The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027579	Escherichia coli strain 2013C-4282 chromosome, complete genome	5030044	336114	345556	5030044		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569383.1|336114_337041_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_000783141.1|337045_337777_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001216963.1|337757_337865_-	membrane protein	NA	NA	NA	NA	NA
WP_001240401.1|337924_338656_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001353100.1|338877_340563_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.3	2.1e-303
WP_001353101.1|340559_341279_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001353102.1|341325_341796_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	99.4	4.0e-82
WP_001353103.1|341838_342300_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001087214.1|342431_344423_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	90.7	0.0e+00
WP_001353104.1|344419_345556_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	1.5e-164
>prophage 2
NZ_CP027579	Escherichia coli strain 2013C-4282 chromosome, complete genome	5030044	883705	960318	5030044	protease,integrase,terminase,tail,holin,lysis,portal,capsid	Shigella_phage(56.25%)	90	887806:887825	916248:916267
WP_001260848.1|883705_884527_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233092.1|884626_884710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743943.1|884802_885138_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091858.1|885533_886787_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019559.1|886893_887787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
887806:887825	attL	AGCCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000225276.1|887921_889142_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_000919228.1|889266_889962_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_071986689.1|889914_891207_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148700.1|891364_891979_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.8	5.6e-28
WP_000526461.1|892021_892876_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_106907480.1|892877_893432_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	58.8	4.8e-63
WP_000051896.1|893469_894633_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	100.0	2.2e-227
WP_000377095.1|894488_894860_-	DNA-binding protein	NA	B9UDM0	Salmonella_phage	74.8	7.8e-41
WP_000497814.1|894894_895146_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	98.8	4.9e-39
WP_040077670.1|895193_895874_-	exonuclease	NA	V5UT69	Shigella_phage	99.6	3.5e-132
WP_000100822.1|895870_896656_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	100.0	6.3e-149
WP_000995034.1|896661_896958_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	100.0	1.5e-50
WP_001271581.1|896954_899003_-	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	98.5	0.0e+00
WP_000660960.1|899111_899498_-	hypothetical protein	NA	A0A088CBP0	Shigella_phage	97.7	7.3e-66
WP_000560215.1|899588_899804_-	cell division protein FtsZ	NA	A0A088CE40	Shigella_phage	98.6	2.8e-35
WP_001005965.1|900135_900492_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	100.0	1.3e-56
WP_000211195.1|900523_901237_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	99.6	1.2e-127
WP_000088198.1|901240_901513_-	hypothetical protein	NA	A0A088CD31	Shigella_phage	100.0	3.3e-41
WP_000239215.1|901907_902678_-	phage repressor protein C	NA	A0A088CBP2	Shigella_phage	100.0	1.5e-147
WP_001068241.1|902762_902990_+	hypothetical protein	NA	A0A088CE43	Shigella_phage	100.0	5.4e-37
WP_000084292.1|903133_903430_+	hypothetical protein	NA	A0A088CBI6	Shigella_phage	100.0	2.3e-48
WP_000438870.1|903444_903663_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_024173690.1|903683_904760_+	DNA-binding protein	NA	V5URT9	Shigella_phage	97.8	6.5e-205
WP_000790395.1|904766_905507_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	100.0	7.2e-139
WP_000450880.1|905532_906303_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	100.0	6.6e-135
WP_001151119.1|906317_906749_+	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	100.0	2.5e-75
WP_000060692.1|906781_907456_-	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	100.0	1.3e-123
WP_000354190.1|907454_907700_+	hypothetical protein	NA	A0A088CC19	Shigella_phage	100.0	6.2e-39
WP_001240641.1|907747_908053_-	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	100.0	3.4e-50
WP_001451755.1|908142_908340_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001260981.1|908468_908726_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	98.8	2.8e-37
WP_000211407.1|909053_909719_+	hypothetical protein	NA	A0A088CD42	Shigella_phage	80.4	3.9e-91
WP_000107185.1|909975_910620_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	52.9	1.0e-56
WP_042963318.1|910674_911085_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	97.8	1.4e-70
WP_042187504.1|911081_911273_+	NinE family protein	NA	Q9MCP2	Enterobacteria_phage	91.2	4.0e-25
WP_000002253.1|911296_911587_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	100.0	2.9e-51
WP_001008117.1|911583_911946_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A088CBJ1	Shigella_phage	100.0	6.4e-64
WP_000992060.1|911945_912140_+	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001204860.1|912132_912513_+	antitermination protein	NA	A0A088CD47	Shigella_phage	99.2	4.0e-69
WP_000350576.1|912644_913238_+	hypothetical protein	NA	A0A088CBP8	Shigella_phage	99.5	4.8e-109
WP_000691354.1|913812_914760_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|914769_915039_+	Shiga toxin Stx1 subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000624529.1|915189_915417_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	81.0	8.4e-22
WP_000874413.1|915542_917483_+	DUF1737 domain-containing protein	NA	A0A088CD51	Shigella_phage	99.4	0.0e+00
916248:916267	attR	AGCCCGAAAAATGTGCTGTT	NA	NA	NA	NA
