The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	229442	295415	4836918	terminase,portal,integrase,protease,tail,lysis,holin,head,capsid,transposase	Enterobacteria_phage(44.93%)	82	232278:232294	294014:294030
WP_006703274.1|229442_231035_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.0e-174
WP_000624677.1|231065_231416_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_000422671.1|231412_231832_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	4.5e-45
WP_106878805.1|231885_232188_+	aconitate hydratase	NA	NA	NA	NA	NA
232278:232294	attL	TGTAGGCCGGATAAGGC	NA	NA	NA	NA
WP_001091599.1|232328_233612_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_000533643.1|233746_234817_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_032154980.1|234794_235013_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.1e-34
WP_000545728.1|235052_235220_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_024229344.1|236276_236504_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.2	2.1e-33
WP_085948123.1|236500_237669_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
WP_001386642.1|237848_238130_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548536.1|238140_238332_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_021559783.1|238304_238487_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	95.0	6.9e-27
WP_000186792.1|238483_239164_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_001414600.1|239160_239946_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	5.3e-148
WP_000995449.1|239951_240248_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000372923.1|240322_240466_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|240434_240599_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_021559784.1|240671_241040_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	1.7e-64
WP_001278766.1|241296_241791_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.4	1.4e-85
WP_072130216.1|241783_242239_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	94.5	5.7e-62
WP_001519589.1|242488_243184_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_000067728.1|243259_243475_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_000251067.1|243594_243888_+	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.4e-45
WP_021559786.1|243920_244820_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.0	4.6e-172
WP_000788855.1|244816_245518_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	2.4e-128
WP_000145919.1|245514_245805_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.8	4.1e-45
WP_000736913.1|245878_246319_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153306.1|246315_246843_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	99.4	2.8e-100
WP_001254255.1|246839_247016_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_021559693.1|247018_247363_+	DUF2591 family protein	NA	K7P7P1	Enterobacteria_phage	67.5	2.0e-35
WP_000950978.1|247362_247539_+	protein ninF	NA	G9L691	Escherichia_phage	98.3	9.7e-26
WP_001003979.1|247531_248254_+	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	95.0	4.2e-123
WP_000002243.1|248253_248544_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_021559692.1|248540_248903_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	2.0e-62
WP_000994515.1|248899_249088_+	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_074453948.1|249084_249708_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	1.1e-111
WP_001302581.1|249960_250704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|250789_250948_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000023266.1|251246_253097_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411802.1|253544_253751_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_021559952.1|254243_254681_+|lysis	lysis protein	lysis	K7P6J0	Enterobacteria_phage	98.6	2.2e-71
WP_021559711.1|254883_255480_+	hypothetical protein	NA	Q9B021	Phage_GMSE-1	65.0	8.7e-18
WP_000187850.1|255476_255680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021559710.1|256231_256738_+	hypothetical protein	NA	O64316	Escherichia_phage	48.1	8.1e-33
WP_021559951.1|256709_258635_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	97.2	0.0e+00
WP_000198149.1|258631_258838_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_021559788.1|258834_260436_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	6.5e-310
WP_074453938.1|260416_261736_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.0e-232
WP_021559790.1|261745_262078_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_021559791.1|262133_263159_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.5e-190
WP_021559792.1|263200_263596_+	hypothetical protein	NA	A0A0K2FIR1	Enterobacteria_phage	90.9	3.8e-54
WP_021559793.1|263607_263961_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	97.4	1.1e-60
WP_021559794.1|263972_264551_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.0e-79
WP_021559795.1|264547_264943_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	6.5e-70
WP_021559796.1|264950_265691_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.8	8.6e-132
WP_000479139.1|265706_266129_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_000459480.1|266110_266545_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_021559797.1|266537_269099_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.9	0.0e+00
WP_000847364.1|269095_269425_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	1.2e-56
WP_021559798.1|269424_270123_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	4.4e-130
WP_032154988.1|270127_270871_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_050576029.1|270807_271410_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	83.7	5.2e-87
WP_021559801.1|271470_275172_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	77.3	0.0e+00
WP_021559802.1|275239_275839_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.0	5.9e-107
WP_021559803.1|275898_277212_+	hypothetical protein	NA	H6WZM9	Escherichia_phage	96.6	1.1e-73
WP_001023455.1|277213_277483_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_021559804.1|277703_278246_+	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	68.6	3.2e-51
WP_106878806.1|278190_278364_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	3.1e-08
WP_032154997.1|279224_279923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024229352.1|280746_281337_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_024229354.1|281853_282735_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	88.7	4.0e-144
WP_021559810.1|282960_283836_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	92.8	8.8e-152
WP_000767391.1|284508_284985_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_000817269.1|285093_286224_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
