The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	206566	299640	5235560	terminase,tRNA,holin,protease,head,transposase,tail	Escherichia_phage(40.74%)	77	NA	NA
WP_106878426.1|206566_207779_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	4.2e-168
WP_000801831.1|207782_208646_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	25.1	3.8e-14
WP_000671574.1|208797_210102_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_000546255.1|210234_211911_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_001251615.1|212148_213369_-	MFS transporter	NA	NA	NA	NA	NA
WP_000771748.1|213586_215239_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000186631.1|215275_215755_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_000365182.1|215958_216753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097453360.1|216890_217232_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	5.1e-39
WP_097453359.1|217446_219951_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	2.5e-114
WP_000883019.1|220212_221145_+	glutaminase A	NA	NA	NA	NA	NA
WP_000970323.1|222970_223429_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000904502.1|223425_224343_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_001157535.1|224488_225166_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
WP_001295323.1|225152_225932_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_001295322.1|225994_226849_-	chaperedoxin	NA	NA	NA	NA	NA
WP_000148941.1|226909_227719_-	NADP(+)-dependent aldehyde reductase	NA	NA	NA	NA	NA
WP_001295836.1|227708_228332_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|228302_228989_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001529777.1|235992_236253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157976.1|237484_238579_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|238647_239574_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_057711557.1|239803_240286_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141276.1|240363_241179_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_000943556.1|243062_243839_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|243938_244817_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401133.1|244985_246440_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_001298987.1|247916_249218_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001364619.1|249239_250385_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.7	1.8e-48
WP_000540996.1|250513_251299_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001364598.1|251309_252545_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_097453329.1|252566_253616_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580862.1|253932_255600_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495366.1|255609_256869_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001364634.1|256879_257695_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855368.1|257691_258585_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815513.1|258721_259789_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|259785_260295_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|260412_261135_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|261137_261632_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|261805_263191_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|263226_263748_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|263855_264068_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|264069_264936_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|265416_265959_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|266178_266871_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_057728694.1|266901_269511_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_097453328.1|269523_270531_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|270541_271057_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000379505.1|271059_271668_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_106878427.1|271710_272924_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	1.4e-168
WP_106878428.1|273777_274990_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	98.3	2.3e-166
WP_001235472.1|275092_275716_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_122997108.1|275968_276712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|276797_276956_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_033816266.1|277036_277435_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284515.1|277577_277793_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135298.1|277792_278290_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	3.8e-91
WP_072169954.1|278274_278397_+	peptidase	NA	A0A1B5FPA1	Escherichia_phage	97.2	5.5e-12
WP_106878430.1|278436_279650_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	97.3	2.2e-164
WP_032351275.1|279712_279913_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	98.5	1.4e-28
WP_000198149.1|279909_280116_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_052611334.1|280959_281229_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.7	2.7e-35
WP_000938125.1|281683_283045_-	hypothetical protein	NA	Q9MBM1	Phage_Gifsy-1	30.1	4.5e-54
WP_096847421.1|283421_283571_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	85.4	1.3e-15
WP_122995715.1|283625_284294_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937501.1|284350_284656_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000998050.1|284735_286274_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|286323_286671_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_105596447.1|286667_287048_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_106878431.1|288175_289376_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	96.3	1.3e-161
WP_001201826.1|289735_290689_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177473.1|291201_291963_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224612.1|292145_293036_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662335.1|293036_296009_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383946.1|295995_298233_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_032316755.1|298503_299640_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	517211	569122	5235560	terminase,holin,head,lysis,transposase,tail,integrase,capsid	Enterobacteria_phage(45.59%)	70	506170:506184	566395:566409
506170:506184	attL	TCACGTTACCGCTGA	NA	NA	NA	NA
WP_000533642.1|517211_518282_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_061360007.1|518259_518478_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	8.3e-35
WP_001303965.1|518568_518868_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000002094.1|518939_519224_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	91.5	2.3e-45
WP_000207907.1|519216_519765_-	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	55.7	1.4e-49
WP_024177819.1|519766_520363_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	65.4	1.5e-62
WP_071532516.1|520349_520583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000812199.1|520579_521080_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	92.7	1.5e-58
WP_001214456.1|521076_521241_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_000855559.1|521237_521528_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	97.9	1.2e-44
WP_001111281.1|521538_521835_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	8.6e-51
WP_106878430.1|522225_523438_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	97.3	2.2e-164
WP_000168274.1|523721_524228_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_000365280.1|524228_524936_-	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_001243355.1|525190_525343_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|525327_525462_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_106878437.1|525537_525906_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_032216306.1|526056_526527_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	9.1e-87
WP_072169526.1|526535_526913_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	1.8e-53
WP_000957426.1|527510_528557_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|528550_529012_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_029793531.1|529079_529421_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	2.8e-61
WP_001274756.1|529430_530144_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|530244_530445_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251073.1|530563_530857_+	hypothetical protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_001244621.1|530879_531152_+	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_023568659.1|531214_532102_+	hypothetical protein	NA	A5VW95	Enterobacteria_phage	92.9	1.8e-144
WP_106878438.1|532098_533001_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.3	5.7e-154
WP_106878439.1|533003_534217_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.0	5.7e-165
WP_106878440.1|534218_534788_+	LysR family transcriptional regulator	NA	G9L681	Escherichia_phage	98.3	2.1e-90
WP_000818844.1|534860_535067_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	94.1	1.1e-25
WP_000344560.1|535084_535348_+	hypothetical protein	NA	Q716C8	Shigella_phage	60.8	1.2e-24
WP_016238076.1|535495_535936_+	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	99.3	1.7e-79
WP_000153270.1|535932_536460_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254256.1|536456_536639_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211430.1|536917_537598_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	88.9	8.2e-121
WP_001004008.1|537672_538395_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_001107998.1|538394_539000_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144758.1|538996_539191_+	protein ninH	NA	Q777W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|539183_539618_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_001365506.1|540124_541072_+	Shiga toxin Stx1a subunit A	NA	Q6LDT4	Enterobacteria_phage	100.0	5.4e-171
WP_000752026.1|541081_541351_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_106878441.1|541850_543701_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.4	0.0e+00
WP_000411811.1|544146_544353_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|544357_544702_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992161.1|544752_545286_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	9.6e-101
WP_001082547.1|545583_546078_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
WP_000736096.1|546074_546299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074667.1|546667_546895_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_000279815.1|546936_547302_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	8.4e-64
WP_000958380.1|547592_548156_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001365116.1|548152_549814_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.8	0.0e+00
WP_000173076.1|549877_551815_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001063096.1|551859_552081_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|554607_554934_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|554943_555294_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|555290_555737_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|555733_556078_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|556143_556860_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030063.1|556865_557240_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|557335_557545_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_057711751.1|557596_560839_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.8	0.0e+00