WP_000142786.1|917618_917798_+	DUF1378 domain-containing protein	NA	A0A088CBQ0	Shigella_phage	94.9	3.2e-24
WP_001290208.1|917838_918084_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000284510.1|918161_918377_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087453.1|918381_918915_+	lysozyme	NA	A0A088CC28	Shigella_phage	99.4	3.0e-102
WP_001056877.1|919187_919787_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	97.9	1.5e-105
WP_001082567.1|919915_920353_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	100.0	6.9e-73
WP_001109015.1|920555_921098_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_001086073.1|921621_922428_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	100.0	1.3e-133
WP_000143989.1|922408_924115_+|terminase	terminase	terminase	A0A0H4IT14	Shigella_phage	99.6	0.0e+00
WP_077166566.1|924114_926259_+|portal	portal protein	portal	A0A0P0ZGR1	Escherichia_phage	99.9	0.0e+00
WP_000345015.1|926416_927424_+	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_000214467.1|927447_928662_+|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_001140440.1|928716_929106_+	hypothetical protein	NA	A0A0H4IQ95	Shigella_phage	100.0	1.3e-62
WP_047081823.1|929156_929618_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	99.3	6.6e-74
WP_000829201.1|929601_930165_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_000207922.1|930164_930815_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_106907481.1|930811_933109_+|tail	phage tail protein	tail	A0A1I9LJS9	Stx_converting_phage	99.2	1.7e-61
WP_106907482.1|933118_933328_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_024173679.1|933327_934002_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	1.5e-114
WP_001146316.1|934080_935706_+	hypothetical protein	NA	A0A0H4IT21	Shigella_phage	98.0	0.0e+00
WP_000197192.1|935702_936971_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|936985_937264_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001373155.1|937269_937887_+	hypothetical protein	NA	A0A088CBQ8	Shigella_phage	99.5	1.5e-121
WP_000790529.1|938010_938745_+	membrane protein	NA	A0A088CE87	Shigella_phage	99.2	8.2e-135
WP_071531851.1|938675_938894_-	hypothetical protein	NA	Q7Y2U2	Escherichia_phage	97.2	9.2e-34
WP_000078907.1|938975_939116_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|939172_939574_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509491.1|939667_940324_+	hypothetical protein	NA	A0A088CD74	Shigella_phage	100.0	5.1e-104
WP_000455651.1|940326_940773_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	98.0	2.6e-75
WP_000540401.1|940783_941056_+	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	92.3	3.6e-11
WP_000012434.1|941066_942332_+	hypothetical protein	NA	Q08J71	Stx2-converting_phage	93.8	3.3e-192
WP_106907483.1|942401_950786_+	hypothetical protein	NA	A0A0P0ZFK4	Escherichia_phage	97.0	0.0e+00
WP_000756597.1|951217_951562_-	TIGR00156 family protein	NA	A0A1I9LJU6	Stx_converting_phage	98.2	1.8e-55
WP_000902690.1|951681_951894_-	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	70.0	1.7e-16
WP_077632750.1|952744_953032_-	hypothetical protein	NA	G9L6B3	Escherichia_phage	98.9	1.1e-53
WP_001014734.1|953261_953969_-	hypothetical protein	NA	A0A088CC42	Shigella_phage	64.0	1.5e-32
WP_000763353.1|953965_954187_-	conjugal transfer protein TraR	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_000203844.1|954234_954867_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	85.8	1.7e-96
WP_000213043.1|955283_955397_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_074501129.1|955407_957831_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	3.7e-208
WP_000041643.1|957891_960318_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.3e-213
>prophage 3
NZ_CP027579	Escherichia coli strain 2013C-4282 chromosome, complete genome	5030044	1244511	1311830	5030044	protease,integrase,terminase,tail,holin,lysis,head,portal,capsid	Escherichia_phage(33.96%)	83	1240791:1240804	1312254:1312267
1240791:1240804	attL	ACCGATTTTATGGC	NA	NA	NA	NA
WP_000422059.1|1244511_1245561_-|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559303.1|1245780_1246539_+	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	3.3e-06
WP_001278877.1|1246535_1247126_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000709.1|1247178_1247487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622031.1|1247498_1248500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|1248669_1249545_-	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
WP_001353240.1|1249645_1250266_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001353241.1|1250262_1251144_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_071986690.1|1251280_1251325_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194646.1|1251416_1252979_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|1252978_1254574_+	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_024218645.1|1254577_1255936_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	2.3e-37
WP_000209510.1|1255947_1257141_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_106907516.1|1257140_1257947_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807647.1|1258327_1258507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056440.1|1258599_1259100_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079516.1|1259145_1259652_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_032347831.1|1260946_1261210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049902.1|1261257_1261929_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	2.5e-106
WP_096857170.1|1261997_1263203_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.2e-55
WP_001270059.1|1263352_1263976_-	membrane protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_106907517.1|1264044_1267740_-|tail	phage tail protein	tail	Q6H9T2	Enterobacteria_phage	84.6	0.0e+00
