279020.1|4435163_4436477_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	1.5e-78
WP_106884200.1|4436541_4437141_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	1.3e-109
WP_106884201.1|4437207_4440687_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	97.7	0.0e+00
WP_072148837.1|4440935_4441568_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.2	2.5e-103
WP_106878694.1|4441513_4442251_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	9.4e-147
WP_106884279.1|4442305_4443229_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.7	1.1e-176
WP_001154345.1|4443299_4443473_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|4443580_4443901_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_106883936.1|4443917_4444616_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000807940.1|4444615_4444957_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001453698.1|4448244_4448454_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030047.1|4448549_4448924_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_106883934.1|4448929_4449646_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.1	8.9e-126
WP_000133388.1|4449712_4450057_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|4450053_4450500_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|4450496_4450847_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000126019.1|4450856_4451183_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|4453383_4453605_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_001502569.1|4453649_4455587_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.1	0.0e+00
WP_106884202.1|4455650_4457312_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_000958416.1|4457308_4457872_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_085947772.1|4458481_4459694_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000095741.1|4459820_4460021_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_001283921.1|4460313_4460571_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|4460567_4461065_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_106878689.1|4461267_4461705_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	95.9	1.2e-69
WP_001135289.1|4461701_4462199_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000411802.1|4462198_4462405_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_106884203.1|4462697_4464548_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_000512807.1|4465616_4466105_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|4466095_4466767_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001591711.1|4466763_4467375_-	recombination protein NinG	NA	Q716C3	Shigella_phage	98.0	9.6e-97
WP_000567000.1|4467367_4467538_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|4467534_4467717_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_106884204.1|4467713_4468241_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	99.4	2.1e-100
WP_001303571.1|4468237_4468684_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000103679.1|4468887_4469103_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|4469236_4469515_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145935.1|4469584_4469875_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_106884205.1|4469871_4470573_-	Replication protein P	NA	Q9EYB6	Enterobacteria_phage	99.6	6.4e-129
WP_000185456.1|4470569_4471508_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438541.1|4471540_4471837_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000064148.1|4471975_4472209_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000428098.1|4472322_4473027_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000885926.1|4473087_4473429_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_001207140.1|4473499_4473934_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_001278657.1|4473930_4474551_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_000198444.1|4475057_4475441_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|4475499_4475970_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000776961.1|4476113_4476425_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_001198861.1|4476497_4476662_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|4476630_4476774_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|4476848_4477145_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001373974.1|4477150_4477936_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_000186759.1|4477932_4478613_+	YqaJ viral recombinase family protein	NA	H6WZG6	Escherichia_phage	98.7	1.8e-131
WP_000682299.1|4478609_4478792_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	98.3	3.7e-28
WP_000548531.1|4478764_4478956_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|4478966_4479248_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763383.1|4479346_4479568_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_069720661.1|4479564_4480335_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.8	4.7e-141
WP_044805131.1|4480336_4481074_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	51.0	4.2e-54
WP_001277767.1|4481170_4481350_+	Eag protein	NA	K7PL40	Enterobacteria_phage	100.0	2.5e-29
WP_106884207.1|4481640_4482927_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.5	6.4e-66
WP_096264167.1|4482919_4483660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106884208.1|4483816_4484008_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
WP_096835757.1|4484056_4484248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096835758.1|4484520_4484907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140430937.1|4485428_4486025_+	replication protein	NA	NA	NA	NA	NA
WP_001310555.1|4487567_4488584_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_044805183.1|4489085_4489778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077787575.1|4489835_4490018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044805132.1|4490091_4490328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102873.1|4491203_4491830_+	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	29.3	3.5e-09
WP_001163428.1|4491991_4492192_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
4491964:4491981	attR	TTCGATTCCTGCAGGGGA	NA	NA	NA	NA
WP_001197016.1|4492720_4493968_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_044805134.1|4494039_4494954_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|4495169_4496603_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 292
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4503254	4510831	5434442		Hokovirus(50.0%)	4	NA	NA
WP_001443604.1|4503254_4506848_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_044805138.1|4506903_4508049_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|4508122_4509067_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|4509136_4510831_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 293
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4514522	4515464	5434442		Morganella_phage(100.0%)	1	NA	NA
WP_044805140.1|4514522_4515464_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.5	3.1e-70
>prophage 294
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4519282	4520017	5434442		Clostridioides_phage(100.0%)	1	NA	NA