WP_001362906.1|286334_287624_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000951218.1|287710_288751_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_000638121.1|288747_289902_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000246767.1|289888_290644_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000030923.1|290636_291314_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000042533.1|291892_293914_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_106426573.1|294066_295415_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
294014:294030	attR	TGTAGGCCGGATAAGGC	NA	NA	NA	NA
>prophage 2
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	1418926	1487547	4836918	terminase,portal,integrase,tail,holin,head,capsid,transposase	Enterobacteria_phage(32.61%)	71	1416454:1416513	1464765:1464826
1416454:1416513	attL	TGGCGGAGAGAGGGGGATTTGAACCCCCGGTGGAGTTGCCCCCACTCCGGTTTTCGAGAC	NA	NA	NA	NA
WP_095111390.1|1418926_1419058_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950813.1|1419404_1420385_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001023459.1|1420561_1420831_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_021559911.1|1420832_1422146_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	97.3	3.0e-79
WP_021559912.1|1422210_1422834_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.3e-69
WP_021559913.1|1422902_1426379_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.4	0.0e+00
WP_000649829.1|1426512_1427040_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_072280596.1|1427230_1427863_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.1e-103
WP_000194790.1|1427808_1428552_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_001357740.1|1428557_1429256_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|1429255_1429585_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_021559914.1|1429581_1432161_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
WP_021559915.1|1432141_1432555_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	3.9e-41
WP_000479105.1|1432581_1433013_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001357739.1|1433026_1433779_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.6e-133
WP_000683066.1|1433786_1434182_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975046.1|1434178_1434712_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.2e-57
WP_001204549.1|1434727_1435081_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000201523.1|1435073_1435448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522615.1|1435498_1436527_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.7	3.9e-114
WP_000256809.1|1436584_1436932_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_021559916.1|1436968_1438474_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	54.2	1.0e-99
WP_000831765.1|1438463_1440056_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.2e-184
WP_000259002.1|1440052_1440259_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021559917.1|1440242_1442171_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.0e-261
WP_000235436.1|1442142_1442652_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|1443054_1443279_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|1443360_1443675_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1444202_1444388_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1444609_1444723_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1444943_1445477_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1445636_1445909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|1446164_1446371_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_001064889.1|1450207_1450897_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_021559919.1|1450893_1451259_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	1.2e-38
WP_021559920.1|1451259_1452318_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	3.4e-89
WP_032155008.1|1452319_1452598_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000935258.1|1452765_1452978_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_021559921.1|1453620_1454064_+	acetyltransferase	NA	NA	NA	NA	NA
WP_021559922.1|1454084_1454669_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021559923.1|1454854_1456093_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_021559924.1|1456408_1456831_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_021559925.1|1456871_1457954_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	6.1e-62
WP_000693867.1|1458025_1458451_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|1458447_1458702_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|1458781_1459201_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379575.1|1459499_1459655_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1459814_1460033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136750914.1|1460036_1460201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560212.1|1460605_1460827_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	82.2	4.3e-31
WP_021559926.1|1460950_1463425_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	4.7e-57
WP_000096345.1|1463483_1463687_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533621.1|1463686_1464712_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_001339726.1|1464947_1465745_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1464765:1464826	attR	TGGCGGAGAGAGGGGGATTTGAACCCCCGGTGGAGTTGCCCCCACTCCGGTTTTCGAGACCG	NA	NA	NA	NA
WP_000480510.1|1467280_1468333_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378556.1|1468647_1469964_+	shikimate transporter	NA	NA	NA	NA	NA
WP_000532923.1|1471861_1472578_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122991305.1|1473206_1474850_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011024.1|1474967_1475918_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011479.1|1476019_1476937_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001358075.1|1477397_1477958_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_000064391.1|1477973_1478726_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_021559929.1|1478821_1479466_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_021559930.1|1479488_1480742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608247.1|1480762_1481056_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_001358076.1|1481074_1481518_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000850105.1|1482959_1483496_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_000420479.1|1483499_1484870_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000422671.1|1485157_1485577_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	4.5e-45
WP_000624677.1|1485573_1485924_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_074453947.1|1485954_1487547_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.2	3.3e-173
>prophage 3
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	1586530	1631408	4836918	terminase,tRNA,portal,integrase,tail,lysis,holin,head,capsid,transposase	Escherichia_phage(33.33%)	57	1573740:1573757	1621607:1621624