WP_106907518.1|1268649_1269294_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	74.3	1.7e-88
WP_047091088.1|1269191_1269935_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	1.1e-147
WP_106901605.1|1269945_1270644_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	1.2e-132
WP_000847280.1|1270643_1270973_-|tail	tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_106907519.1|1270969_1273543_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.3	0.0e+00
WP_071532372.1|1273523_1273937_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	2.3e-41
WP_001299690.1|1273963_1274395_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235126.1|1274410_1275160_-|tail	tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_000683074.1|1275167_1275563_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_001571311.1|1275559_1276135_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_001204531.1|1276150_1276504_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_001373367.1|1276496_1276880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044803575.1|1276931_1277960_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256803.1|1278017_1278365_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_047091051.1|1278401_1279907_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.0e-99
WP_047091052.1|1279896_1281489_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	2.6e-186
WP_000259002.1|1281485_1281692_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_077788238.1|1281675_1283583_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.8	7.3e-260
WP_047091053.1|1283575_1284124_-|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	60.0	4.6e-58
WP_072127061.1|1284407_1284572_-	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	75.6	7.4e-12
WP_000735655.1|1284568_1284793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024177305.1|1284816_1285284_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	86.5	5.1e-66
WP_077630235.1|1285432_1285648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092874.1|1285771_1286305_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_071531504.1|1286608_1286815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264424.1|1286816_1287608_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_000284490.1|1287611_1287827_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290230.1|1287904_1288150_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000142780.1|1288190_1288370_-	DUF1378 domain-containing protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_039264423.1|1288504_1290469_-	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	79.4	2.0e-297
WP_024166055.1|1291964_1292243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000382065.1|1292331_1293057_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000271629.1|1293753_1294182_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_106907520.1|1294661_1295720_-	DNA adenine methylase	NA	S5MDR0	Escherichia_phage	98.9	1.5e-206
WP_000917733.1|1295871_1296069_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000342738.1|1296242_1296956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064918.1|1297209_1297875_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000904136.1|1297867_1298230_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_024210728.1|1299292_1299571_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_000902695.1|1300084_1300297_-	type I toxin-antitoxin system hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	1.4e-26
WP_000206826.1|1300530_1300875_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|1300871_1301039_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_096857400.1|1301049_1301280_-	hypothetical protein	NA	S4TNB5	Salmonella_phage	69.7	2.2e-25
WP_000209146.1|1301313_1301532_-	hypothetical protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_032308166.1|1301564_1301777_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	1.7e-32
WP_077759583.1|1301909_1302290_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	64.1	5.3e-37
WP_000450863.1|1302290_1303061_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	1.8e-84
WP_032308164.1|1303090_1303831_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	82.7	1.8e-113
WP_032211818.1|1303837_1304791_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	50.8	3.1e-73
WP_032308163.1|1304813_1305239_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|1305222_1305498_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|1305601_1305991_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000380318.1|1306158_1306311_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_077788228.1|1306424_1306982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390585.1|1306929_1307172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032326794.1|1307089_1307440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450221.1|1307468_1307657_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092783.1|1307653_1307842_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_047090955.1|1307937_1310409_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.1	4.0e-56
WP_000113183.1|1310473_1310722_+	excisionase	NA	NA	NA	NA	NA
WP_000113694.1|1310699_1311830_+|integrase	integrase	integrase	O21940	Phage_21	51.4	2.0e-103
1312254:1312267	attR	ACCGATTTTATGGC	NA	NA	NA	NA
>prophage 4
NZ_CP027579	Escherichia coli strain 2013C-4282 chromosome, complete genome	5030044	1827008	1838958	5030044	integrase,plate,tail,transposase	Shigella_phage(69.23%)	14	1826651:1826665	1839032:1839046
1826651:1826665	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_000931964.1|1827008_1827371_+	GtrA family protein	NA	U5P0S6	Shigella_phage	86.7	3.9e-53
WP_000703623.1|1827367_1828282_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	88.5	8.1e-156
WP_106907552.1|1828309_1829749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998155.1|1830032_1830437_-|tail	tail fiber assembly protein	tail	Q9B026	Phage_GMSE-1	44.8	5.0e-17
