The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	815172	901360	5942969	tail,integrase,tRNA,transposase,protease,plate,head	Shigella_phage(51.16%)	100	818337:818353	887317:887333
WP_000524974.1|815172_816345_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	2.5e-40
WP_000248097.1|816344_816593_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_001056416.1|817157_817742_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|817909_818158_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001512118.1|818159_820250_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
818337:818353	attL	TTACGTGAACGCTACGC	NA	NA	NA	NA
WP_000129790.1|820321_821254_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|821256_821478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|821490_821745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|821746_822028_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|822024_822297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|822301_822595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|822606_823137_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323221.1|823234_823777_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_000578573.1|823780_824314_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|824313_824829_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|824832_825384_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633440.1|825380_825692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|825706_826057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|826072_826405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|826397_826595_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|826584_826881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|826877_827387_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|827456_827882_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|827953_828454_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|828488_828917_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|828900_829119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|829128_829356_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|829336_829645_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|829641_829932_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|829934_830516_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|830515_832180_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|832179_833769_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|833752_835084_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000094808.1|835205_835679_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|835855_836980_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|836979_837927_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001691380.1|837970_838363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|838359_838779_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|838775_839336_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|839336_839582_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|839578_841081_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|841089_841455_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|841469_841946_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|842072_844148_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|844134_845484_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|845467_846592_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|846581_847196_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|847188_847626_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|847625_848708_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|848698_849259_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|849258_850170_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|850204_850726_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|850805_851009_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|851230_851791_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|851890_853930_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|854076_854259_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|854294_854540_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|854578_855043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444515.1|855157_855358_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528254.1|855311_856049_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_044162426.1|856172_856835_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000262951.1|856831_858562_-	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_000388786.1|858923_860066_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001297764.1|860072_860837_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
WP_000026117.1|861087_862587_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_000943055.1|862586_863639_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_001194680.1|863649_864873_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_000853256.1|864877_865282_+	protein GlcG	NA	NA	NA	NA	NA
WP_000084059.1|865303_867475_+	malate synthase G	NA	NA	NA	NA	NA
WP_001115381.1|867693_867948_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001173033.1|867980_869723_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_085948183.1|870179_871392_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	97.6	8.7e-166
WP_001223345.1|873054_875145_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001218848.1|876170_877436_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	5.3e-81
WP_000234514.1|877814_878522_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839764.1|878919_881055_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|881104_882361_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000760323.1|882562_883642_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|883706_883982_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001321419.1|884009_885062_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|885222_885942_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|885941_886268_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|886451_887171_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394117.1|887346_888393_+	L-asparaginase 2	NA	NA	NA	NA	NA
887317:887333	attR	GCGTAGCGTTCACGTAA	NA	NA	NA	NA
WP_000745217.1|888509_889517_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000378946.1|889572_890874_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000577033.1|890873_891377_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000784004.1|891421_892408_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000239919.1|892719_893856_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174742.1|893848_894442_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|894449_894740_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|894736_895303_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|895320_896025_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001055634.1|896042_897023_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|897198_897615_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|897614_898178_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|898286_899237_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222508.1|899249_899981_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|900060_900768_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|900862_901360_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	1017362	1024269	5942969	integrase,transposase	Stx2-converting_phage(50.0%)	6	1017212:1017228	1026297:1026313
1017212:1017228	attL	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000935135.1|1017362_1018970_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_000852869.1|1018962_1019622_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000082600.1|1020530_1021259_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_001339397.1|1021653_1022331_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1022330_1022678_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1022697_1024269_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
1026297:1026313	attR	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 3
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	1176320	1183460	5942969		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1176320_1176959_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1176955_1178218_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1178214_1179123_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1179318_1180086_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141347.1|1180136_1180793_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272924.1|1180898_1183460_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 4
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	1256240	1361194	5942969	tail,integrase,holin,tRNA,terminase,capsid,head	Stx2-converting_phage(31.82%)	103	1257986:1258000	1270343:1270357
WP_000577251.1|1256240_1257959_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000214985.1|1257960_1259709_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
1257986:1258000	attL	TTGTCCAGAAAACTT	NA	NA	NA	NA
WP_032348774.1|1259780_1260194_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	99.3	6.1e-71
WP_001341819.1|1260232_1261462_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_001431537.1|1261760_1262669_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_000516611.1|1263151_1264327_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_000557643.1|1264499_1264646_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000457722.1|1264649_1264892_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000206753.1|1264976_1265840_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000034210.1|1265841_1266171_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000476199.1|1266167_1266407_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000158004.1|1266399_1266603_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000335005.1|1266599_1267478_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000008174.1|1267468_1268005_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000081319.1|1268133_1268958_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000135680.1|1269023_1269386_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000559922.1|1269856_1270372_+	hypothetical protein	NA	NA	NA	NA	NA
1270343:1270357	attR	TTGTCCAGAAAACTT	NA	NA	NA	NA
WP_001020634.1|1270691_1271384_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1271481_1271742_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1271734_1272286_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1272461_1272641_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104954.1|1272630_1273572_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001305611.1|1273568_1274063_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000066917.1|1274062_1274716_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210187.1|1274712_1275039_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767117.1|1275035_1275425_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_024220650.1|1275444_1276254_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	97.8	4.5e-150
WP_001379493.1|1276261_1277251_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	7.3e-195
WP_001205460.1|1277268_1277610_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|1277622_1278171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032212763.1|1280204_1282142_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143462.1|1282277_1282457_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|1282497_1282770_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284519.1|1282846_1283062_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731236.1|1283066_1283411_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|1283461_1283995_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_047091958.1|1284513_1284699_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000736096.1|1284784_1285009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|1285377_1285605_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001365481.1|1285646_1286012_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000958416.1|1286301_1286865_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_062878316.1|1286861_1288523_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_024220730.1|1288586_1290365_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	91.6	0.0e+00
WP_001063099.1|1290409_1290631_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125996.1|1293157_1293484_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001007889.1|1293494_1293845_+|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000573391.1|1293841_1294288_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|1294284_1294629_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275441.1|1294695_1295412_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710952.1|1295426_1295801_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993730.1|1295896_1296106_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000212998.1|1296156_1299399_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_000807927.1|1299391_1299733_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_001341641.1|1299732_1300431_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000194787.1|1300441_1301185_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_122996338.1|1301130_1301763_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_000514836.1|1302001_1305475_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
WP_001427270.1|1305542_1306142_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000268987.1|1306206_1307520_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001023420.1|1307521_1307791_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_115801847.1|1307897_1307987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1308006_1310355_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_000938111.1|1314725_1316087_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000162574.1|1317841_1318324_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|1318455_1318932_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1318921_1319212_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1319273_1319615_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|1319763_1321425_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1321510_1322389_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1322511_1323105_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1323159_1324446_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1324466_1325258_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460032.1|1325424_1326786_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1327034_1327283_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1327301_1327850_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1327880_1328648_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1328689_1329037_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1329113_1329596_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969036.1|1329611_1330838_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1330827_1331346_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|1331495_1331861_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|1332070_1333141_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|1333151_1334273_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|1334315_1335476_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1335574_1335622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1335725_1336067_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1336337_1337075_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079094.1|1337209_1338190_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|1338186_1338918_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1339047_1341621_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|1347474_1348773_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|1348769_1349093_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1349138_1350494_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|1350607_1353268_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001341635.1|1353299_1353998_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1354066_1354486_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|1354692_1355730_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|1355777_1356467_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|1356771_1357155_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|1357210_1357798_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001341633.1|1357900_1358782_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1358990_1360325_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001298974.1|1360456_1361194_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	1375363	1412676	5942969	tail,terminase,holin	Salmonella_phage(52.27%)	48	NA	NA
WP_000627621.1|1375363_1376755_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.0	7.1e-212
WP_000119721.1|1377510_1377780_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	1.0e-26
WP_000637725.1|1377769_1378069_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	62.1	2.3e-27
WP_001419980.1|1378065_1378281_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000065467.1|1378286_1380350_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.5	1.0e-275
WP_000215799.1|1380411_1381101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001444971.1|1381094_1381736_-	hypothetical protein	NA	H6WRY3	Salmonella_phage	65.0	4.7e-70
WP_000769011.1|1381787_1382336_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_032348529.1|1382351_1383653_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	2.6e-131
WP_000051353.1|1383655_1384558_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000049986.1|1385337_1385961_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000170998.1|1386081_1386294_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_024017626.1|1386297_1388490_+	replication protein	NA	B6SCY1	Bacteriophage	71.5	4.1e-174
WP_001244506.1|1388771_1389194_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001174015.1|1389225_1389567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|1390012_1390354_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_032348532.1|1390357_1390834_+	glycoside hydrolase family 104 protein	NA	Q8SBE0	Shigella_phage	95.6	1.0e-85
WP_000779568.1|1390817_1391342_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.1	3.8e-41