1573740:1573757	attL	GGAAGAGATCGACGCCCG	NA	NA	NA	NA
WP_085948123.1|1586530_1587698_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
WP_021559940.1|1587673_1587967_-|tail	major tail protein V	tail	A0A2I6TC77	Escherichia_phage	96.6	1.2e-44
WP_001358133.1|1587974_1588370_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	1.1e-69
WP_074453944.1|1588366_1588900_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	72.9	1.8e-62
WP_001358135.1|1588911_1589265_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.0e-62
WP_001358136.1|1589276_1589675_-	phage DNA-packaging protein	NA	A0A2R9YJP4	Escherichia_phage	94.7	3.0e-59
WP_001358137.1|1589716_1590481_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	98.0	2.6e-139
WP_021559942.1|1590626_1590812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358138.1|1590856_1591618_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_001356805.1|1592610_1593219_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.1	5.4e-100
WP_001356806.1|1593298_1593682_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_021559944.1|1593693_1594035_-|head	head decoration protein	head	NA	NA	NA	NA
WP_001356808.1|1594044_1595085_-|capsid	phage capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.4	2.6e-65
WP_001356809.1|1595302_1595752_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001356810.1|1595748_1596006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356811.1|1596295_1598047_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	41.3	1.5e-94
WP_001356812.1|1598043_1598343_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001091145.1|1598360_1598582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|1598582_1598774_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_021559945.1|1598773_1598959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064716654.1|1598951_1599239_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_021559946.1|1599294_1599489_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_021559947.1|1599513_1600239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021559948.1|1600279_1600513_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_021559949.1|1600514_1601750_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	45.2	6.5e-100
WP_001365132.1|1601882_1602152_-|capsid	capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	100.0	5.3e-39
WP_001356817.1|1602213_1602546_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	7.1e-54
WP_024235690.1|1602555_1603875_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	6.2e-234
WP_001356819.1|1603855_1605457_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|1605453_1605660_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_106878821.1|1605656_1607582_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|1607556_1608102_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001248043.1|1608241_1608391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881326.1|1608591_1609209_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001357156.1|1609358_1609796_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	2.9e-71
WP_000075143.1|1609792_1610290_-	lysozyme	NA	H6WZK1	Escherichia_phage	98.8	3.8e-91
WP_000284524.1|1610289_1610505_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|1610647_1611046_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|1611126_1611285_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1611370_1612114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235438.1|1612365_1612989_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	98.1	4.4e-113
WP_021559685.1|1612985_1613651_-	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	97.3	1.4e-128
WP_024229307.1|1613647_1614268_-	recombination protein NinG	NA	Q716C3	Shigella_phage	97.1	3.7e-96
WP_000566997.1|1614260_1614431_-	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_016063117.1|1614427_1614610_-	NinE family protein	NA	K7PH28	Enterobacteria_phage	100.0	7.4e-29
WP_000814618.1|1614606_1615017_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	2.0e-69
WP_000229808.1|1615024_1615231_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	95.6	6.7e-26
WP_000145926.1|1615303_1615594_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_071792051.1|1617114_1618062_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.2	3.3e-168
WP_001357162.1|1618405_1619653_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001197878.1|1619652_1622775_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
1621607:1621624	attR	CGGGCGTCGATCTCTTCC	NA	NA	NA	NA
WP_021541090.1|1622775_1625853_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001357165.1|1625853_1627269_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675178.1|1627265_1628669_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|1628665_1629388_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001300972.1|1629567_1629900_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476019.1|1630046_1631408_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	5.5e-217
>prophage 4
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	1703450	1712892	4836918		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001357188.1|1703450_1704587_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
WP_001357189.1|1704583_1706584_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001296231.1|1706708_1707170_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|1707210_1707681_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001308766.1|1707727_1708447_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1708443_1710129_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240405.1|1710350_1711082_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.2e-111
WP_021559962.1|1711141_1711249_+	protein YohO	NA	NA	NA	NA	NA
WP_000783108.1|1711229_1711961_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001357190.1|1711965_1712892_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	1.8e-22
>prophage 5
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	2176736	2272438	4836918	terminase,tRNA,portal,integrase,protease,tail,head,capsid,transposase	Escherichia_phage(65.08%)	97	2221718:2221744	2263354:2263380
WP_021559988.1|2176736_2177474_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_001764820.1|2177605_2178940_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_021559989.1|2178972_2179854_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2179956_2180544_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2180599_2180983_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262726.1|2181287_2181977_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	1.2e-55