WP_000554669.1|1830437_1831370_-	hypothetical protein	NA	U5P0I1	Shigella_phage	95.2	7.9e-50
WP_000383557.1|1831373_1831958_-	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785306.1|1831948_1833007_-|plate	phage baseplate protein	plate	Q8SBG4	Shigella_phage	99.4	9.5e-201
WP_023149016.1|1832993_1833422_-	phage protein GP46	NA	U5P0R9	Shigella_phage	99.3	5.2e-81
WP_001544766.1|1833418_1833967_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	1.1e-96
WP_001544767.1|1833966_1835046_-	hypothetical protein	NA	U5P0H6	Shigella_phage	99.4	2.2e-205
WP_106907553.1|1835042_1836413_-	DNA circularization protein	NA	S5FUX4	Shigella_phage	95.6	1.9e-246
WP_106907554.1|1836424_1836778_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	54.5	5.0e-29
WP_085949836.1|1836773_1837986_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_106907555.1|1837983_1838958_+|integrase	integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.4e-177
1839032:1839046	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 5
NZ_CP027579	Escherichia coli strain 2013C-4282 chromosome, complete genome	5030044	2063591	2134169	5030044	protease,integrase,terminase,tail,transposase,holin,lysis,head,tRNA,portal,capsid	Enterobacteria_phage(36.36%)	83	2074715:2074761	2123971:2124017
WP_000420946.1|2063591_2064725_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001100277.1|2064800_2066123_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.6	6.6e-34
WP_000383938.1|2067639_2069877_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001353378.1|2069863_2072836_+	phage receptor	NA	NA	NA	NA	NA
WP_001224565.1|2072836_2073727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071986676.1|2073640_2073853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177464.1|2073909_2074671_+	porin thermoregulatory protein EnvY	NA	NA	NA	NA	NA
WP_001443680.1|2074664_2074781_+	hypothetical protein	NA	NA	NA	NA	NA
2074715:2074761	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001385716.1|2074966_2075158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106907565.1|2075183_2076137_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_097742520.1|2076386_2077136_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085452879.1|2077681_2077942_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	76.7	3.2e-17
WP_106907794.1|2078040_2078667_+	methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2079171_2079354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097742519.1|2079432_2079933_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2079969_2080476_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488336.1|2080494_2081385_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000355602.1|2081640_2081934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551067.1|2081976_2083017_-	hypothetical protein	NA	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_000654155.1|2083026_2083308_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_106907566.1|2083307_2085683_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	68.8	1.8e-167
WP_050009806.1|2085747_2086347_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	91.5	1.7e-101
WP_106907567.1|2086414_2089810_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.6	0.0e+00
WP_001311619.1|2089870_2090542_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
WP_106907568.1|2090439_2091183_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.0e-148
WP_106907569.1|2091187_2091886_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	1.8e-131
WP_000847347.1|2091885_2092215_-|tail	tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840230.1|2092211_2094773_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000459457.1|2094765_2095200_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_106907570.1|2095181_2095604_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	8.2e-63
WP_062865217.1|2095619_2096360_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	99.2	2.9e-132
WP_000683142.1|2096367_2096763_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_106907571.1|2096759_2097338_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	1.5e-78
WP_000752994.1|2097349_2097703_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_085949836.1|2097884_2099097_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_106907572.1|2099101_2099371_-	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	92.1	1.1e-33
WP_000063263.1|2099411_2100437_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	97.4	1.2e-187
WP_001338090.1|2100492_2100825_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_106907573.1|2100834_2102154_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.7	3.8e-231
WP_106907574.1|2102134_2103736_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	4.6e-308
WP_000198149.1|2103732_2103939_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_106907575.1|2103935_2105861_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453558.1|2105835_2106381_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_032144691.1|2106520_2106622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001307652.1|2106769_2106964_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|2107326_2107620_+	hypothetical protein	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001082739.1|2107651_2108113_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	99.3	2.4e-76
WP_000075162.1|2108109_2108607_-	lysozyme	NA	A5LH83	Enterobacteria_phage	98.8	4.9e-91
WP_000839583.1|2108606_2108822_-|holin	holin	holin	M1FN85	Enterobacteria_phage	94.4	4.5e-33
WP_095522815.1|2108989_2109730_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000592551.1|2110039_2110999_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780585.1|2111191_2111716_+	membrane protein	NA	A0A1W6JNX6	Morganella_phage	54.1	4.2e-48