WP_000162795.1|1391403_1391976_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_001130778.1|1391978_1393601_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000113492.1|1393600_1395067_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	1.8e-261
WP_000184968.1|1394957_1395692_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.6	2.1e-98
WP_000873176.1|1395706_1396927_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	90.2	4.2e-208
WP_001066734.1|1396930_1397437_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.4e-69
WP_032348533.1|1397448_1398390_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	7.0e-155
WP_001107517.1|1398432_1398654_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	70.6	4.5e-12
WP_001125665.1|1398619_1399027_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	95.6	8.7e-70
WP_000008734.1|1399023_1399578_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	82.6	6.3e-79
WP_001142477.1|1399564_1399954_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	3.3e-66
WP_001349562.1|1399928_1400492_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_032348534.1|1400495_1401641_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.8e-160
WP_000109250.1|1401651_1402092_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_000393948.1|1402095_1402548_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	1.0e-55
WP_044163899.1|1402725_1404714_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.4	3.9e-272
WP_044163902.1|1404713_1405301_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.5	6.9e-84
WP_000155115.1|1405300_1405603_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	89.0	3.5e-47
WP_024017629.1|1405605_1406667_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	83.1	2.5e-156
WP_001214053.1|1406670_1407012_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	84.4	2.5e-33
WP_000466688.1|1407065_1407305_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	46.2	2.1e-07
WP_000301086.1|1407364_1408117_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	4.5e-88
WP_001270634.1|1408116_1408470_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	90.6	3.1e-55
WP_001197074.1|1408469_1409669_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	2.9e-185
WP_000049945.1|1409665_1410346_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.3	4.5e-103
WP_001096984.1|1410345_1411194_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	66.5	8.8e-56
WP_000356377.1|1411193_1411799_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	87.4	2.6e-94
WP_001236015.1|1411767_1411965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001115521.1|1411951_1412332_-	hypothetical protein	NA	I3PGW0	Xanthomonas_phage	32.7	1.8e-08
WP_000904679.1|1412361_1412676_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.5	5.7e-37
>prophage 6
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	1469262	1537830	5942969	tail,integrase,holin,tRNA,terminase	Escherichia_phage(42.03%)	80	1520466:1520482	1535207:1535223
WP_000003317.1|1469262_1470417_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_001090850.1|1470701_1471715_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000551807.1|1471741_1472860_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001107167.1|1472970_1474245_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000409205.1|1474262_1474883_+	YfgM family protein	NA	NA	NA	NA	NA
WP_001177037.1|1474893_1476072_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_000249410.1|1476189_1477662_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001341622.1|1477730_1477946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937895.1|1477942_1479313_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
WP_001299507.1|1479474_1480941_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|1481009_1482587_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000954571.1|1482780_1484037_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	1.3e-236
WP_001055435.1|1484039_1484699_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
WP_000163454.1|1484695_1485346_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.1	8.1e-126
WP_001341620.1|1485338_1485590_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_000675390.1|1485747_1485996_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063821.1|1486045_1486927_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	6.8e-160
WP_000802263.1|1486923_1487745_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.9	1.0e-162
WP_001102249.1|1487741_1488041_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	2.2e-46
WP_000836290.1|1488349_1488934_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282458.1|1489088_1489319_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	98.7	1.0e-38
WP_000402893.1|1489469_1489670_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_000086414.1|1489685_1490501_+	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_001341618.1|1490497_1491283_+	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.9	1.8e-151
WP_044163941.1|1491401_1491746_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	6.3e-61
WP_000405097.1|1491807_1492308_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	69.4	1.6e-44
WP_000034221.1|1492304_1492796_+	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	1.5e-23
WP_001341616.1|1493309_1493927_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	97.1	3.2e-108
WP_000156091.1|1493923_1494127_+	hypothetical protein	NA	Q9G077	Enterobacteria_phage	94.6	1.2e-22
WP_001129695.1|1494119_1494458_+	hypothetical protein	NA	G9L6B6	Escherichia_phage	99.1	4.9e-58
WP_001090120.1|1494498_1495173_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_000132525.1|1495169_1496645_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	98.2	1.9e-292
WP_000787773.1|1496641_1497460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335897.1|1498186_1498393_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	80.9	1.8e-10
WP_000852414.1|1498407_1500087_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
WP_000133160.1|1500083_1500380_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_001048079.1|1500382_1501078_+	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
WP_000268713.1|1501092_1502079_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.4	2.8e-186
WP_000627077.1|1502130_1502568_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	97.2	2.0e-72
WP_000012377.1|1502578_1502914_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000424493.1|1502964_1503288_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	97.2	1.0e-52
WP_000179261.1|1503287_1503893_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	100.0	2.1e-112
WP_001018529.1|1503892_1506364_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.8	0.0e+00
WP_000567631.1|1506363_1506828_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_000332878.1|1506827_1507373_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_001145658.1|1507372_1509886_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.8	0.0e+00
WP_000119864.1|1509882_1511685_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
WP_001248457.1|1511690_1514165_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.0	0.0e+00
WP_001147904.1|1514360_1514657_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_001188253.1|1514688_1514946_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
WP_000218923.1|1515141_1517763_+|tail	tail fiber protein	tail	A0A193GYU1	Enterobacter_phage	70.1	4.3e-125
WP_000902802.1|1517899_1518262_-	GtrA family protein	NA	I1TED9	Salmonella_phage	80.8	2.2e-48
WP_001275997.1|1518410_1518803_+	membrane protein	NA	T1SA79	Salmonella_phage	96.9	2.5e-61
WP_000207023.1|1518799_1519108_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	97.0	1.1e-48
WP_000403808.1|1519097_1519727_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.0e-114
WP_001341613.1|1519723_1520206_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	88.1	3.6e-70
1520466:1520482	attL	ATTACCTTAAAGGTATA	NA	NA	NA	NA
WP_000954571.1|1520523_1521780_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	1.3e-236
WP_001055435.1|1521782_1522442_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	79.5	4.4e-103
WP_000163454.1|1522438_1523089_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.1	8.1e-126
WP_001341620.1|1523081_1523333_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_000675390.1|1523490_1523739_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063821.1|1523788_1524670_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	6.8e-160
WP_000802263.1|1524666_1525488_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.9	1.0e-162
WP_001102249.1|1525484_1525784_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	2.2e-46
WP_000836290.1|1526092_1526677_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282458.1|1526831_1527062_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	98.7	1.0e-38
WP_000402893.1|1527212_1527413_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_000086414.1|1527428_1528244_+	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
WP_001341618.1|1528240_1529026_+	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.9	1.8e-151
WP_044163941.1|1529144_1529489_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	6.3e-61
WP_000405097.1|1529550_1530051_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	69.4	1.6e-44
WP_000034221.1|1530047_1530539_+	ead/Ea22-like family protein	NA	A0A0P0ZD75	Stx2-converting_phage	55.0	1.5e-23
WP_001341616.1|1531052_1531670_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	97.1	3.2e-108
WP_000156091.1|1531666_1531870_+	hypothetical protein	NA	Q9G077	Enterobacteria_phage	94.6	1.2e-22
WP_001129695.1|1531862_1532201_+	hypothetical protein	NA	G9L6B6	Escherichia_phage	99.1	4.9e-58
WP_001090120.1|1532241_1532916_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_000132525.1|1532912_1534388_+	hypothetical protein	NA	A0A0F6TK57	Escherichia_coli_O157_typing_phage	98.2	1.9e-292
WP_000787773.1|1534384_1535203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335897.1|1535929_1536136_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	80.9	1.8e-10
1535207:1535223	attR	TATACCTTTAAGGTAAT	NA	NA	NA	NA
WP_000852414.1|1536150_1537830_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	8.0e-303
>prophage 7
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	1549368	1559661	5942969	tail,holin	Escherichia_phage(50.0%)	12	NA	NA
WP_001248457.1|1549368_1551843_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.0	0.0e+00
WP_001147904.1|1552038_1552335_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_001188253.1|1552366_1552624_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
WP_000218923.1|1552819_1555441_+|tail	tail fiber protein	tail	A0A193GYU1	Enterobacter_phage	70.1	4.3e-125
WP_000902802.1|1555577_1555940_-	GtrA family protein	NA	I1TED9	Salmonella_phage	80.8	2.2e-48
WP_001275997.1|1556088_1556481_+	membrane protein	NA	T1SA79	Salmonella_phage	96.9	2.5e-61
WP_000207023.1|1556477_1556786_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	97.0	1.1e-48
WP_000403808.1|1556775_1557405_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.0e-114
WP_001341613.1|1557401_1557884_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	88.1	3.6e-70
WP_000755170.1|1558103_1558643_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	94.4	8.1e-39
WP_000669403.1|1558658_1559174_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_001344399.1|1559487_1559661_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 8
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	1720982	1838985	5942969	tail,integrase,holin,transposase,lysis,terminase,bacteriocin,portal,capsid,head	Escherichia_phage(42.75%)	140	1775564:1775587	1837954:1837977
WP_000381395.1|1720982_1722554_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1722573_1722921_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1722920_1723598_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000100143.1|1724070_1725087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839828.1|1725730_1728091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160236.1|1729403_1729559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163428.1|1732278_1732479_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545713.1|1732536_1732704_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001368678.1|1732739_1733039_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000376716.1|1733196_1733475_-	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_000156090.1|1733474_1734062_-	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
WP_001375782.1|1734058_1734676_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
WP_000060377.1|1734679_1734868_-	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
WP_000052365.1|1734869_1735538_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
WP_000812180.1|1735534_1736122_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
WP_001111303.1|1736293_1736587_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_085948186.1|1737615_1738772_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000031004.1|1739527_1740133_-	ERF family protein	NA	O48415	Enterobacteria_phage	100.0	2.4e-108
WP_001243355.1|1740389_1740542_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1740526_1740661_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000776959.1|1740736_1741048_-	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
WP_000167585.1|1741191_1741662_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000382838.1|1741862_1742357_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_001430488.1|1742387_1742750_-	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
WP_012817806.1|1742752_1743025_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_000394868.1|1743458_1743755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092874.1|1743795_1744470_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	1.2e-103
WP_001054987.1|1744614_1744839_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_001375758.1|1744948_1745227_+	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
WP_000539347.1|1745410_1746232_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
WP_001248395.1|1746228_1747605_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
WP_000103674.1|1747691_1747907_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
WP_085948186.1|1748619_1749775_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_044164962.1|1749768_1749981_+	protein ninF	NA	A0A2D1GLV4	Escherichia_phage	100.0	7.6e-25
WP_001107956.1|1749973_1750579_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
WP_000144614.1|1750575_1750782_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271146.1|1750759_1751425_+	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
WP_001235461.1|1751421_1752045_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|1753117_1753441_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1753424_1753901_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000092296.1|1753897_1754335_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_001016387.1|1754540_1755059_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
WP_000999682.1|1755342_1755714_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_000807788.1|1755817_1756060_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000179910.1|1756139_1756565_+	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000200776.1|1756561_1757974_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000852339.1|1757976_1760103_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
WP_000426731.1|1760116_1761001_+	hypothetical protein	NA	Q716H1	Shigella_phage	98.6	3.4e-143
WP_001133481.1|1761012_1762284_+|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
WP_000375639.1|1762326_1762512_+	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_000246750.1|1762486_1762969_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_001122374.1|1762977_1764396_+	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000785546.1|1764395_1765244_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_000614047.1|1765243_1765699_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000964882.1|1765701_1766394_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246938.1|1766403_1767810_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_000868968.1|1767809_1769654_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.1	4.0e-239
WP_000749290.1|1769668_1770154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287055.1|1770224_1770491_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_001280420.1|1770612_1772736_+	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
WP_000440209.1|1772806_1773949_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_000958687.1|1774193_1775351_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
1775564:1775587	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_032274263.1|1775782_1776952_+|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	100.0	7.5e-231
WP_024174014.1|1776935_1777118_-	helix-turn-helix domain-containing protein	NA	G3CFG7	Escherichia_phage	100.0	4.1e-27
WP_000497812.1|1777178_1777430_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1777417_1777651_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_044164930.1|1777794_1778229_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	76.4	2.4e-49
WP_001291843.1|1778264_1778477_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1778436_1779063_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_044164933.1|1779059_1779491_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	99.3	2.1e-74
WP_000203834.1|1779546_1780185_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_032344420.1|1780508_1781237_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	7.9e-130
WP_032344418.1|1781332_1781956_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	96.6	3.6e-115
WP_000212746.1|1781959_1782247_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_106888384.1|1782248_1782518_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	89.4	2.5e-25
WP_001447495.1|1782555_1782744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032344417.1|1782748_1783450_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	99.6	3.9e-134
WP_032344415.1|1783446_1783686_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	98.7	8.0e-39
WP_001345192.1|1783879_1784758_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	99.7	3.8e-179
WP_032344414.1|1784865_1785309_-	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	97.3	2.3e-76