WP_000807964.1|560831_561173_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001357740.1|561172_561871_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_106878442.1|561876_562620_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_122995720.1|562565_563198_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	3.8e-96
WP_158707939.1|564398_566906_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	98.1	0.0e+00
566395:566409	attR	TCAGCGGTAACGTGA	NA	NA	NA	NA
WP_001230489.1|566972_567572_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_106878443.1|567636_568851_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	95.0	3.6e-79
WP_001023455.1|568852_569122_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
>prophage 3
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	697146	793663	5235560	terminase,tRNA,plate,portal,holin,protease,head,lysis,tail,integrase,capsid	Escherichia_phage(43.1%)	89	722901:722922	734913:734934
WP_000520781.1|697146_697467_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|697497_699774_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|700518_700737_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|701021_701726_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|701767_703489_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043619.1|703489_705256_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|705378_706344_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|706888_707383_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_057728492.1|707517_711585_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|711739_712351_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067756.1|712361_713705_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_000886683.1|713795_715088_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|715326_717771_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|717781_718399_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534667.1|718400_719264_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165878.1|719298_719925_-	hydrolase	NA	NA	NA	NA	NA
WP_000109295.1|720238_721387_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918511.1|721596_723027_+	amino acid permease	NA	NA	NA	NA	NA
722901:722922	attL	CCCGAAAATGGAAGCATTCACC	NA	NA	NA	NA
WP_001242678.1|723027_723936_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190367.1|724035_724626_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000067979.1|724707_725505_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023392.1|725536_726532_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.4	1.3e-188
WP_000072552.1|726625_726937_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|727041_727398_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000217684.1|727575_728076_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	3.8e-91
WP_000557709.1|728139_728352_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	92.9	8.6e-29
WP_000185625.1|728366_728612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789771.1|728608_728899_+	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	80.6	1.2e-33
WP_001113264.1|728898_729123_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027662.1|729119_729395_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	100.0	3.8e-45
WP_057728493.1|729384_731667_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.1	0.0e+00
WP_057711473.1|731786_733619_+	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.1	5.3e-90
WP_097453176.1|733958_734993_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	2.3e-199
734913:734934	attR	GGTGAATGCTTCCATTTTCGGG	NA	NA	NA	NA
WP_000156842.1|734992_736765_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.5	0.0e+00
WP_097453178.1|736938_737793_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	99.6	4.9e-139
WP_001248553.1|737851_738925_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	6.7e-202
WP_000203439.1|738928_739672_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_000988633.1|739771_740281_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|740280_740484_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|740487_740769_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|740768_741266_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736559.1|741280_741706_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	94.3	9.8e-56
WP_000040632.1|741693_742119_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	3.0e-65
WP_072148149.1|742090_742264_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	89.5	1.7e-22
WP_000917186.1|742226_742694_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_001001767.1|742686_743139_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
WP_001093733.1|743205_743841_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	3.8e-112
WP_000127163.1|743837_744185_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121507.1|744189_745098_+|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.7	3.4e-162
WP_001285338.1|745090_745702_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	6.4e-117
WP_057728357.1|745698_746982_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	64.1	2.5e-155
WP_000805547.1|746981_747575_+|tail	tail assembly protein	tail	K7P870	Enterobacteria_phage	64.5	4.1e-60
WP_042111306.1|747546_747951_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	77.8	1.1e-48
WP_000905098.1|748390_748984_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	3.2e-105
WP_097453179.1|749043_750234_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	98.5	4.9e-222
WP_001251408.1|750246_750765_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|750821_751097_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|751129_751249_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069978.1|751241_753689_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.6	0.0e+00
WP_000978896.1|753703_754183_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_097453180.1|754182_755346_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	9.1e-205
WP_000468308.1|755427_755646_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292815.1|755964_758247_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|758301_759159_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001295344.1|759564_761325_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|761454_762147_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057136.1|762345_763434_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000445231.1|763504_764788_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001364509.1|764956_765721_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125015.1|765893_766577_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|766687_768361_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|768520_768805_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_024226769.1|769011_771276_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|771312_773061_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570541.1|773057_774044_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|774080_775313_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|775364_775547_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011601.1|775543_776290_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436927.1|776443_777337_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899574.1|777313_778093_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|778228_779014_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|779010_780333_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|780313_781018_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_097453181.1|781017_785478_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925978.1|785738_787586_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001364527.1|787766_788315_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|788341_788989_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000977920.1|790584_791673_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_097453182.1|792262_793663_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.3	5.3e-82
>prophage 4
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	821381	859919	5235560	integrase,transposase,protease,holin	Escherichia_phage(28.57%)	41	814154:814168	839328:839342
814154:814168	attL	CAGTACCAGAAACTG	NA	NA	NA	NA
WP_000156532.1|821381_823142_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|823327_823780_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001404956.1|823855_824896_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|825252_825762_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|825980_826610_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|826572_828735_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261235.1|828744_829191_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001364529.1|829313_831368_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.3e-20
WP_000424181.1|831399_831858_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|831953_832616_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001343235.1|832788_833202_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|833246_833564_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|833621_834812_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|834906_835185_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|835181_835511_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375138.1|835601_836261_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299351.1|836668_837688_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|837665_837908_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_057711277.1|837975_840411_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	6.0e-57
839328:839342	attR	CAGTTTCTGGTACTG	NA	NA	NA	NA
WP_001098307.1|840504_840696_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|840692_840881_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000373334.1|841584_842031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938157.1|842543_842831_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001300743.1|842831_843023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538413.1|842991_843453_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	53.6	8.8e-10
WP_000448218.1|843483_843855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021577226.1|843957_844239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693825.1|844242_844668_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|844874_845330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000451001.1|847307_848078_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.7	2.3e-79
WP_001151158.1|848093_848507_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.3	2.9e-60
WP_000160655.1|848858_849632_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001146807.1|849866_850220_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	1.5e-33
WP_000090265.1|850209_850581_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265266.1|850733_851552_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_085947974.1|852036_853249_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.0	7.1e-168
WP_000261909.1|853484_854198_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000998050.1|856279_857818_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|857867_858215_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|858211_858592_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000411814.1|859712_859919_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