WP_000997384.1|2182024_2183062_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2183268_2183688_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2183756_2184455_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001357300.1|2184486_2187147_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2187260_2188616_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001696047.1|2188659_2188983_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2188979_2190278_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2196060_2198634_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040137.1|2198763_2199495_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|2199491_2200472_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2200606_2201344_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_001357546.1|2201465_2202794_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000178456.1|2203054_2203396_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2203499_2203547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200129.1|2203645_2204806_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225233.1|2204848_2205970_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2205980_2207051_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001357547.1|2207260_2207626_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2207775_2208294_+	YfiR family protein	NA	NA	NA	NA	NA
WP_106878828.1|2208283_2209510_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589792.1|2209525_2210008_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2210084_2210432_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001357550.1|2210473_2211241_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2211271_2211820_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2211838_2212087_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2212223_2213585_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2213751_2214543_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2214563_2215850_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2215904_2216498_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2216620_2217499_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880935.1|2217584_2219246_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2219394_2219736_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117845.1|2219797_2220088_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2220077_2220554_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2220684_2221167_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2221718:2221744	attL	CGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_001217539.1|2222016_2222265_+	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000734593.1|2222940_2223762_-	cytolethal distending toxin type I nuclease subunit CdtB	NA	A5LH53	Enterobacteria_phage	100.0	1.5e-153
WP_000358619.1|2223758_2224472_-	cytolethal distending toxin type I subunit CdtA	NA	A5LH52	Enterobacteria_phage	100.0	2.9e-137
WP_062860087.1|2224819_2225089_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	95.5	1.7e-42
WP_064577496.1|2225090_2226404_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.1	8.2e-77
WP_001230492.1|2226463_2227063_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	94.5	4.2e-105
WP_106878829.1|2227129_2230612_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_106878830.1|2230672_2231320_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	9.5e-111
WP_042898928.1|2231217_2231961_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.6e-146
WP_062862155.1|2231966_2232665_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	99.6	6.6e-134
WP_001115181.1|2232664_2233006_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_062862154.1|2232998_2236238_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	99.9	0.0e+00
WP_071782001.1|2236283_2236544_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	100.0	2.4e-41
WP_001312914.1|2236585_2236972_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_000097538.1|2236971_2237676_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	100.0	1.0e-121
WP_001209399.1|2237736_2238081_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001312916.1|2238077_2238527_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001147821.1|2238523_2238862_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	100.0	7.0e-57
WP_000983037.1|2238870_2239176_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_000601355.1|2239187_2239376_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000257519.1|2239426_2240632_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	100.0	1.8e-224
WP_001193627.1|2240646_2241297_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B5FPE3	Escherichia_phage	100.0	1.1e-119
WP_000466258.1|2241274_2242516_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	7.6e-242
WP_000478568.1|2242515_2242698_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	100.0	1.3e-25
WP_001140882.1|2242709_2244467_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	100.0	0.0e+00
WP_024182462.1|2244466_2244949_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	100.0	1.6e-86
WP_062859908.1|2245097_2245448_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	100.0	8.6e-66
WP_032193450.1|2245552_2245738_-	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	1.1e-19
WP_062862152.1|2245954_2246452_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	100.0	2.0e-92
WP_000839579.1|2246451_2246667_-	hypothetical protein	NA	A0A1B5FPA9	Escherichia_phage	100.0	5.3e-34
WP_000738206.1|2247626_2247890_-	Shiga toxin Stx2f subunit B	NA	A0A1B5FPJ9	Escherichia_phage	100.0	1.7e-42
WP_062860140.1|2247902_2248862_-	Shiga toxin Stx2f subunit A	NA	A0A1B5FPE4	Escherichia_phage	99.7	6.9e-174
WP_062860141.1|2249349_2250270_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	100.0	6.8e-78
WP_000762841.1|2250384_2251215_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	99.6	3.0e-149
WP_001258394.1|2251214_2252072_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	98.9	6.4e-163
WP_000844624.1|2252071_2253040_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	99.7	1.4e-187
WP_001177554.1|2253041_2254700_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	99.5	0.0e+00
WP_001287834.1|2254811_2255180_-	hypothetical protein	NA	A0A1B5FPB1	Escherichia_phage	99.2	1.2e-62
WP_000677966.1|2255734_2256007_-	transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	100.0	3.1e-47
WP_000793268.1|2256141_2256831_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	100.0	2.0e-130
WP_000654197.1|2256977_2257406_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	100.0	1.7e-76
WP_000781553.1|2257407_2257599_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	98.4	1.7e-28
WP_000632553.1|2257595_2257787_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	100.0	2.7e-29
WP_062860142.1|2257971_2258331_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	100.0	3.2e-60
WP_001281776.1|2258330_2258540_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	100.0	6.3e-32
WP_000610945.1|2258766_2259345_+	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	100.0	1.7e-79