WP_106884211.1|4519282_4520017_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.0	1.0e-12
>prophage 295
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4545711	4561081	5434442		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|4545711_4547727_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|4547797_4548784_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|4549013_4549775_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|4549959_4550931_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|4551314_4551572_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|4551616_4553344_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|4553384_4553894_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|4553935_4554787_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|4554891_4555260_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|4555262_4556174_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|4556307_4557405_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852685.1|4557394_4558270_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|4558269_4559103_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|4559102_4560119_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517439.1|4560289_4561081_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
>prophage 296
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4564559	4569497	5434442		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|4564559_4565864_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|4565921_4566821_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_106884213.1|4566916_4567492_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001325675.1|4567552_4568002_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|4567988_4568414_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|4568627_4569497_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 297
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4588051	4589002	5434442		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4588051_4589002_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 298
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4607048	4607762	5434442		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4607048_4607762_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 299
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4629012	4633014	5434442		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|4629012_4630302_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|4630387_4631014_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001341612.1|4631338_4632376_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|4632375_4633014_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 300
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4639437	4686547	5434442	terminase,holin,tail,integrase	Escherichia_phage(62.96%)	57	4641088:4641104	4681901:4681917
WP_001344399.1|4639437_4639611_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669403.1|4639924_4640440_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755172.1|4640455_4640995_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
4641088:4641104	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001397318.1|4641214_4641697_-	DUF2514 domain-containing protein	NA	G9L6E9	Escherichia_phage	100.0	1.0e-77
WP_000403814.1|4641693_4642323_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	100.0	6.6e-117
WP_000256098.1|4642312_4642621_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	100.0	1.3e-49
WP_001272512.1|4642607_4643012_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	100.0	1.7e-65
WP_024237019.1|4643366_4645442_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	85.5	1.8e-102
WP_001546908.1|4645637_4645895_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	3.7e-42
WP_047089533.1|4646207_4646894_+	anti-repressor protein	NA	G9L6E2	Escherichia_phage	81.8	5.9e-103
WP_001609225.1|4647015_4647342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|4647909_4648071_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_000200604.1|4648144_4649083_-	hypothetical protein	NA	G9L6D8	Escherichia_phage	92.7	4.0e-166
WP_001167931.1|4649155_4649323_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	100.0	2.3e-24
WP_000085730.1|4649443_4649875_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	100.0	1.6e-58
WP_000849598.1|4649965_4650529_+	hypothetical protein	NA	G9L6D5	Escherichia_phage	97.9	1.8e-97
WP_106884219.1|4650540_4653555_-	hypothetical protein	NA	G9L6D4	Escherichia_phage	99.3	0.0e+00
WP_001145643.1|4653554_4656272_-	hypothetical protein	NA	G9L6D3	Escherichia_phage	99.1	0.0e+00
WP_000332877.1|4656271_4656847_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
WP_000568023.1|4656846_4657311_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_106884220.1|4657310_4659782_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.9	0.0e+00
WP_000179260.1|4659781_4660387_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
WP_000424489.1|4660386_4660710_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	99.1	9.1e-54
WP_106884221.1|4660760_4661096_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	3.8e-55
WP_106884222.1|4661106_4661544_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	99.3	4.8e-74
WP_106884223.1|4661595_4662582_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	4.3e-187
WP_001048086.1|4662596_4663292_-	peptidase	NA	G9L6C4	Escherichia_phage	97.8	3.7e-92
WP_000133158.1|4663294_4663591_-	hypothetical protein	NA	A0A0F6R8M9	Escherichia_coli_O157_typing_phage	100.0	2.0e-47
WP_000852414.1|4663587_4665267_-|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_000335899.1|4665281_4665488_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_024246651.1|4666190_4666376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106884224.1|4666466_4667942_-|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	1.4e-295
WP_001090126.1|4667938_4668613_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	98.2	4.2e-117
WP_001124396.1|4668609_4668822_-	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_016245495.1|4668838_4669177_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	98.2	2.4e-57
WP_021524753.1|4669169_4669451_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	2.0e-49
WP_106884225.1|4669443_4669788_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	84.1	7.0e-36
WP_000137941.1|4669784_4670156_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|4670191_4670404_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_106884226.1|4670503_4670977_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	1.1e-66
WP_106884227.1|4670973_4671639_-	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	65.5	2.9e-62
WP_001231265.1|4671700_4672045_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	100.0	9.7e-62
WP_001406039.1|4672162_4672948_-	hypothetical protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	100.0	9.3e-153
WP_045892869.1|4672944_4673760_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.3	5.0e-117