>prophage 5
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	982583	1136209	5235560	terminase,portal,holin,protease,head,lysis,transposase,tail,capsid	Enterobacteria_phage(34.74%)	147	NA	NA
WP_001427255.1|982583_982928_+	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	34.7	1.9e-09
WP_000003742.1|984092_984362_-	excisionase	NA	NA	NA	NA	NA
WP_000048280.1|984423_986895_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_001365098.1|986988_987180_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001358566.1|987176_987365_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000379610.1|987854_988007_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000948454.1|988325_988802_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|988926_989250_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693928.1|989233_989659_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262372.1|989730_990801_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	4.5e-65
WP_106878447.1|991573_992335_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	3.2e-73
WP_042353845.1|992367_992649_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	3.9e-29
WP_000699809.1|992645_992873_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001365112.1|992865_993201_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.4	2.0e-48
WP_000683607.1|993303_993522_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	73.6	6.2e-22
WP_000104474.1|993523_994081_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|994314_994527_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|994646_994991_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|995112_995385_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265233.1|995386_996436_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_001217416.1|996448_996823_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	1.7e-32
WP_000762928.1|996819_997641_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000466957.1|998206_998638_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143073.1|999208_1001059_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.6	0.0e+00
WP_000411811.1|1001504_1001711_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|1001715_1002060_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992161.1|1002110_1002644_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	9.6e-101
WP_001056816.1|1002910_1003465_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	97.4	8.5e-100
WP_000539792.1|1003464_1003611_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1003838_1004024_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000074667.1|1004448_1004676_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_000279815.1|1004717_1005083_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	8.4e-64
WP_000958380.1|1005372_1005936_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001365116.1|1005932_1007594_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.8	0.0e+00
WP_001063096.1|1009638_1009860_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|1012386_1012713_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1012722_1013073_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1013069_1013516_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1013512_1013857_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|1013922_1014639_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030063.1|1014644_1015019_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1015114_1015324_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_057711751.1|1015375_1018618_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.8	0.0e+00
WP_000807964.1|1018610_1018952_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_001357740.1|1018951_1019650_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_045904127.1|1019655_1020399_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	3.6e-146
WP_122995720.1|1020344_1020977_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	3.8e-96
WP_106878448.1|1021212_1024686_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.8	0.0e+00
WP_001230489.1|1024752_1025352_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_106878522.1|1025416_1026631_+|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	94.6	1.1e-78
WP_001023452.1|1026632_1026902_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_115801847.1|1027007_1027097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001365180.1|1027116_1029465_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_057714318.1|1030055_1033457_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_095585410.1|1035573_1035726_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001058318.1|1036321_1037440_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107395.1|1037436_1039230_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186419.1|1039248_1039956_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003660.1|1039952_1040540_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063978.1|1040536_1040935_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|1040931_1041789_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263576.1|1041922_1043467_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460803.1|1043478_1044615_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1044627_1044720_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001365179.1|1044799_1046098_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208650.1|1046212_1048393_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1048412_1048859_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001343234.1|1048846_1049986_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742345.1|1050031_1052128_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038079.1|1052127_1052874_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|1052870_1053515_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|1053621_1053927_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1054368_1054581_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1054866_1055079_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071528578.1|1055089_1055278_+	cold-shock protein	NA	NA	NA	NA	NA
WP_021292990.1|1055252_1055483_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1055472_1055646_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818470.1|1055694_1056768_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071532497.1|1056839_1059584_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.6	1.1e-35
WP_001120135.1|1060666_1061359_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.5e-18
WP_001365183.1|1061488_1062661_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063151.1|1062660_1065207_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.5	3.1e-72
WP_000209866.1|1065203_1065803_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1065895_1066201_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420617.1|1066200_1067121_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_100224531.1|1067482_1068640_+	YccE family protein	NA	NA	NA	NA	NA
WP_001044273.1|1068930_1070172_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_097453323.1|1070208_1070436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607021.1|1070456_1071035_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_085947971.1|1072084_1073297_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	4.3e-165
WP_001254256.1|1073613_1073796_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_158707934.1|1073762_1074020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178727.1|1074643_1075318_+	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	88.8	6.2e-113
WP_001004008.1|1075392_1076115_+	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_001107998.1|1076114_1076720_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144758.1|1076716_1076911_+	protein ninH	NA	Q777W6	Enterobacteria_phage	100.0	8.4e-31
WP_001365506.1|1077843_1078791_+	Shiga toxin Stx1a subunit A	NA	Q6LDT4	Enterobacteria_phage	100.0	5.4e-171
WP_000752026.1|1078800_1079070_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_106878441.1|1079569_1081420_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.4	0.0e+00
WP_000411811.1|1081864_1082071_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|1082075_1082420_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992161.1|1082470_1083004_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	9.6e-101
WP_001082547.1|1083301_1083796_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
WP_000736096.1|1083792_1084017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453587.1|1084464_1085010_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_106878450.1|1084984_1086910_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.9	0.0e+00
WP_000198153.1|1086906_1087113_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001415980.1|1087109_1088711_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000123251.1|1088691_1090011_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1090020_1090353_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1090408_1091434_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1091474_1091870_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1091881_1092235_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000683137.1|1092819_1093215_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|1093222_1093975_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479051.1|1093988_1094411_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|1094437_1094851_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000847298.1|1097438_1097768_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_057728503.1|1097767_1098466_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	3.1e-131
WP_106878451.1|1098470_1099214_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	95.5	6.1e-146
WP_123000057.1|1099159_1099792_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.7e-104
WP_106878452.1|1100027_1103441_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	85.8	0.0e+00
WP_032316813.1|1104173_1105487_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	98.9	2.4e-76
WP_001023407.1|1105488_1105758_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001364720.1|1105863_1106745_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.1	2.3e-144
WP_001247930.1|1106975_1107674_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000830137.1|1108419_1109586_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.9e-226
WP_001105385.1|1109704_1110178_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200892.1|1110376_1111435_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1111606_1111936_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_052158572.1|1112036_1112171_-	propanediol utilization protein	NA	NA	NA	NA	NA
WP_085947974.1|1112234_1113447_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.0	7.1e-168