WP_000080417.1|1785385_1786207_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|1786270_1786618_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344636.1|1786692_1787280_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.5	2.0e-107
WP_000187063.1|1787279_1787969_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459721.1|1787965_1788916_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	100.0	1.1e-179
WP_000995345.1|1788932_1789214_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_024177061.1|1789234_1789456_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.6	3.2e-34
WP_000917252.1|1789527_1789740_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_106894353.1|1789810_1790596_-	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	92.3	5.7e-134
WP_001292087.1|1791213_1791594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000331648.1|1791593_1792064_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	41.6	5.4e-23
WP_025404424.1|1792244_1793198_-	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	97.8	3.6e-183
WP_000939555.1|1793194_1794664_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	97.1	2.7e-278
WP_000162431.1|1794759_1795479_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	68.6	3.1e-86
WP_000171145.1|1795584_1795824_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302923.1|1795986_1796181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1796347_1796725_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913119.1|1796718_1798239_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	100.0	6.4e-307
WP_001193567.1|1798228_1799200_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	100.0	1.4e-195
WP_000402092.1|1799199_1799649_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|1799656_1800220_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_044164955.1|1800216_1800411_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	98.4	1.4e-30
WP_001204859.1|1800403_1800838_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001304085.1|1801086_1801239_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_000649753.1|1801621_1802581_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1802592_1802862_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_106904141.1|1803359_1805297_+	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	99.4	0.0e+00
WP_000142777.1|1805433_1805613_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_044165587.1|1805653_1805899_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	97.5	5.7e-16
WP_000284506.1|1805976_1806192_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1806196_1806730_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1807000_1807570_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1807569_1807716_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816804.1|1807943_1808129_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001108577.1|1808367_1808919_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_001086067.1|1809211_1810006_+	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	96.3	4.1e-132
WP_000143988.1|1809986_1811693_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787035.1|1811692_1813837_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.9	0.0e+00
WP_000345011.1|1813994_1815002_+	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.7	3.0e-180
WP_000214474.1|1815025_1816240_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140444.1|1816294_1816684_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_001371266.1|1816733_1817195_+	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_000829202.1|1817178_1817742_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_000207922.1|1817741_1818392_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_012816803.1|1818388_1820326_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_001023407.1|1820327_1820597_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001303606.1|1820735_1820924_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146321.1|1821218_1822844_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_000197188.1|1822840_1824109_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_000455633.1|1824123_1824402_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001459282.1|1824407_1825025_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000836187.1|1825104_1825842_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_000078907.1|1826074_1826215_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035555.1|1826271_1826673_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000509019.1|1826766_1827420_+	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000455645.1|1827422_1827869_+	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000540391.1|1827879_1828131_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012437.1|1828141_1829407_+	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000331701.1|1829476_1837831_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	96.9	0.0e+00
WP_000368131.1|1838052_1838985_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1837954:1837977	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 9
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	1939973	2036820	5942969	tail,integrase,holin,transposase,protease,lysis,terminase,portal,head	Enterobacteria_phage(37.5%)	99	1948964:1948982	2024452:2024470
WP_000140570.1|1939973_1940876_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|1941069_1942260_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209922.1|1942256_1943516_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|1943505_1945134_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|1945406_1946765_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|1946769_1947846_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|1948308_1948959_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
1948964:1948982	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000135040.1|1949012_1949267_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|1949266_1950397_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_044163413.1|1950485_1952771_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001341569.1|1953466_1957201_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_032348523.1|1957328_1958051_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_001281242.1|1958197_1960825_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012302.1|1960973_1962662_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215756.1|1962658_1963264_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|1963278_1964349_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|1964326_1964545_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|1964650_1964995_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|1965113_1965356_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001345188.1|1965430_1965781_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_001289868.1|1965777_1966383_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_000763358.1|1966379_1966601_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001444000.1|1966699_1966981_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1966991_1967183_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1967155_1967338_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_085948186.1|1967790_1968947_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_032348838.1|1969003_1969282_-	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	100.0	2.2e-48
WP_000100831.1|1969278_1970064_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	5.3e-148
WP_000995439.1|1970069_1970366_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372926.1|1970420_1970585_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_001198860.1|1970553_1970718_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065385.1|1970790_1971159_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167595.1|1971308_1971779_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000930321.1|1971912_1972251_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000256573.1|1972253_1972559_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_001095982.1|1972873_1973524_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|1973604_1973790_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035947.1|1973899_1974196_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000185462.1|1974228_1975167_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000788878.1|1975163_1975865_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|1975861_1976152_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|1976224_1976431_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|1976438_1976885_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|1976881_1977409_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|1977405_1977588_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001429269.1|1978091_1979927_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|1980426_1980993_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|1980967_1981570_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|1981566_1982232_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|1982228_1982852_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|1983104_1983848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1983933_1984092_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|1984172_1984571_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1984713_1984929_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075153.1|1984928_1985426_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_001228695.1|1985642_1985825_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1985915_1986209_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|1986568_1986763_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000235436.1|1987157_1987667_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_024017589.1|1987638_1989567_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000258991.1|1989550_1989757_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_001430223.1|1989753_1991346_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_001254039.1|1991335_1992841_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256849.1|1992877_1993225_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_000522643.1|1993282_1994167_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000201528.1|1994218_1994593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|1994585_1994939_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|1994953_1995529_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|1995525_1995921_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|1995928_1996681_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|1996694_1997126_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533403.1|1997152_1997566_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082375.1|1997546_2000108_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000847413.1|2000104_2000434_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_001152619.1|2000433_2001132_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194778.1|2001137_2001881_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_000090884.1|2001817_2002450_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_032325348.1|2002510_2005810_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	94.9	0.0e+00
WP_000839179.1|2005838_2006243_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2006239_2006587_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|2006635_2008174_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001230644.1|2008236_2008452_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_001228241.1|2008519_2009119_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_069358370.1|2009183_2010497_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	3.7e-77
WP_001023397.1|2010498_2010768_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	3.2e-44
WP_001448330.1|2010976_2011624_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001676637.1|2014440_2018835_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|2018835_2020485_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|2020489_2021266_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000876014.1|2021540_2024390_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001061917.1|2024475_2025126_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2024452:2024470	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_001249127.1|2025142_2027815_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|2028553_2029645_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|2029756_2030812_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|2030885_2031950_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|2031949_2032600_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422231.1|2032675_2034319_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758074.1|2034536_2036183_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|2036331_2036820_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 10
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	2132514	2142442	5942969	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001240401.1|2132514_2133246_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2133467_2135153_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2135149_2135869_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|2135915_2136386_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000998019.1|2136817_2138203_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|2138252_2138600_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|2138596_2138977_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001342301.1|2139308_2141309_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|2141305_2142442_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 11
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	2233864	2240166	5942969		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116073.1|2233864_2235259_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
WP_000183038.1|2235433_2236327_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_000699427.1|2236698_2237784_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_001023633.1|2237783_2238683_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000857547.1|2238740_2239619_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001100797.1|2239623_2240166_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
>prophage 12
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	2273802	2279120	5942969	transposase	Stx2-converting_phage(50.0%)	9	NA	NA
WP_000692323.1|2273802_2274024_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186725.1|2274092_2274569_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849582.1|2274584_2275070_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234620.1|2275124_2275943_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_001119729.1|2276042_2276276_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000378676.1|2276354_2276786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839179.1|2276784_2277189_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2277185_2277533_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099148.1|2277581_2279120_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
>prophage 13
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	2398842	2435004	5942969	tail,integrase,holin,plate,terminase,portal,capsid,head	Enterobacteria_phage(87.18%)	46	2397780:2397839	2435111:2435231
2397780:2397839	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078921.1|2398842_2398983_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
WP_000488107.1|2399173_2399434_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|2399720_2400860_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000132847.1|2401259_2402360_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_000005439.1|2402517_2403702_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000290450.1|2403701_2404214_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|2404268_2404634_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|2404669_2404798_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000853455.1|2404784_2407592_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000979950.1|2407604_2408093_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000954196.1|2408249_2408822_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|2408865_2409444_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000108513.1|2409443_2411576_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000071738.1|2411578_2412109_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111967.1|2412101_2412998_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000213447.1|2413001_2413352_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|2413348_2413930_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000356339.1|2413926_2414562_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001342220.1|2414554_2415022_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000202151.1|2415045_2416923_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_000780555.1|2417061_2417469_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072343.1|2417465_2417858_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_001342221.1|2417854_2418178_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864911.1|2418180_2418381_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000063100.1|2418380_2418875_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632311.1|2418976_2419777_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_001055094.1|2419822_2420875_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262641.1|2420898_2421735_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_032348662.1|2421889_2423641_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087812.1|2423640_2424687_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001289969.1|2425176_2425767_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000211289.1|2425830_2426142_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|2426146_2427106_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_001272084.1|2427182_2430023_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.5	0.0e+00