WP_001282459.1|4674126_4674357_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_047089548.1|4674511_4675096_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.0	1.0e-103
WP_074417041.1|4675407_4676442_+	hypothetical protein	NA	A0A2H4JIB1	uncultured_Caudovirales_phage	69.6	2.5e-36
WP_106884228.1|4676449_4676749_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	96.0	1.1e-45
WP_000063821.1|4677563_4678445_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	6.8e-160
WP_000675390.1|4678494_4678743_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001341620.1|4678900_4679152_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_023152120.1|4679144_4679795_+	MT-A70 protein	NA	G9L699	Escherichia_phage	98.1	1.2e-126
WP_001055436.1|4679791_4680451_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	3.3e-103
WP_000954565.1|4680453_4681710_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	99.3	1.7e-236
WP_000138282.1|4681902_4683480_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
4681901:4681917	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|4683548_4685015_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937895.1|4685176_4686547_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
>prophage 301
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4695376	4695808	5434442		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_044805161.1|4695376_4695808_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 302
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4705692	4712149	5434442		Mycoplasma_phage(20.0%)	8	NA	NA
WP_044805163.1|4705692_4706976_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|4707153_4707354_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|4707365_4707701_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_044805164.1|4707702_4709553_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.4	1.6e-102
WP_000384411.1|4709569_4710085_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|4710180_4710504_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|4710520_4710907_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|4710934_4712149_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 303
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4727441	4728953	5434442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493455.1|4727441_4728953_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	9.6e-13
>prophage 304
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4734711	4746019	5434442		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|4734711_4735965_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|4736292_4737483_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|4737527_4737866_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|4737926_4739261_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_106884231.1|4739250_4739964_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|4740128_4741556_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970119.1|4742131_4746019_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	9.1e-132
>prophage 305
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4750137	4750398	5434442		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|4750137_4750398_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 306
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4753856	4757599	5434442		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|4753856_4754537_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|4754809_4755784_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|4755799_4757599_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 307
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4763370	4769630	5434442	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|4763370_4764705_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|4764914_4765796_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|4765898_4766486_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4766541_4766925_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|4767229_4767919_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|4767966_4769004_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4769210_4769630_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 308
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4774923	4776222	5434442		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4774923_4776222_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 309
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4782074	4784648	5434442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4782074_4784648_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 310
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4790554	4791625	5434442		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168054.1|4790554_4791625_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
>prophage 311
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4805370	4811823	5434442	integrase	Escherichia_phage(80.0%)	5	4803158:4803171	4810274:4810287
4803158:4803171	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_044804850.1|4805370_4805853_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	1.2e-28
WP_044805718.1|4806595_4807825_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.8	5.8e-234
WP_000448925.1|4807863_4808280_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_106884235.1|4808351_4810103_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.5	0.0e+00
WP_044805717.1|4810104_4811823_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	95.8	2.7e-306
4810274:4810287	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
>prophage 312
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4817079	4821204	5434442		Klosneuvirus(50.0%)	4	NA	NA
WP_001087606.1|4817079_4818360_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_106884236.1|4818670_4820071_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|4820091_4820754_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|4820754_4821204_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 313
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4825139	4830432	5434442		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|4825139_4825385_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001565743.1|4825381_4825789_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.7	4.5e-18
WP_000246508.1|4825761_4827906_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
WP_044805708.1|4827915_4828875_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.2	2.9e-132
WP_000985494.1|4829229_4830432_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 314
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4843250	4848810	5434442	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|4843250_4843436_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|4843670_4846301_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140519.1|4846428_4846929_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_044805706.1|4847171_4848233_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	8.9e-114
WP_000132231.1|4848312_4848810_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 315