WP_001028558.1|2259356_2260103_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	100.0	5.1e-140
WP_000053174.1|2260102_2260441_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	100.0	1.9e-57
WP_000701813.1|2260441_2260663_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	100.0	9.3e-34
WP_000516301.1|2260766_2261396_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	100.0	4.6e-118
WP_000457733.1|2261483_2261726_+	DUF4222 domain-containing protein	NA	A0A1B5FPC4	Escherichia_phage	100.0	1.5e-37
WP_001030145.1|2261729_2261876_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	100.0	7.5e-24
WP_062860143.1|2262048_2263221_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	87.7	1.1e-197
WP_106878831.1|2263817_2264985_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	5.1e-171
2263354:2263380	attR	CGGGTTCAACTCCCGCCAGCTCCACCA	NA	NA	NA	NA
WP_071526065.1|2268219_2268321_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021559993.1|2268520_2272438_-|protease	serine protease autotransporter toxin EspC	protease	Q9LA58	Enterobacterial_phage	38.2	3.0e-223
>prophage 6
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	2343771	2350911	4836918		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2343771_2346333_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141304.1|2346438_2347095_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_001298167.1|2347145_2347913_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	2.2e-69
WP_000847997.1|2348108_2349017_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590411.1|2349013_2350276_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279001.1|2350272_2350911_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
>prophage 7
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	3335966	3346554	4836918	integrase	Enterobacteria_phage(100.0%)	11	3335784:3335806	3347039:3347061
3335784:3335806	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_024229489.1|3335966_3337145_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.1e-208
WP_000344414.1|3337996_3339406_-	maturase	NA	NA	NA	NA	NA
WP_000446131.1|3339728_3340301_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_000638629.1|3340374_3340875_-	transactivation protein	NA	NA	NA	NA	NA
WP_021560086.1|3340871_3341606_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	1.5e-128
WP_001613634.1|3342159_3342426_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
WP_021560087.1|3342422_3343022_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	1.7e-50
WP_001244664.1|3343014_3343302_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_000459307.1|3343294_3343750_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	100.0	7.2e-65
WP_000856729.1|3343885_3344206_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_021560088.1|3344220_3346554_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
3347039:3347061	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 8
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	3636462	3734652	4836918	terminase,tRNA,plate,portal,integrase,protease,tail,lysis,holin,head,capsid,transposase	Escherichia_phage(38.3%)	100	3663007:3663053	3694449:3694495
WP_021560109.1|3636462_3636900_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|3636944_3637886_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001357065.1|3637949_3638858_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|3639086_3639398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|3639398_3639689_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|3640047_3640326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314326.1|3640721_3640940_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000027710.1|3641163_3642093_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|3642089_3642725_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|3642721_3643624_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077627280.1|3643636_3646687_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753585.1|3646880_3647714_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_021560110.1|3648709_3650104_+	glycoporin	NA	NA	NA	NA	NA
WP_001357063.1|3650144_3650459_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179744.1|3650468_3651293_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001357062.1|3651385_3652645_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144110.1|3652641_3654111_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217156.1|3654398_3655235_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|3655218_3656157_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063508.1|3656153_3657188_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001298417.1|3657473_3658094_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	8.4e-64
WP_106878845.1|3658353_3659337_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270239.1|3659485_3660160_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001357059.1|3660264_3661638_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|3661634_3662333_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001357058.1|3662482_3662983_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3663007:3663053	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985242.1|3663169_3664150_-|integrase	site-specific integrase	integrase	Q858U3	Yersinia_virus	100.0	4.7e-186
WP_000777029.1|3664219_3664513_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|3664649_3664922_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|3665091_3665592_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3665655_3665880_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277905.1|3665879_3666182_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	100.0	3.5e-47
WP_001113264.1|3666181_3666406_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027662.1|3666402_3666678_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	100.0	3.8e-45
WP_021560112.1|3666667_3668977_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_001533789.1|3670123_3670843_-	hypothetical protein	NA	A0A0R6PKK0	Moraxella_phage	28.4	1.2e-16
WP_021560113.1|3670853_3671999_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	46.2	3.3e-82
WP_021560114.1|3672326_3673361_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	9.3e-201
WP_000156861.1|3673360_3675133_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_021560115.1|3675306_3676161_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_001248553.1|3676219_3677293_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	6.7e-202
WP_021560116.1|3677296_3678040_+|terminase	terminase endonuclease subunit	terminase	U5N091	Enterobacteria_phage	98.8	1.7e-124
WP_000988633.1|3678139_3678649_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_021560117.1|3678648_3678852_+	hypothetical protein	NA	A0A0F7LCN2	Escherichia_phage	98.5	6.8e-31