WP_000564224.1|2430019_2430409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|2430732_2430936_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|2431022_2431136_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|2431132_2431375_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|2431386_2431665_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|2431675_2432026_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|2432047_2432251_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2432322_2432460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|2432549_2432954_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|2432969_2433620_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|2433649_2433997_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|2434002_2435004_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
2435111:2435231	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 14
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	2522446	2601844	5942969	tail,holin,tRNA,transposase,protease,lysis,portal,head	Escherichia_phage(34.48%)	89	NA	NA
WP_001443927.1|2522446_2522728_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|2522834_2523023_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2523015_2523210_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166317.1|2523266_2524076_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_000105101.1|2524068_2526720_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001307773.1|2526818_2527094_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_001427414.1|2527167_2527338_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560218.1|2527337_2527559_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427316.1|2527979_2528132_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_001303511.1|2528418_2528697_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2528698_2528890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|2528910_2529282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2529379_2529682_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2529678_2530104_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444941.1|2530126_2531089_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000450872.1|2531862_2532624_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_000603384.1|2532656_2532938_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2532934_2533162_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2533154_2533466_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2533593_2533812_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2533813_2534371_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2534604_2534817_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2534936_2535281_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2535402_2535675_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2535676_2536726_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217413.1|2536738_2537113_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|2537109_2537931_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_106904143.1|2539101_2540952_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000411802.1|2541399_2541606_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|2541605_2542103_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|2542099_2542537_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_001448382.1|2542686_2542839_+	hypothetical protein	NA	A0A0N7CFG9	Salmonella_phage	98.0	2.4e-20
WP_085948186.1|2542879_2544036_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_074432125.1|2544109_2544571_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	81.5	2.4e-63
WP_001307652.1|2544758_2544953_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|2545341_2545887_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000198153.1|2547783_2547990_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|2547986_2549588_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123251.1|2549568_2550888_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|2550897_2551230_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000158897.1|2552351_2552747_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|2552758_2553112_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975099.1|2553123_2553702_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000479086.1|2554865_2555297_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|2555323_2555737_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_032324121.1|2555717_2558297_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000847298.1|2558293_2558623_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001299882.1|2558622_2559321_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_001375575.1|2559326_2560070_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_096844540.1|2560015_2560648_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106904144.1|2560893_2564286_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	85.0	0.0e+00
WP_001230428.1|2564353_2564953_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000268926.1|2565017_2566331_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001023379.1|2566332_2566602_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000491545.1|2566742_2567618_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|2567842_2568493_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000812724.1|2569447_2570104_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|2570104_2570296_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|2570400_2570637_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|2570754_2572194_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|2572273_2574907_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|2574875_2576159_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|2576288_2576786_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|2576882_2577581_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001427396.1|2577600_2579649_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|2579840_2580722_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|2580767_2582141_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|2582317_2583109_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|2583251_2583491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|2583649_2583793_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|2583867_2584155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|2584823_2584967_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2584979_2585189_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|2585354_2586164_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|2586160_2586727_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|2587155_2587614_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|2587668_2588520_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|2588532_2589333_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|2589395_2590367_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|2590829_2592386_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001295494.1|2592389_2593988_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|2594118_2595483_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|2595666_2596245_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|2596248_2597610_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|2597683_2597863_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|2597982_2598342_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|2598704_2599049_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|2599180_2601091_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|2601148_2601844_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 15
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	2813624	2913510	5942969	tail,integrase,holin,transposase,protease,lysis,terminase,portal,capsid,head	Stx2-converting_phage(31.88%)	108	2807538:2807556	2912710:2912728
2807538:2807556	attL	CTTTCGCTTTTGCTGCTTT	NA	NA	NA	NA
WP_001260840.1|2813624_2814446_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2814545_2814629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2814721_2815057_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2815453_2816707_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|2816813_2817707_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2817841_2819062_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|2819186_2819882_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2819834_2821127_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2821285_2821900_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|2821942_2822797_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2822798_2823416_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|2823426_2825850_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_001307224.1|2828534_2828840_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2828947_2829658_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138576.1|2829660_2830221_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2830255_2830597_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2830731_2831058_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2831263_2832478_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2832489_2833509_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|2833566_2833677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877011.1|2833696_2834977_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	4.3e-155
WP_001339397.1|2835231_2835909_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2835908_2836256_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2836275_2837847_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000048369.1|2838042_2840514_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|2840607_2840799_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2840795_2840984_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000347171.1|2841470_2842046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2842047_2842203_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|2842395_2842803_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|2842880_2843108_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|2843091_2843613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054507.1|2843593_2844559_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_001151195.1|2844599_2845019_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000589012.1|2845052_2846393_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001317460.1|2846829_2847162_-	protein flxA	NA	NA	NA	NA	NA
WP_001326990.1|2847364_2847670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2847694_2847934_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2847933_2848221_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2848293_2848449_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_012817871.1|2848616_2848889_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_001369253.1|2848890_2849946_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	2.4e-87
WP_000140024.1|2849946_2850312_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640017.1|2850320_2850863_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000917767.1|2851094_2851292_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611215.1|2851442_2852492_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.7	3.4e-190
WP_001340026.1|2853290_2853422_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	7.0e-05
WP_000871291.1|2853702_2854038_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_069358388.1|2854297_2856151_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	97.6	0.0e+00
WP_000284518.1|2856300_2856516_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_021569237.1|2856520_2856865_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	4.2e-57
WP_000992033.1|2856915_2857449_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	8.1e-100
WP_032140280.1|2858003_2858090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2858311_2858497_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000828072.1|2858897_2859224_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_000095732.1|2859355_2859556_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_000279801.1|2859597_2859963_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	2.3e-61
WP_044162959.1|2860254_2860818_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	98.4	6.8e-89
WP_033800465.1|2860814_2862476_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_062854036.1|2862539_2864318_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	91.8	0.0e+00
WP_001063099.1|2864362_2864584_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267296.1|2864529_2867109_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125990.1|2867111_2867438_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2867447_2867798_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2867794_2868241_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2868237_2868582_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|2868648_2869365_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|2869379_2869754_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|2869849_2870059_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212980.1|2870106_2873349_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.0	0.0e+00
WP_000807940.1|2873341_2873683_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|2873682_2874381_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000194723.1|2874391_2875135_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_050439450.1|2875080_2875713_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_073976222.1|2876055_2878506_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.8	0.0e+00
WP_000839170.1|2878583_2878988_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_000612626.1|2878984_2879332_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|2879380_2880919_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000902073.1|2880941_2881991_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_001228278.1|2882058_2882658_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_106904145.1|2882809_2884123_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_000381395.1|2884155_2885727_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2885746_2886094_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2886093_2886771_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001023357.1|2886831_2887101_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_106409364.1|2891046_2891169_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2891275_2892187_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2892252_2892822_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|2893989_2894268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2894695_2894842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2894978_2895626_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2895809_2896400_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|2899162_2899381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079509.1|2899882_2900389_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2900434_2900935_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2901020_2901200_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|2901580_2902387_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|2902386_2903580_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001342102.1|2903591_2904950_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000763511.1|2904953_2906549_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194584.1|2906548_2908111_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2908202_2908247_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|2908384_2909266_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001342101.1|2909262_2909883_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|2909983_2910856_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|2910895_2911486_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|2911482_2912241_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|2912460_2913510_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
2912710:2912728	attR	AAAGCAGCAAAAGCGAAAG	NA	NA	NA	NA
>prophage 16
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	2990053	3046110	5942969	tail,integrase,holin,tRNA,transposase,lysis,portal,capsid,head	Escherichia_phage(42.42%)	68	2990173:2990187	3012448:3012462
WP_000628065.1|2990053_2991286_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2990173:2990187	attL	CGGTAAAACGTGGTA	NA	NA	NA	NA
WP_000387388.1|2991540_2992524_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|2993001_2994375_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2994503_2995439_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040851.1|2995490_2996726_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_000079604.1|2996727_2996943_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|2997042_2997231_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|2997268_2997418_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|2997473_2998283_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105150.1|2998275_3000876_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.0e-248
WP_000632297.1|3000977_3001253_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|3001327_3001498_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|3001497_3001719_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001427316.1|3002139_3002292_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000233320.1|3002590_3003010_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072343.1|3003089_3003344_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|3003340_3003763_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000788968.1|3004638_3005385_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450674.1|3005407_3006169_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001151124.1|3006184_3006607_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_001266134.1|3006603_3006900_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|3006896_3007358_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|3007335_3007692_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|3007742_3007955_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|3008040_3008205_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|3008206_3008470_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|3008480_3009350_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|3009465_3009570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|3009759_3009972_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341382.1|3010139_3010418_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265060.1|3010419_3011469_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	6.9e-111
WP_001217413.1|3011481_3011856_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|3011852_3012674_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