WP_001171554.1|1113797_1114178_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1114174_1114522_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998050.1|1114571_1116110_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000973176.1|1116416_1116962_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|1116958_1117702_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|1117713_1118793_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001310930.1|1118854_1119790_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011447.1|1120247_1121165_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011020.1|1121266_1122217_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122995708.1|1122334_1123978_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1124609_1125326_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000378567.1|1127222_1128539_-	shikimate transporter	NA	NA	NA	NA	NA
WP_085947969.1|1129286_1130500_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_001442913.1|1133422_1134220_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_085947969.1|1134996_1136209_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
>prophage 6
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	1140495	1203835	5235560	transposase,tail,holin	Escherichia_phage(22.58%)	65	NA	NA
WP_122993170.1|1140495_1140603_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	84.8	9.4e-08
WP_000887491.1|1140647_1140860_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_000980999.1|1141076_1141328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|1141393_1141672_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001265038.1|1141673_1142723_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.1e-108
WP_000904097.1|1142735_1143095_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	1.2e-35
WP_000640035.1|1143103_1143658_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917749.1|1143882_1144080_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935499.1|1144230_1145307_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	87.6	5.0e-181
WP_001443281.1|1145901_1146228_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	62.9	5.1e-36
WP_000142777.1|1148602_1148782_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_001290217.1|1148822_1149095_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284516.1|1149171_1149387_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_097453432.1|1149390_1149624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106878453.1|1149649_1150862_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	5.1e-166
WP_106878523.1|1151089_1154023_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	98.3	0.0e+00
WP_001230532.1|1154089_1154689_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_106878524.1|1154753_1156067_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	3.1e-76
WP_105484667.1|1156068_1156299_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	97.4	5.1e-35
WP_013009221.1|1156299_1157172_-	restriction endonuclease Eco57I	NA	NA	NA	NA	NA
WP_001079080.1|1159288_1159819_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	7.2e-56
WP_123006889.1|1160161_1160833_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240105.1|1161068_1161704_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740100.1|1161704_1162709_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|1162817_1163231_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|1163363_1164035_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826740.1|1164034_1165393_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_000218213.1|1165500_1166352_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824357.1|1166943_1168059_-	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	1.1e-90
WP_072163550.1|1168622_1168988_+	permease	NA	NA	NA	NA	NA
WP_000365563.1|1169027_1169723_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	8.1e-07
WP_001157254.1|1169789_1171208_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_000786004.1|1171188_1171659_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212226.1|1171647_1172568_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|1172740_1173658_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|1173736_1173919_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077632660.1|1174089_1175784_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	3.8e-18
WP_000491518.1|1175780_1176596_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|1176894_1177122_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071524607.1|1177230_1177473_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103994.1|1177516_1178140_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983998.1|1178429_1179215_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|1179223_1179493_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253437.1|1179502_1180240_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001282098.1|1180606_1181020_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001350520.1|1181016_1182021_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001171554.1|1182502_1182883_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1182879_1183227_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998050.1|1183276_1184815_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_097453377.1|1185044_1186172_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807591.1|1186168_1186612_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|1186630_1188004_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282661.1|1188003_1188690_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|1188682_1189678_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001274295.1|1191542_1191857_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|1192190_1192523_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000734031.1|1192691_1193243_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879833.1|1193252_1194050_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106878439.1|1196500_1197714_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.0	5.7e-165
WP_000334582.1|1198002_1198674_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.8e-80
WP_000790504.1|1198780_1199014_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118909.1|1199010_1200216_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|1200402_1200816_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245672.1|1200849_1202337_-	alpha-amylase	NA	NA	NA	NA	NA
WP_085948002.1|1202622_1203835_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.2e-169
>prophage 7
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	1551353	1561286	5235560	transposase	Stx2-converting_phage(50.0%)	10	NA	NA
WP_000041693.1|1551353_1553780_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.9e-212
WP_001295396.1|1553978_1554284_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072163568.1|1554391_1555102_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|1555104_1555665_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|1555699_1556041_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001364742.1|1556175_1556502_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	5.8e-24
WP_001295394.1|1556707_1557922_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000998050.1|1558973_1560512_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|1560561_1560909_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1560905_1561286_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 8
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	1685422	1797389	5235560	terminase,tRNA,portal,holin,protease,transposase,tail,integrase	Escherichia_phage(36.51%)	106	1711847:1711863	1796522:1796538
WP_000826450.1|1685422_1686631_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.7e-209
WP_001261013.1|1687162_1687831_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586728.1|1688133_1688727_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001190278.1|1688723_1689716_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000140884.1|1690814_1691351_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1691413_1691638_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|1691777_1693433_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013776.1|1693657_1695001_-	VOC family protein	NA	NA	NA	NA	NA
WP_024177738.1|1695217_1696141_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_097453303.1|1696178_1697819_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|1698217_1698367_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|1698438_1698612_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|1698856_1699387_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|1699575_1700577_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_097453302.1|1700618_1702058_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027947.1|1702254_1703055_-	YdcF family protein	NA	NA	NA	NA	NA
WP_097453301.1|1703326_1707229_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|1707429_1708035_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_024226026.1|1709378_1711136_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_096859193.1|1711151_1712048_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
1711847:1711863	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_106878463.1|1712047_1712671_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_024226023.1|1712841_1715148_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_024226021.1|1716304_1716895_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_057728709.1|1716876_1717827_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_097453299.1|1717927_1719241_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206184.1|1719267_1720473_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|1720472_1720895_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_032204915.1|1720884_1722312_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969780.1|1722313_1723102_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292357.1|1723101_1723869_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206362.1|1723865_1724936_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189193.1|1724943_1725441_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_024226016.1|1725455_1726202_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|1726210_1726498_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_057728708.1|1726509_1727439_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_062882266.1|1727723_1729769_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_057728706.1|1730016_1732290_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_106878439.1|1733184_1734397_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.0	5.7e-165
WP_001364714.1|1735315_1735642_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|1735649_1735835_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_097453298.1|1735831_1738471_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1738678_1739668_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001298828.1|1739778_1740201_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1740197_1740464_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628144.1|1740737_1744262_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|1744628_1745762_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001364706.1|1745902_1746337_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	4.0e-28
WP_106878464.1|1746502_1747703_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	96.3	1.3e-161
WP_158707935.1|1747743_1747923_-	hypothetical protein	NA	A0A0N7CBX1	Escherichia_phage	89.8	1.4e-24
WP_106878465.1|1747897_1749211_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001230489.1|1749275_1749875_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	9.7e-110
WP_158707940.1|1749945_1752474_-	DUF1983 domain-containing protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	99.0	0.0e+00