WP_000123124.1|3678855_3679137_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|3679136_3679634_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_021560118.1|3679648_3680074_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.7	3.3e-59
WP_021560119.1|3680061_3680487_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	96.5	8.0e-66
WP_072134039.1|3680458_3680632_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
WP_021560120.1|3680594_3681062_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	2.2e-80
WP_021560121.1|3681054_3681507_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.8e-76
WP_001093707.1|3681573_3682209_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	4.1e-114
WP_021560122.1|3682205_3682553_+|plate	baseplate assembly protein W	plate	A0A0F7LDQ1	Escherichia_phage	99.1	1.5e-57
WP_001121503.1|3682557_3683466_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	2.6e-162
WP_001285325.1|3683458_3683989_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_074453924.1|3683999_3686060_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.9	7.5e-218
WP_021560124.1|3686063_3686591_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	94.9	2.0e-90
WP_032155057.1|3686812_3687406_+	hypothetical protein	NA	Q858S7	Enterobacteria_phage	94.4	6.3e-101
WP_021560126.1|3687735_3688926_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	99.5	8.1e-225
WP_001251408.1|3688938_3689457_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|3689513_3689789_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|3689821_3689941_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_106878846.1|3691657_3692380_+	hypothetical protein	NA	M1T2S3	Escherichia_phage	88.8	2.0e-93
WP_021560129.1|3692873_3694037_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	7.7e-204
WP_000468308.1|3694118_3694337_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|3694573_3695476_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3694449:3694495	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_001318165.1|3695656_3696619_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758727.1|3696938_3697928_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001357041.1|3698034_3698790_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|3698844_3699612_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802217.1|3699719_3700319_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|3700419_3700860_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|3701071_3701371_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|3701397_3701826_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|3701830_3702577_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|3702673_3703684_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|3703854_3705363_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|3705385_3706231_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|3706655_3706901_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|3706985_3707471_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|3707563_3708490_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|3708556_3709888_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|3709897_3710428_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|3710520_3711480_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|3711571_3712597_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001334265.1|3712752_3714951_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|3715153_3715366_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000702302.1|3715426_3716035_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|3716094_3716412_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_001357040.1|3716688_3717849_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110759.1|3717851_3720284_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000275563.1|3720501_3721362_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001357039.1|3721438_3723058_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000105532.1|3724870_3725995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000694066.1|3726127_3727681_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	1.0e-09
WP_106878847.1|3728062_3728953_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001296626.1|3729281_3731462_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001271242.1|3731555_3732461_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647862.1|3732487_3733105_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_106426573.1|3733304_3734652_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 9
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	3863515	3910592	4836918	plate,portal,integrase,tail,holin,head,capsid	Enterobacteria_phage(26.67%)	64	3902666:3902681	3911443:3911458
WP_001093916.1|3863515_3863797_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_021559699.1|3863833_3864406_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.4	3.0e-108
WP_021559698.1|3864405_3865158_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	99.2	4.9e-143
WP_001014291.1|3865160_3865352_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_000476214.1|3865878_3866118_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	8.2e-36
WP_000111289.1|3866110_3866314_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_021559696.1|3866310_3866673_-	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	4.0e-66
WP_000008178.1|3866663_3867200_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_106878848.1|3867328_3868153_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	8.6e-149
WP_000135680.1|3868218_3868581_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000349080.1|3868992_3869361_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021559690.1|3869525_3870200_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.1	1.0e-131
WP_000649477.1|3870290_3870491_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_021559695.1|3870534_3871086_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_074452361.1|3871082_3871922_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	82.8	6.1e-118
WP_024167702.1|3871926_3872151_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	95.9	8.5e-35
WP_074452360.1|3872147_3872966_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	4.7e-123
WP_074452359.1|3872962_3873457_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	95.7	3.8e-83
WP_000066917.1|3873456_3874110_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|3874106_3874433_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_021559677.1|3874429_3874819_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	96.9	3.9e-67
WP_074452358.1|3874838_3875648_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	98.9	3.4e-150
WP_021560131.1|3875655_3876645_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001047085.1|3876658_3877411_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	1.5e-136