3012448:3012462	attR	CGGTAAAACGTGGTA	NA	NA	NA	NA
WP_000143049.1|3013844_3015695_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|3016142_3016349_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|3016348_3016846_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|3016842_3017280_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_001448382.1|3017429_3017582_+	hypothetical protein	NA	A0A0N7CFG9	Salmonella_phage	98.0	2.4e-20
WP_085948186.1|3017622_3018779_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_074432125.1|3018852_3019314_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	81.5	2.4e-63
WP_001307652.1|3019501_3019696_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|3020084_3020630_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000198153.1|3022526_3022733_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|3022729_3024331_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123251.1|3024311_3025631_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|3025640_3025973_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|3026028_3027054_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|3027095_3027491_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|3027502_3027856_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975099.1|3027867_3028446_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683137.1|3028442_3028838_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_032325228.1|3028845_3029598_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000479086.1|3029611_3030043_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|3030069_3030483_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_032324121.1|3030463_3033043_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000847298.1|3033039_3033369_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001299882.1|3033368_3034067_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_001375575.1|3034072_3034816_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_096844540.1|3034761_3035394_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106904144.1|3035639_3039032_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	85.0	0.0e+00
WP_001230428.1|3039099_3039699_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000268926.1|3039763_3041077_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001023379.1|3041078_3041348_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_001131657.1|3041460_3042036_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001443810.1|3042108_3042738_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|3042819_3043461_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|3044401_3044836_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|3044976_3046110_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 17
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	3191359	3424570	5942969	tail,integrase,holin,transposase,protease,lysis,terminase,plate,portal,capsid,head	Escherichia_phage(31.35%)	284	3193769:3193785	3425407:3425423
WP_085948178.1|3191359_3192572_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000520676.1|3192839_3193754_-	fimbrial protein	NA	NA	NA	NA	NA
3193769:3193785	attL	TTAAAAATTGATTTAAA	NA	NA	NA	NA
WP_000825452.1|3193812_3194316_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|3194328_3194859_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000123648.1|3194872_3197524_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195166.1|3197565_3198276_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001125458.1|3199227_3200550_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|3200549_3200816_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_000127325.1|3201038_3201518_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.7	1.7e-43
WP_000154339.1|3208414_3209368_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000911171.1|3211144_3212173_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|3212172_3213165_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|3213176_3214199_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774200.1|3214225_3215095_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_072097594.1|3215048_3215555_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001341531.1|3215558_3216473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854640.1|3216679_3218131_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558058.1|3218357_3219776_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|3219914_3220274_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|3220273_3221200_-	glutaminase B	NA	NA	NA	NA	NA
WP_001296740.1|3221263_3222652_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366496.1|3222752_3223634_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001323836.1|3223711_3224170_+	putative protein YneK	NA	NA	NA	NA	NA
WP_001341528.1|3224118_3224826_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|3224975_3226166_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|3226190_3226856_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|3227067_3227502_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|3227521_3227905_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|3227936_3228155_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|3228211_3229651_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_001022772.1|3229675_3231349_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|3231404_3231716_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001375402.1|3231743_3233066_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|3233180_3233492_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577179.1|3233690_3234389_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|3234433_3235333_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|3235527_3236715_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|3236841_3236937_+	protein MgtS	NA	NA	NA	NA	NA
WP_000671731.1|3239076_3239469_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024559.1|3239744_3240263_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001341522.1|3240307_3242353_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|3242489_3243236_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|3243324_3244011_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|3244188_3244392_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|3244427_3245888_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|3245976_3247260_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|3247862_3247976_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3248044_3248278_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|3248594_3249185_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|3249282_3249858_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001448491.1|3249857_3252818_-	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.1	4.0e-55
WP_001233114.1|3252882_3253482_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_044162558.1|3253552_3256966_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_000741589.1|3257026_3257674_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140707.1|3257571_3258315_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_001152371.1|3258319_3259018_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000447251.1|3259027_3259357_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_000372024.1|3259356_3262422_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3262393_3262723_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|3262731_3263118_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|3263178_3263922_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|3263932_3264334_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677126.1|3264330_3264909_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	97.9	2.0e-99
WP_001283148.1|3264920_3265196_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_001097041.1|3265188_3265512_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001136588.1|3265598_3267626_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985929.1|3267570_3269079_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|3269078_3269291_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507036.1|3269287_3271387_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_000421825.1|3271395_3271935_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_001031435.1|3272495_3272702_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000035577.1|3273002_3273413_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|3273564_3273738_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3273909_3274065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|3274144_3274210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|3274212_3274401_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3274411_3274624_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|3274986_3275484_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|3275480_3276014_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|3276010_3276322_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|3276326_3276542_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066483.1|3277295_3277511_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_000087756.1|3277811_3278024_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|3278078_3278168_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047133.1|3278445_3279198_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_001265198.1|3279211_3280261_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|3280262_3280541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|3280607_3280859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3281075_3281231_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|3281302_3281590_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|3281589_3281829_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|3281853_3282159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|3282361_3282694_+	protein flxA	NA	NA	NA	NA	NA
WP_000589012.1|3283130_3284471_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000156210.1|3285104_3286202_+	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_001204666.1|3286161_3286740_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_001002672.1|3287045_3287357_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_000004322.1|3287349_3287604_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001151209.1|3287600_3288023_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|3288063_3289026_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|3289048_3289474_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|3289470_3289686_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|3289735_3290452_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_001448352.1|3290724_3290880_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_001171923.1|3291039_3291258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394528.1|3291280_3291655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993340.1|3291640_3291787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3292187_3292376_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199473.1|3292372_3292561_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_044165005.1|3292656_3295128_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	1.0e-59
WP_000003742.1|3295189_3295459_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|3295427_3296546_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_001435497.1|3296954_3297119_-|tail	tail fiber assembly domain protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.2e-16
WP_001132151.1|3297335_3297926_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144080.1|3298109_3298760_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|3298834_3299893_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|3300020_3300656_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|3300723_3301305_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_085948186.1|3302035_3303191_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001063025.1|3304103_3304325_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_044165271.1|3304369_3306307_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.7	0.0e+00
WP_032323913.1|3306370_3308032_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|3308028_3308592_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279796.1|3308884_3309250_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001448509.1|3309291_3309516_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|3309596_3309911_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3310436_3310622_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|3310849_3310999_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056883.1|3310998_3311568_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000087714.1|3311842_3312376_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|3312380_3312596_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|3312673_3312919_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|3312959_3313139_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_000023293.1|3313274_3315212_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|3315689_3316121_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|3316570_3317284_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|3317418_3317616_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|3317857_3318388_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|3318396_3318756_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|3318768_3319815_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|3319816_3320089_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|3320224_3320482_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|3320487_3320787_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|3320991_3321336_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229296.1|3321332_3321698_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|3321699_3321918_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|3322005_3322641_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|3322806_3322989_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|3323022_3323235_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|3323285_3323642_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|3323619_3324081_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|3324077_3324374_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|3324370_3324763_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_000450641.1|3324778_3325504_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_072096947.1|3325537_3326080_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|3325991_3327002_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|3327088_3327526_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|3327522_3327783_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|3327909_3328302_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|3328348_3328708_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|3328710_3329013_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_024182289.1|3329426_3329627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|3329719_3329938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|3329941_3330106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3330506_3330695_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3330691_3330880_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048499.1|3330974_3333425_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|3333492_3333735_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3333712_3334732_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_095585410.1|3335014_3335167_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|3335543_3336905_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_044164404.1|3337359_3337665_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	6.8e-43
WP_000528251.1|3337753_3338491_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|3338444_3338645_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|3338759_3339224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|3339262_3339508_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|3339543_3339726_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|3339872_3341912_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|3342011_3342572_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|3342793_3342997_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|3343076_3343598_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|3343632_3344544_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|3344543_3345104_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|3345094_3346177_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|3346176_3346614_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|3346606_3347221_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|3347210_3348335_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|3348318_3349668_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113525.1|3349654_3351730_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|3351856_3352333_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|3352347_3352713_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|3352721_3354224_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|3354220_3354466_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|3354466_3355027_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|3355023_3355443_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001691380.1|3355439_3355832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|3355875_3356823_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850811.1|3356822_3357947_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_000094804.1|3358123_3358597_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|3358715_3360041_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|3360024_3361614_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|3361613_3363278_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_044165520.1|3363277_3363859_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	56.5	4.2e-49