WP_001171554.1|1753563_1753944_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1753940_1754288_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998050.1|1754337_1755876_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_158707941.1|1756129_1756759_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.5	2.6e-97
WP_069358375.1|1756704_1757448_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	2.9e-148
WP_105459055.1|1757458_1758157_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	4.4e-130
WP_000847280.1|1758156_1758486_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_105466394.1|1758482_1761128_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	93.4	0.0e+00
WP_000532073.1|1761171_1761480_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|1761506_1761929_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|1761942_1762695_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1762702_1763101_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|1763113_1763737_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|1763739_1764021_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|1764013_1764340_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_096955153.1|1764427_1766392_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974568.1|1766395_1767898_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|1767897_1768110_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_096859288.1|1768106_1770230_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
WP_096859289.1|1770226_1770703_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	98.7	1.4e-82
WP_134792868.1|1771442_1771628_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	86.9	8.9e-22
WP_001092862.1|1772146_1772680_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	2.4e-99
WP_105484663.1|1772716_1773706_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	65.7	7.2e-110
WP_000284515.1|1773710_1773926_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_097453428.1|1774002_1774275_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	1.1e-23
WP_000143464.1|1774315_1774495_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_106878467.1|1774630_1776577_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000640115.1|1777498_1778053_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.0	4.2e-67
WP_000228035.1|1778049_1778340_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	7.4e-47
WP_000940306.1|1778339_1778939_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	5.9e-107
WP_071525388.1|1779010_1779262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1779498_1779711_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278447.1|1779899_1780004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206794.1|1780119_1780704_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001141093.1|1780760_1781153_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	5.9e-39
WP_106878468.1|1781168_1781939_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	9.0e-84
WP_000789014.1|1781964_1782705_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	83.3	2.3e-116
WP_106878469.1|1783606_1784029_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.0e-68
WP_001033914.1|1784025_1784268_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|1784364_1784784_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|1785090_1785243_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000560227.1|1785651_1785873_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	1.2e-36
WP_001359121.1|1785872_1786043_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
WP_062880995.1|1786493_1789166_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	94.4	7.6e-170
WP_000595430.1|1789158_1789968_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	69.9	2.2e-104
WP_001317028.1|1790024_1790219_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|1790211_1790421_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|1790499_1790715_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|1790716_1791952_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157404.1|1792003_1792939_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.3e-145
WP_000123759.1|1793067_1794441_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001296046.1|1794470_1794644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|1794918_1795902_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_024177798.1|1796156_1797389_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1796522:1796538	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 9
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	1874567	1906444	5235560	transposase,tail,protease,holin	Stx2-converting_phage(37.5%)	32	NA	NA
WP_000422045.1|1874567_1875617_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559274.1|1875836_1876595_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	1.5e-06
WP_001278904.1|1876591_1877182_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1877221_1878094_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|1878194_1878815_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285668.1|1878811_1879693_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001386774.1|1879830_1879875_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_097453267.1|1879966_1881529_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1881528_1883124_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000209521.1|1884496_1885690_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443055.1|1885689_1886496_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1886876_1887056_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1887141_1887642_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|1887687_1888194_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071532495.1|1888695_1888914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|1890654_1891224_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|1891288_1892200_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106878526.1|1892306_1892360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106878472.1|1892419_1893620_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.0	1.1e-165
WP_001025663.1|1895321_1896644_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	83.9	2.1e-221
WP_106409363.1|1896986_1897181_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|1897125_1897668_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_000807930.1|1898752_1899094_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000074669.1|1899597_1899822_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|1899903_1900218_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106878473.1|1900699_1902238_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.6	2.9e-299
WP_000612591.1|1902287_1902635_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_105596447.1|1902631_1903012_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_001365021.1|1903122_1903335_-	hypothetical protein	NA	A0A0N7KZA0	Stx2-converting_phage	93.5	2.0e-25
WP_000411802.1|1903334_1903541_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_001365252.1|1905681_1906011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1906231_1906444_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
>prophage 10
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	2007625	2106588	5235560	terminase,tRNA,holin,protease,head,lysis,transposase,tail,integrase,capsid	Enterobacteria_phage(42.55%)	117	2063047:2063062	2109651:2109666
WP_085947970.1|2007625_2008839_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_064764447.1|2008876_2009998_+	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_097453400.1|2010202_2010934_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|2011154_2011559_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|2011611_2011722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|2012254_2012578_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000539892.1|2012680_2012833_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	1.6e-21
WP_000998050.1|2013362_2014901_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|2014950_2015298_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2015294_2015675_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000089723.1|2015811_2016234_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|2016258_2016843_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201826.1|2017340_2018294_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_105475244.1|2018480_2019965_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937499.1|2020148_2020454_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_106878427.1|2020771_2021985_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	1.4e-168
WP_000134810.1|2022989_2023172_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|2023250_2023751_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2023787_2024294_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488336.1|2024312_2025203_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885594.1|2025322_2025904_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	2.3e-103
WP_106878476.1|2025903_2028975_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	1.9e-68
WP_071532503.1|2029393_2030026_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	88.1	1.3e-93
WP_000140767.1|2029962_2030706_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.5e-144
WP_000453622.1|2031626_2032172_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_001300120.1|2032560_2032755_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|2032919_2033126_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|2033411_2033822_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|2034113_2034407_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_012738274.1|2034497_2034680_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_001180491.1|2034896_2035373_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.0e-85
WP_000544528.1|2035359_2035665_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_096847942.1|2036552_2036798_+	hypothetical protein	NA	A0A0P0ZBQ0	Stx2-converting_phage	98.8	6.2e-39
WP_000763364.1|2036896_2037115_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488406.1|2037162_2037402_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2037541_2037778_+	excisionase	NA	NA	NA	NA	NA
WP_000741341.1|2037767_2038910_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	99.7	3.1e-205
WP_000444487.1|2039023_2040274_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_097453362.1|2040445_2041099_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476089.1|2041108_2041570_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001297484.1|2041623_2042730_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_024017298.1|2042765_2043407_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_097453363.1|2043410_2044781_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.6	2.1e-107