WP_021560133.1|3878435_3878930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560134.1|3879229_3879781_+	hypothetical protein	NA	A0A0P0ZFJ1	Escherichia_phage	93.3	1.2e-93
WP_024229507.1|3879998_3880493_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	52.4	3.2e-34
WP_050576034.1|3880760_3881204_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	46.7	4.8e-29
WP_021560138.1|3881169_3882102_+	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	37.6	1.7e-39
WP_001113005.1|3882103_3882424_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_001039321.1|3882437_3882905_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	57.2	2.5e-44
WP_000111451.1|3882901_3883138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560139.1|3883109_3883391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136503118.1|3883549_3883978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560141.1|3884025_3884457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073976905.1|3884530_3884713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157924770.1|3884842_3884980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024229510.1|3885166_3885832_+	hypothetical protein	NA	G8EY51	Synechococcus_phage	32.3	7.7e-07
WP_021560143.1|3885960_3886674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000982249.1|3888601_3888853_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_021560145.1|3888861_3890502_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	37.5	9.2e-94
WP_021560146.1|3890498_3891359_+	S49 family peptidase	NA	A0A2H4PRE9	Proteus_phage	46.4	6.2e-49
WP_021560147.1|3891351_3891924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560148.1|3891923_3892325_+|head	head decoration protein	head	A0A0C5AN05	Bacteriophage	45.9	4.3e-13
WP_001290409.1|3892380_3893436_+|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	31.2	5.3e-34
WP_000146201.1|3893437_3893623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560149.1|3893606_3893939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560150.1|3893938_3894499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021560151.1|3894512_3894749_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_021560152.1|3894745_3896248_+	hypothetical protein	NA	B5TK67	Pseudomonas_phage	44.7	6.2e-105
WP_050576033.1|3896287_3896653_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021560154.1|3896652_3896934_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_021560155.1|3897069_3899037_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	47.9	2.1e-20
WP_021560156.1|3899047_3900460_+	hypothetical protein	NA	J7FAD8	Agrobacterium_phage	36.3	3.7e-06
WP_062897568.1|3900456_3901545_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	31.1	2.4e-37
WP_062897569.1|3901541_3902123_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	33.3	4.7e-16
WP_021560159.1|3902124_3902562_+	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	42.5	6.2e-21
WP_021560160.1|3902563_3903718_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	32.3	5.8e-34
3902666:3902681	attL	CCGGGGATTCTGGCGG	NA	NA	NA	NA
WP_158707951.1|3903726_3904845_+	DUF2313 domain-containing protein	NA	A0A0C4UR33	Shigella_phage	29.3	3.3e-10
WP_062860027.1|3905930_3906722_+	hypothetical protein	NA	U5N099	Enterobacteria_phage	51.1	2.9e-16
WP_021560164.1|3906723_3907263_+|tail	tail assembly chaperone	tail	A0A1B0VCD0	Salmonella_phage	42.7	9.6e-32
WP_021560165.1|3907774_3908563_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001217107.1|3909232_3909433_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	95.5	8.4e-26
WP_000332257.1|3909494_3910592_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	98.9	4.0e-210
3911443:3911458	attR	CCGGGGATTCTGGCGG	NA	NA	NA	NA
>prophage 10
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	4584386	4596297	4836918	integrase,transposase	Stx2-converting_phage(20.0%)	17	4586900:4586958	4606531:4606589
WP_001285288.1|4584386_4585490_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|4585501_4586755_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
4586900:4586958	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
WP_001375035.1|4586959_4588120_-|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	97.7	3.9e-224
WP_085948123.1|4588367_4589535_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	8.7e-171
WP_001164448.1|4589666_4590125_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_001374979.1|4590228_4591113_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001591577.1|4591314_4592097_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	44.5	3.3e-49
WP_000951713.1|4592093_4592303_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.2	1.3e-32
WP_001375001.1|4592304_4592853_-	ead/Ea22-like family protein	NA	E7C9P4	Salmonella_phage	98.6	8.0e-34
WP_000763363.1|4592849_4593071_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_077694308.1|4593169_4593451_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	1.8e-45
WP_000548531.1|4593461_4593653_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682306.1|4593625_4593808_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|4593804_4594485_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|4594481_4595267_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|4595272_4595569_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_086204775.1|4595733_4596297_+	replication protein P	NA	C1JJ54	Enterobacteria_phage	95.1	4.7e-98
4606531:4606589	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTTAAATCAATAA	NA	NA	NA	NA
>prophage 11
NZ_CP027550	Escherichia coli strain 2015C-4136CT1 chromosome, complete genome	4836918	4599940	4605045	4836918	transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_000422671.1|4599940_4600360_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	4.5e-45
WP_000624677.1|4600356_4600707_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_006703274.1|4600737_4602330_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.0e-174
WP_021559744.1|4602645_4603689_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072172241.1|4604038_4604140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021559745.1|4604136_4604592_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.8e-59
WP_000224914.1|4604591_4604762_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_021559746.1|4604754_4605045_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	4.8e-46
>prophage 1
NZ_CP027551	Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence	162810	7810	68583	162810	integrase,transposase	Stx2-converting_phage(38.46%)	40	7781:7840	44012:46516
7781:7840	attL	GTAAGCGTCAACGGAGCACCGTATTGACGCTTATTTATTGGTGAGAACTACGTTCCATGG	NA	NA	NA	NA
WP_062860097.1|7810_9403_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.8e-174
WP_000624677.1|9433_9784_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_000422671.1|9780_10200_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	4.5e-45