WP_001279084.1|3363861_3364152_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|3364148_3364457_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|3364437_3364665_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|3364674_3364893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|3364876_3365305_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|3365339_3365840_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_001214362.1|3366405_3366915_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|3366911_3367208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|3367197_3367395_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|3367387_3367720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|3367758_3367944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|3367940_3368492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|3368495_3369011_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564280.1|3369010_3369544_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.8	2.8e-68
WP_000323222.1|3369547_3370090_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|3370187_3370718_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|3370729_3371023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|3371027_3371300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3371296_3371578_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|3371579_3371834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|3371846_3372068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|3372070_3373003_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|3373073_3375164_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|3375165_3375414_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|3375604_3376135_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000381395.1|3376430_3378002_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3378021_3378369_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3378368_3379046_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_032325383.1|3379101_3380415_-|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	98.2	2.2e-77
WP_001230428.1|3380479_3381079_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106904146.1|3381145_3384619_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.2	0.0e+00
WP_096844540.1|3384864_3385497_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_001429308.1|3385442_3386186_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_099356498.1|3386196_3386895_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.0	2.6e-130
WP_000807940.1|3386894_3387236_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106904147.1|3387228_3390471_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.8	0.0e+00
WP_001513217.1|3390518_3390728_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030040.1|3390823_3391198_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|3391203_3391920_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|3391985_3392330_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3392326_3392773_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3392769_3393120_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3393129_3393456_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|3395982_3396204_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|3396248_3398186_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_062890118.1|3398249_3399911_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_000958380.1|3399907_3400471_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829190.1|3400763_3401129_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_001428130.1|3401170_3401356_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_085948186.1|3401431_3402588_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000347013.1|3402752_3402893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3403249_3403474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3403538_3403745_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3403972_3404119_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056803.1|3404118_3404685_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.9e-103
WP_000992088.1|3404955_3405489_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_000731221.1|3405539_3405884_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|3405888_3406104_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000023141.1|3406253_3408107_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_001059384.1|3409629_3410319_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|3410315_3410681_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001448332.1|3410681_3411737_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	7.5e-89
WP_010917803.1|3411738_3412017_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3412086_3412344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|3412564_3412777_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|3413055_3413814_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3414512_3414677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|3415440_3415983_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000705622.1|3416905_3417457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3417440_3417668_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3417744_3418152_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3418416_3418716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3418788_3419007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3419029_3419437_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3419414_3419648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|3419641_3419809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|3420208_3420397_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|3420393_3420582_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048478.1|3420677_3423149_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3423213_3423462_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3423439_3424570_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
3425407:3425423	attR	TTTAAATCAATTTTTAA	NA	NA	NA	NA
>prophage 18
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	3718726	3901758	5942969	tail,integrase,holin,transposase,protease,terminase,portal,capsid,head	Enterobacteria_phage(32.86%)	211	3852479:3852538	3900833:3900897
WP_000998025.1|3718726_3720259_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	7.1e-298
WP_000233452.1|3721015_3723376_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|3723530_3724094_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|3724914_3726348_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3726566_3726764_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3726990_3727287_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282206.1|3728398_3730216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3730402_3731605_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_001297190.1|3732230_3732686_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001307105.1|3733497_3734421_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199164.1|3734904_3736176_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154411.1|3736181_3737309_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|3737366_3738197_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018496.1|3738862_3740371_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|3740529_3740739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341463.1|3740793_3744756_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001448446.1|3744795_3745434_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|3745721_3746813_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|3746812_3747505_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|3747516_3747903_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001341462.1|3747910_3748711_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001171.1|3748720_3749311_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|3749321_3749816_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|3749836_3751165_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|3751247_3751421_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_021520678.1|3752247_3752823_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.4	8.1e-21
WP_032348648.1|3753817_3754753_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032348649.1|3754749_3755040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021542951.1|3755359_3755650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032348651.1|3755649_3756036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032348652.1|3756173_3756497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044163363.1|3757060_3757771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072001722.1|3757794_3758001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044163366.1|3758142_3760296_+	tape measure protein	NA	A0A2I6PGW5	Salmonella_phage	30.5	6.3e-58
WP_032348654.1|3760452_3761241_+	hypothetical protein	NA	A0A0A0RK63	Escherichia_phage	77.2	3.2e-76
WP_032348656.1|3761237_3762881_-	recombinase family protein	NA	A0A142LP20	Marinitoga_camini_virus	24.3	5.0e-07
WP_000111568.1|3762932_3763538_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3763558_3763786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044313.1|3763823_3765065_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097601.1|3765356_3766616_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|3766875_3767796_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|3767795_3768101_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|3768193_3768793_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|3768789_3771336_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|3771335_3772508_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3772647_3773340_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|3773312_3774341_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001121564.1|3774812_3775466_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_001002867.1|3775478_3776177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131653.1|3776377_3776959_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_106420821.1|3776949_3777144_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767050.1|3777088_3777631_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023995.1|3777852_3778122_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000279017.1|3778123_3779437_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001230429.1|3779501_3780101_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_044165468.1|3780167_3783644_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.8	0.0e+00
WP_047085664.1|3783882_3784515_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.7	2.5e-103
WP_000194787.1|3784460_3785204_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_001368648.1|3785214_3785913_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000807964.1|3785912_3786254_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_050869705.1|3786246_3789489_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.3	0.0e+00
WP_001513217.1|3789536_3789746_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030040.1|3789841_3790216_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|3790221_3790938_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|3791004_3791349_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3791345_3791792_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3791788_3792139_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3792148_3792475_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|3795001_3795223_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|3795267_3797205_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_062890118.1|3797268_3798930_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_062854044.1|3798926_3799490_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	99.5	3.1e-89
WP_000829190.1|3799778_3800144_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000095741.1|3800185_3800386_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000828068.1|3800517_3800844_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_001109019.1|3801189_3801741_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_071529499.1|3801979_3802165_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001280922.1|3802387_3802519_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000661712.1|3802613_3803309_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000087733.1|3803582_3804116_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001072901.1|3804120_3804336_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290221.1|3804412_3804685_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	97.8	9.1e-23
WP_000143458.1|3804725_3804905_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_069358378.1|3805040_3806978_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.8	0.0e+00
WP_000752026.1|3807477_3807747_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3807756_3808704_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|3809210_3809645_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|3809637_3809832_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107963.1|3809828_3810434_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004024.1|3810433_3811156_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211425.1|3811230_3811965_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	99.6	9.4e-123
WP_001254256.1|3812239_3812422_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|3812418_3812946_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|3812942_3813389_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|3813345_3813582_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3813592_3813808_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|3813940_3814219_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|3814289_3814580_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_000788928.1|3814576_3815278_-	Replication protein P	NA	C1JJ58	Enterobacteria_phage	100.0	3.4e-130
WP_000185454.1|3815274_3816213_-	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000438541.1|3816245_3816542_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|3816680_3816908_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|3816986_3817694_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_000885203.1|3817754_3818096_+	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_001221211.1|3818163_3818625_+	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000957426.1|3818618_3819665_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_000198444.1|3820320_3820704_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000167595.1|3820762_3821233_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_001341800.1|3821484_3822345_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|3822369_3822501_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|3822485_3822638_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|3822894_3823500_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|3823499_3823883_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|3823906_3824200_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|3824210_3824375_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|3824371_3824929_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034232.1|3824925_3825483_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|3825484_3826102_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_012817743.1|3826098_3826401_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000002107.1|3826393_3826678_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545733.1|3826750_3826918_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|3826946_3827291_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|3827397_3827616_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_044165337.1|3827593_3828667_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.0e-197
WP_001444338.1|3828761_3831506_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|3831577_3832651_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3832698_3832872_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|3832861_3833092_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3833066_3833255_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3833265_3833478_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|3833763_3833976_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|3834417_3834723_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|3834829_3835474_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|3835470_3836217_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742348.1|3836216_3838313_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_044165345.1|3838358_3839498_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|3839485_3839932_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|3839951_3842132_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|3842246_3843545_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|3843624_3843717_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|3843729_3844866_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071527988.1|3844877_3846374_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|3846556_3847414_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063972.1|3847410_3847809_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|3847805_3848393_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|3848389_3849097_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|3849115_3850909_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|3850905_3852024_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
3852479:3852538	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_012817749.1|3853140_3853893_+	type III effector	NA	NA	NA	NA	NA
WP_001023445.1|3854017_3854287_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_032212660.1|3854288_3855602_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001216290.1|3855666_3856290_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_044163520.1|3856358_3859835_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.6	0.0e+00
WP_078326917.1|3860071_3860704_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.0	2.6e-97