WP_001265481.1|2044949_2045621_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735399.1|2045620_2047081_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|2047156_2048278_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|2048326_2049553_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2049802_2050939_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799399.1|2050922_2051786_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001132165.1|2052059_2052650_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144080.1|2052832_2053483_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|2053557_2054616_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|2054743_2055379_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|2055446_2056028_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131642.1|2056318_2056894_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023452.1|2057007_2057277_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_106878477.1|2057278_2058592_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001216290.1|2058656_2059280_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106878478.1|2059348_2062825_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	98.7	0.0e+00
2063047:2063062	attL	TTTTTTTATTCTTTTT	NA	NA	NA	NA
WP_045904127.1|2063637_2064381_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	3.6e-146
WP_001357740.1|2064386_2065085_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|2065084_2065426_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_057711751.1|2065418_2068661_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.8	0.0e+00
WP_001453698.1|2068712_2068922_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2069017_2069392_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275471.1|2069397_2070114_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_000133388.1|2070179_2070524_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2070520_2070967_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2070963_2071314_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2071323_2071650_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2074176_2074398_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000173076.1|2074442_2076380_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001365116.1|2076443_2078105_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.8	0.0e+00
WP_000958380.1|2078101_2078665_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279815.1|2078954_2079320_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	8.4e-64
WP_000074667.1|2079361_2079589_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_012816791.1|2080013_2080199_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2080426_2080573_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056816.1|2080572_2081127_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	97.4	8.5e-100
WP_000992161.1|2081393_2081927_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	9.6e-101
WP_000731236.1|2081977_2082322_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411811.1|2082326_2082533_-|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_106878441.1|2082978_2084829_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.4	0.0e+00
WP_000752026.1|2085328_2085598_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_001365506.1|2085607_2086555_-	Shiga toxin Stx1a subunit A	NA	Q6LDT4	Enterobacteria_phage	100.0	5.4e-171
WP_000144758.1|2087487_2087682_-	protein ninH	NA	Q777W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107998.1|2087678_2088284_-	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_001004008.1|2088283_2089006_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_000211430.1|2089080_2089761_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	88.9	8.2e-121
WP_001254256.1|2090039_2090222_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153270.1|2090218_2090746_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_016238076.1|2090742_2091183_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	99.3	1.7e-79
WP_000344560.1|2091330_2091594_-	hypothetical protein	NA	Q716C8	Shigella_phage	60.8	1.2e-24
WP_000818844.1|2091611_2091818_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	94.1	1.1e-25
WP_085947971.1|2092213_2093426_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	4.3e-165
WP_000442612.1|2095592_2095889_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2096030_2096246_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2096320_2097016_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2097517_2098039_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2098607_2098790_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088202.1|2098767_2099040_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	1.7e-40
WP_000394303.1|2099098_2099350_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	2.8e-42
WP_000972063.1|2099576_2099711_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|2099695_2099848_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000168274.1|2100809_2101316_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_001016186.1|2101324_2101873_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.9	9.5e-104
WP_001111281.1|2101889_2102186_+	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	8.6e-51
WP_000855559.1|2102196_2102487_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	97.9	1.2e-44
WP_001214456.1|2102483_2102648_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_000812199.1|2102644_2103145_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	92.7	1.5e-58
WP_071532516.1|2103141_2103375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024177819.1|2103361_2103958_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	65.4	1.5e-62
WP_000207907.1|2103959_2104508_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	55.7	1.4e-49
WP_000002094.1|2104500_2104785_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	91.5	2.3e-45
WP_001303965.1|2104856_2105156_+	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000132739.1|2105237_2105429_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_106878479.1|2105409_2106588_-|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.2	3.2e-229
2109651:2109666	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 11
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	2131257	2139225	5235560		Bathycoccus_sp._RCC1105_virus(16.67%)	8	NA	NA
WP_000564888.1|2131257_2132361_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.1	8.0e-41
WP_000971201.1|2132357_2132825_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001025599.1|2132821_2133217_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_000676087.1|2133220_2134084_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	67.7	9.7e-111
WP_000699410.1|2134083_2135169_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	5.2e-101
WP_000183078.1|2135541_2136435_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
WP_000999473.1|2136677_2137673_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001116024.1|2137830_2139225_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	1.8e-18
>prophage 12
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	2179489	2192132	5235560	terminase,transposase,tail,portal	Enterobacteria_phage(42.86%)	15	NA	NA
WP_106878481.1|2179489_2180703_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_057728384.1|2180920_2181496_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.0	4.7e-77
WP_021351651.1|2181940_2182312_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_042353374.1|2182440_2183223_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.4	1.2e-144
WP_000950982.1|2183489_2184371_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_105475256.1|2184476_2184746_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	92.1	1.0e-42
WP_000533419.1|2185760_2186174_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.0e-41
WP_097453406.1|2186252_2186744_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	60.8	4.2e-42
WP_097453405.1|2186740_2186947_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2187339_2187849_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2188243_2188468_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001303878.1|2188549_2188864_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2189390_2189576_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_085948002.1|2190018_2191231_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.2e-169
WP_000992174.1|2191598_2192132_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	1.4e-99
>prophage 13
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	2503824	2514977	5235560	transposase,integrase	Enterobacteria_phage(50.0%)	9	2501650:2501663	2521799:2521812
2501650:2501663	attL	GCGAGCTATAAAGA	NA	NA	NA	NA
WP_000368135.1|2503824_2504757_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.1e-167
WP_000958686.1|2505068_2506226_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	6.9e-221
WP_000506736.1|2506232_2506622_-	hypothetical protein	NA	K7P6F7	Enterobacteria_phage	88.3	7.1e-61
WP_024177747.1|2506951_2508037_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	31.0	4.3e-23
WP_000998050.1|2507943_2509482_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|2509531_2509879_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2509875_2510256_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000991370.1|2510764_2511379_+	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_072169949.1|2511383_2514977_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
2521799:2521812	attR	GCGAGCTATAAAGA	NA	NA	NA	NA
>prophage 14
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	2730608	2856111	5235560	terminase,tRNA,portal,head,transposase,tail,integrase,capsid	Enterobacteria_phage(39.62%)	116	2770419:2770436	2802012:2802029
WP_024177753.1|2730608_2731346_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219202.1|2731477_2732812_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.5	1.1e-44
WP_001364831.1|2733020_2733902_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189201.1|2734004_2734592_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2734647_2735031_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262720.1|2735335_2736025_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|2736072_2737110_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_097453358.1|2737316_2737736_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	8.3e-15
WP_001300438.1|2737804_2738503_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082978.1|2738534_2741195_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949248.1|2741308_2742664_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2742709_2743033_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2743029_2744328_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2750107_2752681_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|2752810_2753542_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|2753538_2754519_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_106878486.1|2754653_2755391_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2755661_2756003_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2756106_2756154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2756252_2757413_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2757455_2758577_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2758587_2759658_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|2759867_2760233_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2760382_2760901_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969034.1|2760890_2762117_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589825.1|2762132_2762615_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2762691_2763039_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2763080_2763848_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2763878_2764427_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2764445_2764694_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2764830_2766192_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2766358_2767150_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2767170_2768457_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001364786.1|2768511_2769105_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2769227_2770106_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880895.1|2770191_2771853_+	DNA repair protein RecN	NA	NA	NA	NA	NA