WP_001132891.1|12576_12828_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_062862136.1|13349_14321_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	93.8	2.2e-164
WP_062860116.1|14320_15487_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	5.2e-224
WP_062860185.1|17030_18182_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.6	1.5e-42
WP_000747069.1|18101_18452_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	1.8e-39
WP_053264260.1|20394_20763_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_062860125.1|20749_21811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062859980.1|22656_23070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101750711.1|23908_25071_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_064577908.1|25891_26137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062859980.1|26417_26831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106878861.1|28144_29353_+|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
WP_077878401.1|32622_33309_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	54.4	6.9e-27
WP_025263474.1|34262_35372_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.6	1.3e-115
WP_062859902.1|35531_36299_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062859901.1|38236_39433_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000578339.1|40758_41493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062859900.1|41582_41891_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025263478.1|42049_42388_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_152930419.1|42944_43085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062860097.1|44041_45634_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.8e-174
WP_000624677.1|45664_46015_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_000422671.1|46011_46431_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	4.5e-45
WP_062860084.1|46589_46880_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.9	7.2e-18
44012:46516	attR	GTAAGCGTCAACGGAGCACCGTATTGACGCTTATTTATTGGTGAGAACTACGTTCCATGGCAGGAGTTCGTCAACACGGTTGGAGGGCCATTCCGGCAGTACGCTCAGAATATGGCGCAGATACGCTTCCGGATCGATACCGTTCAGACGGCAGGTGCCGATCAGCCCGTACAGCAGTGCACCACGCTCGCCGCCGTGATCGCTACCGAAGAACACGTAATTTTTCTTTCCAAGACAGACTGCACGAAGCGCTCTTTCCGCTGTGTTATTGTCCGTCTCCGCCAGTCCGTCATCACTGTAATAACAGAGGGCGTCCCACTGATTCAGTACATAGCTGAACGCTTCGCCCAGTCTGGATTTTTTCGACAGCGTACCATTCTTCTCCACCATCCATTCATGCAGCGACGTCAGTAACGCTTTGCCTCGCTGCTGTCTGACTGCAAGACGCTCTGACTCCGGTAATCCCCGTATTTCATCCTCGATGGCGTACAGTTCACTGATTCGCTTCAGGGCTTCTTCTGCCGTCGCACTTTTGCTGCTGATGTATACATCGTGGATTTTTCTCCGGGCATGGGCCCAGCACGCAACTTCTGTCAGCGCACCACCTTCACGTTCTGCACTGAACAGCCTGTCATAACCTGTGAACGCATCCGCCTGCAGGATACCCCGGAAGGGGCGGAGGTGTTGCTCCGGGTGTTTCCCCTGCCGGTTCGGTGAGTACGCGAACCAGACCGCCGGAGGAGATGACGAACCCGCATTGCGATCATCCCGGACATACGTCCAGATGCGCCCTGTTTTCGTCTTTTTCAGGCCCGGTGCCAGTACTTTTACCGGTGTGTCGTCAGTGTGAAGCTTGCGGGTATTCATCACATAACGGTACAGGGCATCATTCAGCGGTGTCATTAACTGGCAGCACGCGTCAACCCAGTTGGAGAGTAATGCACGGCTCAGTTCGACACCCTGTCGGGCAAAGATTTCACTCTGACGATACAGTGGCAGGTGTTCGCAGTATTTTCCCGTTAACACGCGGGCAAGTAATCCGGGGCCCGCGATACCACGCTCTATCGGGCGGGACGGCGCCGGTGCTTCAACGATGCAGTCACATTTTGTACAGGCTTTTTTTACCCGTTCTGTGCGGATCACTTTCAGGGCGCTGCTCACCAGTTCCAGTTGTTCTGCACTGACTTCCCCCAGATAATCCAGCTCACCGCCACACTCCGGGCAACAGCTTTCTTCAGACTCCAGACGGTGTATTTCACGGGGAAGGTGTGCCGGTAACGGACGACGATGGCGCGACTGTCGCAACTGGCGGGGAACCTGTGGATCGTCTTCCCGCCCACTGCAACGATCGCTGTCCTGTTCGCGTTGTTTCAGCAGGGCCTCAGCCTGTTCAACTTCACGACGCAGTTTTTCAGAACGGGTACCGAACAGCATCCGGCGCAGTTTTTCTATCTGAGCCCGCAGATGTTCTATTTCCCGTTCATCCTCTTCGATCTTTTCTTCGGCACGTGCCAGTGCAGAGCGCAGGAAGGCCGCCGTCTCTTCAACCAGACTCAGTTGCTGGTCTTTCTGACGGAGCTGGCTTTCCAGTTCTGCAATGCGAATGAGGTATTTCTGACTCATGGCCGTTTTTATAATGCGGCCAGGCGTTTTTTACAACATTGTCAGGGCGTTAAGGCGGGATGTTTTTGGCTGACGCCAGTCCAGCTTATCGAGGAGCATTGCCAGTTGCGAGCGGGTAATGGATACCTTACCGTCACGCACCGCAGGCCAGATAAACTGGCCTTCCTCCAGACGTTTGGTGAACAGGCACAGACCATCAGCATCAGCCCAAAGAATTTTAACGGTGTCACCCCGTCGGCCACGGAAGATAAACAGGTGACCGGAGAAGGGATTAACATTTAACACATGCTGTACCTGTTCACCCAGCCCGTTGAAAGACTTACGCATATCGGTTATCCCGGCAACGAGCCAGATACGGGTACCGGATGGGAGTGAGATCATCTTCCCCTCCCGGTCAGTTCACGAATCAATACAGTGAGCAGCTCTGGTGAAGGATTTTCCAGCGTCATGTTACCGTGACGGAACTCCACCTTGCAGGAGCTGGCACTGACAGTAGTCTGAGTGGATAAGGGCGGAGTAAGAGCAGCCATCGGTTCTTTCGGCTCATCAGGCGTTATCTCTACAGGTAATAATTCAAGGCCTGCGTCAGAAGTGGTTGTCACCGGAAGACGCCGTGATATACGCCCTTCGTTTTGCCAGAGTCTGAGCCATTTGAAAATAACATTATCATTGACGCCATTTTCTCGTGCAATCTGAGCCACACAAGCACCGGGTTGTGATGCCAGTTCAATCATACGAAGTTTGAATTCATTCGAATACTTTTTACGAGGTTCTTTTCGCCAGTCCTGTAATTCCATACTTAGATGTCCGTCTGTGTCAGATGGGCGTCTAAGTTACCAATTCTTGTCTAATGGCTACATACGGCGGTCGGTTTACGCTTAC	NA	NA	NA	NA
WP_062860083.1|47167_47371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062860082.1|47740_51238_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.9	5.4e-99
WP_000422671.1|52667_53087_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	4.5e-45
WP_000624677.1|53083_53434_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_106878862.1|53464_55057_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.2	2.5e-173
WP_006703274.1|56556_58149_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.0e-174
WP_000624677.1|58179_58530_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_000422671.1|58526_58946_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	4.5e-45
WP_062860182.1|61274_61550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064768262.1|61761_65859_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	36.6	7.9e-243
WP_000422671.1|66193_66613_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	4.5e-45
WP_000624677.1|66609_66960_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_074453947.1|66990_68583_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.2	3.3e-173
>prophage 2
NZ_CP027551	Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence	162810	78708	96414	162810	transposase	Shigella_phage(40.0%)	14	NA	NA
WP_074466352.1|78708_79917_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
WP_001159871.1|84654_84960_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_062860119.1|84961_85180_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_062860120.1|86019_86610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136503195.1|86734_88080_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	6.0e-75
WP_062860059.1|88384_89200_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062860058.1|89439_89577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062860057.1|89587_89719_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_101750278.1|90416_91497_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.9	1.1e-50
WP_077878528.1|91512_91764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062860055.1|92067_92844_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106878864.1|93079_93784_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	44.3	1.4e-43
WP_062860054.1|94423_94804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101750704.1|95140_96414_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	4.2e-171