WP_000194707.1|3860649_3861393_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|3861403_3862102_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|3862101_3862431_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081792.1|3862427_3865040_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000533442.1|3865020_3865434_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|3865460_3865883_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|3865896_3866649_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|3866656_3867052_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975098.1|3867048_3867627_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000752994.1|3867638_3867992_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|3868003_3868399_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|3868440_3869466_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|3869521_3869854_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|3869863_3871183_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|3871163_3872765_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|3872761_3872968_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000453587.1|3874864_3875410_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001300236.1|3875806_3876031_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|3876112_3876427_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3876954_3877140_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3877361_3877475_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003111.1|3877695_3878229_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000138558.1|3878388_3878661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|3878916_3879123_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874348.1|3879571_3881422_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000261909.1|3882189_3882903_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|3883040_3883238_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|3883524_3884343_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|3884494_3884866_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|3884855_3885227_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265133.1|3885239_3886289_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341388.1|3886290_3886569_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000018421.1|3886736_3886949_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|3887138_3887243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208016.1|3887358_3888228_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_000224233.1|3888238_3888502_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000209148.1|3888503_3888722_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000935423.1|3888754_3888967_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_001151235.1|3889072_3889495_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_032324560.1|3889510_3890281_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.5	2.5e-86
WP_021498074.1|3890306_3891047_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001205820.1|3891053_3892169_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	2.2e-131
WP_000273724.1|3892247_3892703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3892909_3893335_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3893318_3893591_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3893699_3894101_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3894128_3894320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3894319_3894607_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379552.1|3894883_3895036_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_000394543.1|3895047_3895686_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_001133037.1|3895686_3895896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3896463_3896652_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3896648_3896840_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_009448824.1|3896933_3899384_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|3899451_3899694_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3899671_3900691_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375138.1|3901098_3901758_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
3900833:3900897	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 19
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	4097765	4178513	5942969	tail,integrase,holin,transposase,protease,lysis,terminase,portal,head	Enterobacteria_phage(47.06%)	99	4098891:4098925	4179947:4179981
WP_000399648.1|4097765_4098746_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
4098891:4098925	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001145128.1|4099005_4099488_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001218655.1|4099607_4101758_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_000386551.1|4101785_4102748_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443534.1|4102888_4103974_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000007094.1|4104204_4105569_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|4105797_4106469_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|4106471_4107467_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|4107459_4109196_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|4109188_4110322_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|4110332_4111439_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|4111400_4111811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113363.1|4111943_4112705_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|4112701_4113943_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045454.1|4113942_4114899_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446932.1|4114934_4115648_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|4115852_4116557_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|4116693_4117146_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|4117147_4117393_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|4117385_4117871_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|4117873_4118386_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|4118407_4119397_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|4119793_4120702_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|4120893_4122915_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|4123493_4124171_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|4124163_4124919_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|4124905_4126060_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|4126056_4127097_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|4127183_4128473_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|4128531_4129008_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|4129511_4130165_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|4130177_4130399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|4130482_4130863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448642.1|4131063_4131639_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001339397.1|4131699_4132377_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4132376_4132724_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4132743_4134315_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_021351651.1|4134789_4135161_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652081.1|4135284_4136112_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_000950982.1|4136335_4137217_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|4137322_4137592_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000268998.1|4137593_4138808_-	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001230449.1|4138872_4139472_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_106904148.1|4139539_4143016_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_096844540.1|4143261_4143894_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_001375575.1|4143839_4144583_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	2.5e-147
WP_044165811.1|4144588_4145287_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	8.9e-131
WP_000847304.1|4145286_4145616_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|4145612_4148192_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|4148172_4148586_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|4148612_4149044_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_069358395.1|4149057_4149810_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	4.9e-127
WP_032284507.1|4149817_4150186_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_000099160.1|4150182_4151721_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|4151769_4152117_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|4152113_4152518_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_001254029.1|4152595_4152772_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_001432013.1|4152761_4154354_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_000259002.1|4154350_4154557_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106904149.1|4154540_4156469_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	1.0e-261
WP_000235451.1|4156440_4156950_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_001307652.1|4157345_4157540_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|4157727_4158345_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|4158494_4158932_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|4158928_4159426_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|4159425_4159632_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000499454.1|4162242_4162401_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|4162486_4163230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|4163414_4164104_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|4164118_4164241_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|4164579_4165539_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|4165750_4165939_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|4165935_4166298_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|4166294_4166585_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|4166584_4167307_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|4167299_4167509_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_000924601.1|4167468_4167870_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|4167872_4168049_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|4168045_4168456_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|4168427_4168784_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000145926.1|4169080_4169371_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_001202479.1|4169367_4169580_-	hypothetical protein	NA	O48422	Enterobacteria_phage	100.0	3.5e-30
WP_085948186.1|4169666_4170822_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001341800.1|4171333_4172194_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|4172218_4172350_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|4172334_4172487_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|4172743_4173349_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|4173348_4173732_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|4173755_4174049_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|4174059_4174224_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|4174220_4174778_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034232.1|4174774_4175332_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|4175333_4175951_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_012817743.1|4175947_4176250_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000002107.1|4176242_4176527_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545733.1|4176599_4176767_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|4176795_4177140_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|4177246_4177465_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|4177442_4178513_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
4179947:4179981	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 20
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	4398144	4456650	5942969	tail,integrase,transposase,protease,lysis,terminase,portal,capsid,head	Enterobacteria_phage(59.65%)	71	4406625:4406671	4456664:4456710
WP_000420938.1|4398144_4399281_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383941.1|4399549_4401787_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001375368.1|4401773_4404746_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|4404746_4405637_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|4405819_4406581_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4406625:4406671	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|4407093_4408047_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|4408233_4409718_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|4409901_4410207_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|4410263_4410932_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885569.1|4410986_4411571_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000279150.1|4411570_4414531_-	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_001230523.1|4414595_4415195_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_077758966.1|4415265_4418328_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_000090884.1|4418592_4419225_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152557.1|4419910_4420609_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000847347.1|4420608_4420938_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|4420934_4423496_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|4423488_4423923_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|4423904_4424327_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|4424342_4425083_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|4425090_4425486_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|4425482_4426061_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|4426051_4426426_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|4426437_4426833_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|4426874_4427900_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|4427955_4428288_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000088640.1|4428297_4429176_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001339397.1|4429216_4429894_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4429893_4430241_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4430260_4431832_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001444138.1|4432304_4433906_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000198149.1|4433902_4434109_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027295.1|4434105_4436031_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453558.1|4436005_4436551_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001427981.1|4436939_4437134_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_085948178.1|4437251_4438464_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_157825797.1|4438430_4438598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738423.1|4438805_4439099_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4439189_4439372_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135274.1|4439588_4440086_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|4440085_4440301_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737278.1|4440889_4441972_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_001204791.1|4442160_4442544_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|4442629_4442770_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|4442766_4443129_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|4443125_4443416_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|4443408_4443579_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|4443578_4444034_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|4444030_4444132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|4444255_4444657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|4444635_4445052_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|4445351_4445960_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|4446712_4447060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788789.1|4447264_4447966_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_001342088.1|4447962_4448892_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_001182773.1|4448978_4449518_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|4449587_4449818_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|4449922_4450612_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000066829.1|4450693_4450957_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|4451092_4451413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206913.1|4451879_4452170_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_000995439.1|4452245_4452542_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|4452547_4453333_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|4453329_4454010_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|4454006_4454189_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|4454161_4454353_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|4454363_4454645_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763390.1|4454743_4454962_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|4455009_4455288_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|4455259_4455631_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|4455486_4456650_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
4456664:4456710	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 21
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	4740805	4757200	5942969	integrase,transposase	Sodalis_phage(15.38%)	18	4734695:4734708	4756334:4756347
4734695:4734708	attL	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_000246961.1|4740805_4742227_-	DNA transfer protein	NA	B6SCW4	Bacteriophage	53.0	2.8e-123
WP_000909176.1|4742226_4742904_-	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
WP_032312028.1|4742897_4743359_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.2e-61
WP_001719727.1|4744130_4746887_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	8.9e-299
WP_001208878.1|4746873_4747245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628967.1|4747237_4747579_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001058740.1|4747589_4748192_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.6e-25
WP_000181940.1|4748184_4748406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032341460.1|4748402_4748666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065741.1|4748662_4748857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032348625.1|4748849_4749917_-	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	8.9e-13
WP_000476150.1|4749910_4750093_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032312024.1|4750085_4750919_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000412538.1|4750931_4751363_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_085948186.1|4751540_4752696_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_016234638.1|4753261_4754476_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	8.3e-132