2770419:2770436	attL	TCTGTGCTGGCTGGAAGA	NA	NA	NA	NA
WP_001203437.1|2772001_2772343_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2772404_2772695_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2772684_2773161_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162571.1|2773292_2773775_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000124722.1|2774536_2775736_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	7.7e-106
WP_021522835.1|2775736_2777434_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_000628292.1|2777420_2777654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534626.1|2777640_2778189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562050.1|2778191_2778452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446131.1|2778904_2779477_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	6.5e-95
WP_000638634.1|2779550_2780051_-	transactivation protein	NA	NA	NA	NA	NA
WP_106878487.1|2780567_2781780_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	97.3	2.2e-164
WP_001244670.1|2781861_2782149_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_001217542.1|2782433_2782682_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001121225.1|2783275_2783926_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491544.1|2784150_2785026_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.9	9.7e-159
WP_001023420.1|2785166_2785436_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_057719858.1|2785437_2786457_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	79.6	2.6e-78
WP_001230281.1|2786516_2787116_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.0	1.6e-107
WP_105459102.1|2787185_2790599_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.4	0.0e+00
WP_000090857.1|2790659_2791292_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	5.0e-96
WP_158707936.1|2791228_2791930_-|tail	phage tail protein	tail	A5LH41	Enterobacteria_phage	92.7	1.9e-125
WP_001152629.1|2791975_2792674_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
WP_000847362.1|2792673_2793003_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_097453393.1|2792999_2795561_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.0	0.0e+00
WP_000459467.1|2795553_2795988_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479187.1|2795969_2796392_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	6.5e-60
WP_002432346.1|2796407_2797148_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.8e-129
WP_000683105.1|2797155_2797551_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_032292245.1|2797547_2798126_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	7.8e-80
WP_000753004.1|2798137_2798491_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158879.1|2798502_2798898_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	1.7e-57
WP_000063254.1|2798939_2799965_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001345004.1|2800020_2800353_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000123288.1|2800362_2801682_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_105459061.1|2801662_2803264_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	6.5e-310
2802012:2802029	attR	TCTTCCAGCCAGCACAGA	NA	NA	NA	NA
WP_000198149.1|2803260_2803467_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_106878488.1|2803463_2805389_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|2805363_2805909_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_106878489.1|2806268_2807481_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_001303940.1|2807610_2807835_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2807916_2808231_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_106878487.1|2808913_2810127_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	97.3	2.2e-164
WP_106878490.1|2810429_2812280_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_153244796.1|2812265_2812409_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000466957.1|2812758_2813190_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|2813639_2814353_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|2814486_2814684_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_096859246.1|2815603_2815972_+	NIPSNAP family protein	NA	NA	NA	NA	NA
WP_106878492.1|2820399_2822496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993087.1|2822905_2823883_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_106878493.1|2823902_2825171_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000772845.1|2825193_2826642_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001364906.1|2826655_2827936_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	7.1e-33
WP_001295173.1|2828246_2829647_+	GABA permease	NA	NA	NA	NA	NA
WP_000156817.1|2829667_2830330_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522428.1|2830330_2830780_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.6e-06
WP_000508177.1|2830863_2831022_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000137291.1|2831204_2831504_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001229456.1|2831513_2832038_+	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000115370.1|2832084_2832489_-	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_000492656.1|2833156_2833606_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000281320.1|2833642_2833987_-	YgaC family protein	NA	NA	NA	NA	NA
WP_001295174.1|2834138_2834468_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001223227.1|2834715_2834961_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080944.1|2834957_2835368_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_000777969.1|2837493_2838453_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|2838807_2840010_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000775000.1|2840002_2841067_+	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000445651.1|2843716_2844454_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000119763.1|2844443_2844779_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000378442.1|2844869_2845400_+	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_001295175.1|2845526_2846699_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_001295176.1|2846715_2848254_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001130211.1|2848317_2848833_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000611802.1|2848982_2850539_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001287457.1|2850611_2851040_-	DedA family protein	NA	NA	NA	NA	NA
WP_000273309.1|2851036_2851603_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000906486.1|2853060_2853246_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047202.1|2853480_2856111_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
>prophage 15
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	2893008	2900144	5235560		Escherichia_phage(71.43%)	7	NA	NA
WP_001272924.1|2893008_2895570_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141338.1|2895675_2896332_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	44.9	1.4e-48
WP_001364965.1|2896382_2897150_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.1	1.5e-70
WP_001364885.1|2897345_2897861_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	69.8	3.6e-52
WP_078126497.1|2897875_2898250_+	NAD-binding protein	NA	A0A077SLF7	Escherichia_phage	85.4	4.0e-53
WP_000590409.1|2898246_2899509_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	4.4e-136
WP_001279007.1|2899505_2900144_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	4.1e-82
>prophage 16
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	3348469	3397680	5235560	transposase,protease	Stx2-converting_phage(29.41%)	45	NA	NA
WP_106878430.1|3348469_3349682_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	97.3	2.2e-164
WP_001053345.1|3349841_3351083_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000301248.1|3351504_3352080_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_000116680.1|3352148_3352727_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000255079.1|3352775_3353816_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000007449.1|3353838_3354294_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_097453339.1|3354316_3355474_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254139.1|3355473_3356055_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	3.7e-13
WP_001035166.1|3356377_3357436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|3357445_3358588_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001040060.1|3358580_3359354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182418.1|3359355_3360435_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3360434_3361391_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_097453338.1|3361401_3362610_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3362627_3363095_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3363355_3363685_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957249.1|3363671_3364052_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3364955_3366569_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3366599_3366950_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435661.1|3366946_3367372_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_000397130.1|3369709_3370381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3371251_3371392_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3371692_3371956_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021388.1|3373167_3373785_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3373796_3374471_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3374471_3374936_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3374945_3376649_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3376641_3376962_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3376970_3377273_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_029785359.1|3377282_3378062_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3378442_3378718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591995.1|3378936_3380556_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3380648_3381008_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001171554.1|3381454_3381835_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3381831_3382179_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998050.1|3382228_3383767_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001304211.1|3384143_3384434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3384457_3384709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097453412.1|3384756_3385326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947969.1|3385392_3386606_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_000282084.1|3389047_3389611_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000270113.1|3392106_3392334_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000248065.1|3393063_3394677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268401.1|3394769_3395366_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	89.4	2.0e-99
WP_106878430.1|3396467_3397680_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	97.3	2.2e-164