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4854276	4855242	5434442		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|4854276_4855242_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 316
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4862815	4863829	5434442		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001341827.1|4862815_4863829_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	3.9e-26
>prophage 317
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4883296	4890436	5434442		Escherichia_phage(83.33%)	6	NA	NA
WP_106884237.1|4883296_4885858_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141347.1|4885963_4886620_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|4886670_4887438_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4887633_4888542_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_106884238.1|4888538_4889801_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_001278994.1|4889797_4890436_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 318
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4895649	4899317	5434442		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|4895649_4896642_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272581.1|4896704_4897796_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|4897935_4898562_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|4898555_4899317_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 319
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4902428	4904461	5434442		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|4902428_4903034_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_106884240.1|4903033_4904461_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 320
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4928313	4929099	5434442		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|4928313_4929099_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 321
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4932917	4937837	5434442		Vibrio_phage(33.33%)	5	NA	NA
WP_001199970.1|4932917_4933589_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|4933727_4933868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268451.1|4933881_4934754_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|4934813_4936112_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|4936199_4937837_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 322
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4941869	4945984	5434442		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_044805689.1|4941869_4943171_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	3.9e-39
WP_000186450.1|4943227_4945984_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 323
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4953518	4954367	5434442		Vibrio_phage(100.0%)	1	NA	NA
WP_000100393.1|4953518_4954367_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 324
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4959225	4959981	5434442		Bacillus_phage(100.0%)	1	NA	NA
WP_014640592.1|4959225_4959981_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	6.5e-10
>prophage 325
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4971507	4974013	5434442	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_106884242.1|4971507_4972713_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	4.3e-72
WP_000184265.1|4972712_4973156_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|4973206_4974013_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
>prophage 326
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4978560	4992384	5434442		Vibrio_phage(20.0%)	7	NA	NA
WP_000810575.1|4978560_4980141_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_106884243.1|4980172_4980997_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|4981256_4982510_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|4982741_4984073_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775978.1|4984134_4985961_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	2.0e-25
WP_106884244.1|4985960_4989503_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	20.6	3.4e-08
WP_044805679.1|4989495_4992384_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	2.4e-68
>prophage 327
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	4997861	5004634	5434442		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|4997861_4998656_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|4998662_4999538_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|4999688_5001935_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|5001947_5002478_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|5003162_5003852_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|5003920_5004634_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 328
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5014264	5016759	5434442		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|5014264_5015683_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603508.1|5015997_5016759_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 329
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5039590	5040346	5434442		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|5039590_5040346_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 330
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5064625	5080017	5434442	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_106884251.1|5064625_5066026_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_044804977.1|5066043_5067360_+	guanine deaminase	NA	NA	NA	NA	NA
WP_106884252.1|5067395_5068763_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	72.8	6.2e-160
WP_000838428.1|5068798_5069287_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_044804975.1|5069286_5071206_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|5071641_5073090_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|5073091_5073217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|5073213_5073285_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192826.1|5073339_5073888_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|5073930_5075448_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|5075457_5076556_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813220.1|5076646_5078380_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|5078385_5079096_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|5079120_5080017_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 331
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5083941	5089309	5434442		Pandoravirus(50.0%)	3	NA	NA
WP_001344773.1|5083941_5085375_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
WP_000951964.1|5085431_5086175_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_106878669.1|5086435_5089309_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.4	8.2e-263
>prophage 332
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5097837	5099070	5434442		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|5097837_5099070_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 333
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5117074	5117752	5434442		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|5117074_5117752_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 334