WP_000893255.1|4754831_4756085_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|4756096_4757200_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
4756334:4756347	attR	AAGAATGGCGGCAG	NA	NA	NA	NA
>prophage 22
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	5207756	5271274	5942969	tRNA,integrase,transposase	Stx2-converting_phage(46.15%)	60	5230316:5230331	5262456:5262471
WP_000099160.1|5207756_5209295_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|5209343_5209691_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|5209687_5210092_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_077221339.1|5210541_5210820_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001344112.1|5211453_5211630_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001339397.1|5211697_5212375_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5212374_5212722_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5212741_5214313_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001185332.1|5214622_5214895_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000991130.1|5214896_5215451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214377.1|5215447_5216200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001084853.1|5217114_5217375_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000761643.1|5217371_5217920_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001014979.1|5217919_5218144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000842358.1|5218140_5218464_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016235.1|5218478_5220812_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000594911.1|5221717_5222542_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|5222590_5223163_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000177060.1|5224516_5224774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|5225331_5226099_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|5226099_5227056_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125183.1|5227052_5228051_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|5228047_5228950_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|5228994_5231319_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
5230316:5230331	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|5231405_5232359_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|5232355_5232877_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|5234627_5234885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|5235617_5236976_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|5237214_5238600_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|5238649_5238997_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|5238993_5239374_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|5239728_5240163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|5240150_5240552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|5240717_5241287_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|5242026_5243598_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5243617_5243965_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5243964_5244642_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000091133.1|5244931_5246518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356577.1|5246656_5247496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772685.1|5247739_5249002_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000061768.1|5249445_5250465_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001332879.1|5250594_5252097_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_001295681.1|5252215_5253298_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584109.1|5253297_5254398_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|5254664_5256176_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786398.1|5256529_5256973_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|5256972_5259828_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001059398.1|5261270_5261774_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|5261819_5262236_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012897.1|5262397_5263411_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
5262456:5262471	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
WP_001074121.1|5263595_5265107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000583470.1|5265229_5265682_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256681.1|5265826_5266420_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500687.1|5266490_5267204_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230273.1|5267334_5267730_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|5268010_5268145_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|5268148_5269084_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|5269096_5269558_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|5269630_5270017_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000399648.1|5270293_5271274_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP027599	Escherichia coli strain 97-3250 chromosome, complete genome	5942969	5330588	5388883	5942969	protease,transposase,integrase,tRNA	Vibrio_phage(15.38%)	57	5356091:5356105	5388152:5388166
WP_000811566.1|5330588_5330864_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|5330980_5332606_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|5332689_5333853_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|5333855_5334494_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5334503_5334902_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|5334919_5335579_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|5335629_5336328_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|5336346_5336748_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5336874_5337606_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|5337785_5340227_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|5340265_5340691_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5340895_5342194_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5342297_5342495_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5342576_5343581_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5343583_5344843_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460361.1|5344928_5346209_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|5346285_5346594_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|5346679_5347630_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|5347622_5349470_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|5349479_5350817_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|5350835_5351297_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|5351268_5352816_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294203.1|5352814_5353954_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_100699686.1|5353936_5353990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|5354853_5355399_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|5355493_5356546_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
5356091:5356105	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934920.1|5356642_5357611_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|5357632_5360956_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|5360984_5361299_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|5361295_5361610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|5361661_5363164_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|5363382_5364360_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|5364684_5366493_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|5366485_5367220_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|5367230_5367626_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|5367636_5367996_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|5368058_5369192_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|5369280_5369814_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|5369810_5370128_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|5370309_5370456_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|5370566_5370692_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|5370743_5371310_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|5371351_5372380_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|5372769_5373639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399685.1|5373887_5374868_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|5375120_5375474_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|5375611_5377258_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|5377301_5377595_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|5377870_5379127_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|5379142_5379619_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|5379955_5381392_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|5381509_5382811_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883338.1|5382926_5383265_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|5383240_5384938_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|5384974_5385550_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|5385929_5387195_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_032325301.1|5387311_5388883_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	2.2e-294
5388152:5388166	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
>prophage 1
NZ_CP027600	Escherichia coli strain 97-3250 plasmid unnamed1, complete sequence	120604	58629	96160	120604	integrase,transposase	Escherichia_phage(30.0%)	34	81647:81676	100881:100910
WP_000486835.1|58629_59799_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	43.3	5.5e-48
WP_001168072.1|60413_61778_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	K7P7Q7	Enterobacteria_phage	39.6	1.1e-23
WP_000478596.1|61782_62418_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_000870986.1|62436_62910_-	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	36.3	2.9e-08
WP_001011156.1|62963_63500_-	cleavage protein	NA	NA	NA	NA	NA
WP_000670135.1|63573_64674_-	type II secretion protein F	NA	NA	NA	NA	NA
WP_000886638.1|64675_66184_-	Flp pilus assembly complex ATPase component	NA	NA	NA	NA	NA
WP_001112926.1|66268_66721_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000129889.1|66710_68006_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_001034998.1|68026_69646_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_000539685.1|69676_70114_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001170192.1|70118_71189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174020.1|71345_71681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330559.1|71797_72115_-	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_000482663.1|72120_73815_-	flotillin family protein	NA	NA	NA	NA	NA
WP_000176497.1|73841_74462_-	YqiJ family protein	NA	NA	NA	NA	NA
WP_000154143.1|74728_75394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335846.1|75534_76176_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_032144930.1|76887_77751_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001139207.1|78699_78951_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000222775.1|78947_79235_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	1.7e-19
WP_044162833.1|79493_79790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000517694.1|80441_81044_-	hypothetical protein	NA	NA	NA	NA	NA
81647:81676	attL	CTCAGAAAACGGAAAATAAAGCACGCTAAG	NA	NA	NA	NA
WP_001067855.1|84392_85097_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|85681_86542_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|86691_87093_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|87139_87844_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|88033_88849_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_009447875.1|89743_90511_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_001082319.1|90510_91314_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043265.1|91374_92190_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_000240536.1|92497_93349_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|94104_94809_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|94855_96160_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
100881:100910	attR	CTTAGCGTGCTTTATTTTCCGTTTTCTGAG	NA	NA	NA	NA
>prophage 1
NZ_CP027601	Escherichia coli strain 97-3250 plasmid unnamed2	92590	2867	67167	92590	protease,integrase,transposase	Stx2-converting_phage(45.83%)	56	38727:38786	67713:69544
WP_001034100.1|2867_6770_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_000112000.1|7017_7275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136138333.1|7573_7987_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_085953672.1|7985_9198_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_000381395.1|9650_11222_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|11241_11589_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|11588_12266_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000991402.1|13214_15935_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001291056.1|15946_16279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157095.1|16510_16846_+	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001341408.1|16931_17780_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_106889346.1|18020_18299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|18357_18609_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032348834.1|18639_19539_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	45.0	9.9e-66
WP_001247865.1|19603_19870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218854.1|19962_20397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117628.1|21124_21625_-	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_032313270.1|22086_22404_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_001276261.1|22680_23400_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001341455.1|23396_23879_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000274418.1|23923_24358_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001443814.1|24369_24588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086167.1|24587_25271_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_077249722.1|25654_26557_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000921957.1|26829_27789_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_000445934.1|27788_28184_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001172748.1|29144_29534_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|29577_31788_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_086163899.1|31896_31995_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
WP_085953785.1|31960_33174_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_000361610.1|33979_34957_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001341442.1|35119_35347_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_001341423.1|35400_36075_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|36071_36419_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|36422_37991_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
38727:38786	attL	CGAGTAGGCAGCCTGGCGGCTGCGGCTTGTCATGGCCTGAAATTACCGTTATAAAAACAG	NA	NA	NA	NA
WP_000091308.1|38814_39180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937603.1|39179_40367_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_012917687.1|40645_42214_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|42217_42565_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|42561_43236_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001066949.1|43289_43676_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000704534.1|43803_44664_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_085948186.1|45468_46625_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001165114.1|46692_47238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044768.1|47399_47816_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|47812_48043_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000465041.1|48602_49016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164205.1|49017_49800_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000864810.1|49971_50325_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000987096.1|52179_54300_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_000217745.1|54349_57346_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_001302199.1|60510_61332_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|61331_62438_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|62531_64253_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_012680945.1|64326_65325_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_012917688.1|65628_67167_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
67713:69544	attR	CGAGTAGGCAGCCTGGCGGCTGCGGCTTGTCATGGCCTGAAATTACCGTTATAAAAACAGACAATATCATTGTCTTTCAGGTAGTTATATGTCCCGTTCAGCTAAACCCCGTAAACGAAAACCTGCCCCTCAAAGAAGCAAACTTCCCCGCTATGTCGTGAAGCTTCACGACGATGACTTCTTTGACGAAGAAGACGCAGAAGCTCTGCGCTTTGATAATTTTGACGATGCCGTTGAGTGCTGCGCAGACCTGAATATTCCCTTCTTTGTGGATGCCGGAAACAAAAAGCTGGTCTTCTGGTTTGTACGTGTTGATGACGAAGGGTATCCTGAAATAGCCCGCTGCACGGAGCGGGAGTTTGCGACCATTCTTGCCGGTATCAGCGCCGGCGGCATGTACTGCCCGGAGTGTGGCACGGTTCACTGGCCGGACGGAGTCCCCCCGCCCTTCTGATGCTTCCCCGTTTTGCCGACATTTTTCAGCAGGGAAACCGCTGGCTTAACTGGCTGGAGAAACAACCGGAAGGTTCAGTGCGTCCGGTAGTCATTGAGTCTGTGACAAAAATCATGGCCTGCGGGACCACGCTGATGGGGTACACACAGTGGTGCTGTTCATCTCCGGACTGCAGCCACATAAAAAAGGTCTGCTTCCGGTGTAAAAGTCGCTCCTGCCCGCACTGCGGAGTGAAGGCTGGCGCACAGTGGATACAGTATCTGCTGAGTCTGGTTCCCGACTGTCCGTGGCAGCATATTGTGTTCACACTTCCCTGCCAGTACTGGTCCCTGGTGTTCCACAACCGGAGGTTACTGGCAGAGATGAGCCGCATTGCTGCGGATGTGATACAGGAAATCTGCCGCCAGGCAGATGTGGTGCCGGGGATATTCACGGTGATCCACACATGGGGACGTGACCAGGAGTGGCATCCGCACATTCACCTGTCGACAACGACCGGCGGCGTGACATCAGACCACACCTGGAAAAACCTTCATTTTTACGCCCGTAAGGTGATGAGTATGTGGCGTTACCGGATAACGCGGTTACTGTCACGGAAATATCCGGACCTGGTGATACCGGATGCGCTGGCAGCAGAAGGAAGCAGTAAACGGGACTGGAATCGCTTCCTGGACAGTCATTACCGGCGGGGCTGGAATGTCAACGTATCCCGGGTGATGGATAACGCCACACATGTGGCGGTGTACTTCGGCTCTTACCTGAAAAAACCGCCGGTGCCGATGAGCCGTCTGGAGCACTATGCTGGTCAGGATGAAATTGGTCTGCGTTACAACAGTCACCGGACAAAACGGGAAGAATACCTGGTGATGAGTGGTGATGAGTTTATGGAAAGGTTCTCCTGGCATGTGGCGGATAAGGGGTTCCGTATGGTGAGGTACTACGGTTTCCTGAGTCCGGTGAAGCGCCGGTTACTGGAAGATGTTGTGTACGTCATAACGGAGACGGTGAGAAAGACGGCGATGCAAATCAGGTGGAGAGGGATGTATCAGCGGTTACTGAAGGTTGACCCGCTGAAGTGCATCCTGTGCGGAGGTCAGATGCGTTTTACGGGGCTGAAGCGGGGCTACCGTCTGACAGAGCTGGTCCTGATGCATGAGCCACTGGCGCAACAGCGGGTGTGTGGCTGAGAGCCGCATCGGAGAAGTTGCGTCCATTTTCAGGGGAATGGGGTAAAAAACCATCAGTGATATGCAGTATCAATCGATAAGATCCATTTAATTGACGGCGGTGCACTCATGGCACGCAGGCAGTGTTGAATAAACATCCGTTTTTGGGTGTTTTTTTAATCTTTTTGGGATTTAAATTCCTATCGATCGAG	NA	NA	NA	NA