>prophage 17
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	4028531	4037955	5235560		Enterobacteria_phage(87.5%)	11	NA	NA
WP_000119815.1|4028531_4030391_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|4030387_4030813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446138.1|4031140_4031713_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.7	1.6e-93
WP_097453423.1|4031786_4032287_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283028.1|4032283_4033018_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	3.3e-128
WP_001149160.1|4033560_4033827_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|4033823_4034423_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244670.1|4034415_4034703_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459302.1|4034695_4035151_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4035286_4035607_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_106878508.1|4035621_4037955_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
>prophage 18
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	4617780	4687595	5235560	transposase,tRNA,integrase,protease	Stx2-converting_phage(18.75%)	49	4616175:4616189	4655686:4655700
4616175:4616189	attL	TCCAGTTCCATACCG	NA	NA	NA	NA
WP_032236816.1|4617780_4617951_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	2.7e-25
WP_106878515.1|4618002_4619215_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	98.6	7.9e-167
WP_000609745.1|4631695_4632370_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_001365466.1|4632418_4633408_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.2	1.2e-96
WP_001121628.1|4634015_4635665_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_077632679.1|4636018_4636165_-	PapI protein	NA	NA	NA	NA	NA
WP_085947969.1|4636130_4637344_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_000603950.1|4639956_4640505_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.4	1.3e-15
WP_000631719.1|4642826_4643174_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001341423.1|4643170_4643845_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001218841.1|4644835_4646101_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001365454.1|4646480_4647056_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068978.1|4647092_4648790_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883401.1|4648765_4649104_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000069437.1|4650637_4652074_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4652410_4652887_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_001013736.1|4652902_4654159_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4654434_4654728_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4654771_4656418_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
4655686:4655700	attR	CGGTATGGAACTGGA	NA	NA	NA	NA
WP_000558209.1|4656555_4656909_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008020.1|4657111_4657981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940506.1|4658375_4659404_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|4659445_4660012_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|4660063_4660189_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|4660299_4660446_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|4660627_4660945_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001238378.1|4660941_4661475_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001299193.1|4661562_4662696_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001299198.1|4662758_4663118_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|4663128_4663524_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|4663534_4664269_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192979.1|4664261_4666052_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|4666376_4667354_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001300174.1|4667572_4669075_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_001236855.1|4669225_4672549_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_097453343.1|4672570_4673539_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041970.1|4673635_4674688_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|4674782_4675328_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|4676184_4676238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|4676220_4677360_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001295189.1|4677358_4678906_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4678877_4679339_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990262.1|4679357_4680692_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122503.1|4680701_4682549_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|4682541_4683492_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4683577_4683886_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4683962_4685243_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312487.1|4685328_4686588_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4686590_4687595_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 19
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	4793947	4800448	5235560		Enterobacteria_phage(100.0%)	9	NA	NA
WP_001365434.1|4793947_4794520_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	98.4	1.5e-96
WP_000984200.1|4794534_4794780_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	98.8	5.1e-41
WP_105466375.1|4794776_4795511_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	96.7	8.2e-127
WP_001149160.1|4796053_4796320_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|4796316_4796916_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244670.1|4796908_4797196_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459302.1|4797188_4797644_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4797779_4798100_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783689.1|4798114_4800448_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
>prophage 20
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	4888046	4909195	5235560	holin	Shigella_phage(28.0%)	33	NA	NA
WP_000135680.1|4888046_4888409_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001311077.1|4889111_4889804_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|4889901_4890162_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526667.1|4890154_4890706_+	hypothetical protein	NA	S5FXP0	Shigella_phage	95.1	2.1e-95
WP_001250269.1|4890881_4891061_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104941.1|4891050_4891992_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_013009328.1|4891988_4892483_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	1.1e-85
WP_000066917.1|4892482_4893136_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210181.1|4893132_4893459_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_000771483.1|4893455_4893851_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	97.6	9.7e-66
WP_001072669.1|4894013_4894829_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001519432.1|4894836_4895826_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001047103.1|4895839_4896592_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	3.4e-136
WP_122995718.1|4896870_4896960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087755.1|4897014_4897227_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066486.1|4897527_4897743_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_000839580.1|4898495_4898711_+|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	1.9e-31
WP_000193257.1|4898715_4899060_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	91.7	7.0e-36
WP_001315200.1|4899025_4899298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|4901025_4901373_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4901369_4901750_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000992048.1|4901853_4902387_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	1.5e-98
WP_001071779.1|4902383_4902875_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066496.1|4903243_4903456_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|4903466_4903655_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|4903802_4903958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|4904130_4904304_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000836769.1|4905012_4905246_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|4905314_4905428_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|4905854_4906103_-	DinI family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202564.1|4906322_4907909_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4908301_4908907_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4909033_4909195_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 21
NZ_CP027587	Escherichia coli strain 2013C-4974 chromosome, complete genome	5235560	5219891	5234691	5235560	integrase	Enterobacteria_phage(88.89%)	15	5208168:5208181	5225574:5225587
5208168:5208181	attL	AGTGCGGGTTGCAG	NA	NA	NA	NA
WP_106878519.1|5219891_5221076_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.0e-143
WP_000064054.1|5221068_5222697_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_000622599.1|5222693_5223434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446138.1|5223736_5224309_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	95.7	1.6e-93
WP_001365316.1|5224382_5224883_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283028.1|5224879_5225614_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	3.3e-128
5225574:5225587	attR	AGTGCGGGTTGCAG	NA	NA	NA	NA
WP_001149160.1|5226156_5226423_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|5226419_5227019_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244670.1|5227011_5227299_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459302.1|5227291_5227747_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_106878520.1|5227882_5228203_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783689.1|5228217_5230551_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_001111354.1|5231137_5231548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121353.1|5231526_5232483_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667028.1|5232492_5234691_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	2.8e-37
>prophage 1
NZ_CP027588	Escherichia coli strain 2013C-4974 plasmid unnamed	58109	23961	36646	58109	transposase,protease	Stx2-converting_phage(33.33%)	13	NA	NA
WP_000205772.1|23961_24708_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	7.1e-09
WP_000704526.1|24766_25627_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	7.4e-10
WP_000139321.1|25729_26290_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001309245.1|26419_26632_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024177720.1|26876_27338_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	36.4	1.2e-19
WP_057711467.1|27383_27593_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_057711465.1|27630_28200_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_106878481.1|28205_29418_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_137538905.1|29384_29681_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.2e-06
WP_106878530.1|30210_34110_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.3	5.2e-236
WP_000998050.1|34333_35872_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|35921_36269_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|36265_36646_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