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5138759	5139914	5434442		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|5138759_5139914_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 335
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5165744	5171888	5434442	integrase	Stx2-converting_phage(50.0%)	4	5158659:5158672	5189604:5189617
5158659:5158672	attL	AATCAGGCGATGAT	NA	NA	NA	NA
WP_044805839.1|5165744_5167010_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	9.0e-81
WP_001341423.1|5168000_5168675_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_025380681.1|5168671_5169019_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	5.9e-43
WP_000603950.1|5171339_5171888_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
5189604:5189617	attR	AATCAGGCGATGAT	NA	NA	NA	NA
>prophage 336
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5177112	5178102	5434442		Salmonella_phage(100.0%)	1	NA	NA
WP_044805841.1|5177112_5178102_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	4.1e-97
>prophage 337
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5191024	5191797	5434442		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000422686.1|5191024_5191450_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_106884259.1|5191446_5191797_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	8.9e-39
>prophage 338
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5206157	5208333	5434442		Yersinia_phage(33.33%)	4	NA	NA
WP_106884262.1|5206157_5206976_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	4.7e-46
WP_000213700.1|5207066_5207552_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	2.4e-13
WP_159028787.1|5207566_5208043_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_106884263.1|5208111_5208333_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 339
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5241819	5242992	5434442		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|5241819_5242992_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 340
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5265206	5266091	5434442		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|5265206_5266091_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 341
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5272054	5282875	5434442		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000013149.1|5272054_5272882_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000848528.1|5274057_5274315_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|5274357_5276577_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|5276687_5278100_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|5278174_5278912_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|5279144_5281403_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183500.1|5281947_5282430_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|5282482_5282875_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 342
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5286702	5297664	5434442		Bacillus_virus(20.0%)	12	NA	NA
WP_044805641.1|5286702_5288595_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|5288623_5289205_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444756.1|5289204_5290032_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|5290056_5290479_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|5290479_5291109_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|5291313_5292795_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|5292942_5293614_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|5293619_5294780_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188373.1|5294817_5295633_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|5295748_5296522_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|5296579_5296750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|5297010_5297664_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 343
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5307178	5308612	5434442		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|5307178_5308612_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 344
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5313749	5314988	5434442	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708470.1|5313749_5314988_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.7e-92
>prophage 345
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5321370	5337555	5434442	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|5321370_5322384_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|5322621_5322837_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918826.1|5322947_5324693_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|5324887_5326729_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|5326807_5327314_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_044805630.1|5327567_5328332_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018000.1|5328608_5329232_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|5329385_5330906_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000627213.1|5331212_5332703_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|5332744_5333077_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|5333295_5334279_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082879.1|5334462_5337555_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
>prophage 346
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5349976	5350942	5434442		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|5349976_5350942_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 347
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5376957	5379252	5434442		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|5376957_5379252_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 348
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5387239	5388385	5434442		Streptococcus_phage(100.0%)	1	NA	NA
WP_001297158.1|5387239_5388385_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 349
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5411379	5419172	5434442		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809253.1|5411379_5412240_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249157.1|5412303_5414340_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|5414297_5414693_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|5414712_5415303_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|5415312_5415888_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147619.1|5416001_5417042_-	permease	NA	NA	NA	NA	NA
WP_001298741.1|5417114_5417750_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|5417877_5418396_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449041.1|5418375_5418819_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|5418869_5419172_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 350
NZ_CP027552	Escherichia coli strain 2015C-4498 chromosome, complete genome	5434442	5425000	5426881	5434442		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_044805614.1|5425000_5426881_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	1.5e-52