WP_072721625.1|2111871_2112249_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	1.6e-54
WP_095522816.1|2112267_2113257_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	2.5e-195
WP_059339195.1|2113264_2114074_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	1.8e-151
WP_024705348.1|2114093_2114483_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	9.2e-69
WP_053918604.1|2114479_2114806_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_059275986.1|2114802_2115456_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.5	2.5e-127
WP_095522817.1|2115455_2115950_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_042974103.1|2115946_2116888_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.0	3.1e-142
WP_001250269.1|2116877_2117057_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515828.1|2117232_2117784_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	2.6e-101
WP_000649477.1|2117827_2118028_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2118118_2118793_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_072094451.1|2119007_2119568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029130908.1|2119695_2119920_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	64.6	1.1e-13
WP_000135680.1|2119992_2120355_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_095522777.1|2120420_2121245_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	98.9	6.6e-149
WP_095522776.1|2121372_2121909_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	97.8	5.3e-99
WP_095522775.1|2121899_2122262_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.3	1.7e-64
WP_000206811.1|2122261_2122567_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_012599996.1|2122482_2122938_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	83.3	3.4e-62
WP_095522774.1|2122793_2123957_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	5.2e-200
WP_000805420.1|2124291_2124924_+	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2123971:2124017	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001353380.1|2124926_2125442_-	fimbriae assembly protein	NA	NA	NA	NA	NA
WP_000691081.1|2125452_2126460_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_074501009.1|2126472_2129082_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000988389.1|2129112_2129805_-	molecular chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|2130024_2130567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000729155.1|2131038_2131905_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190284.1|2131906_2132119_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001143557.1|2132226_2132748_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|2132783_2134169_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 6
NZ_CP027579	Escherichia coli strain 2013C-4282 chromosome, complete genome	5030044	2738759	2818411	5030044	integrase,terminase,tail,transposase,holin,head,tRNA,portal,capsid	Enterobacteria_phage(37.1%)	98	2765176:2765201	2821584:2821609
WP_001223153.1|2738759_2739446_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|2739845_2739986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|2740081_2740798_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000920296.1|2740857_2742210_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219627.1|2742267_2743692_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	1.1e-10
WP_001188682.1|2743691_2744381_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.3	1.1e-29
WP_000875487.1|2744393_2744867_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|2745077_2745947_+	right origin-binding protein	NA	NA	NA	NA	NA
WP_000942351.1|2745943_2746591_-	phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_022646480.1|2746642_2747158_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068675.1|2747151_2747478_-	Trp operon repressor	NA	NA	NA	NA	NA
WP_000409430.1|2747567_2749505_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	2.3e-11
WP_001328668.1|2749613_2749742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046749.1|2749715_2751383_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000007436.1|2751438_2751723_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000513551.1|2751724_2752057_-	toxin RelE	NA	NA	NA	NA	NA
WP_000093833.1|2752148_2753381_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|2753401_2754784_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|2754832_2755801_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|2755906_2756551_+	protein Smp	NA	NA	NA	NA	NA
WP_000105852.1|2756578_2757595_+	lipoate--protein ligase A	NA	NA	NA	NA	NA
WP_000566246.1|2757626_2757890_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000224877.1|2758050_2758770_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|2758826_2760050_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|2760101_2761424_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|2761563_2762343_-	2-deoxyribose-5-phosphate aldolase	NA	NA	NA	NA	NA
WP_106907606.1|2762601_2764152_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_039020382.1|2764123_2764987_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
2765176:2765201	attL	CGGATGCGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
WP_106907607.1|2765217_2766000_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_106907608.1|2765996_2767070_-	patatin family protein	NA	NA	NA	NA	NA
WP_001304521.1|2767191_2767371_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
WP_001295410.1|2767479_2768085_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202561.1|2768477_2770064_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001217539.1|2770283_2770532_+	DNA-damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000839978.1|2771140_2771374_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	87.0	1.9e-32
WP_000086527.1|2771754_2772345_+	Rac prophage; site-specific recombinase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001306187.1|2772572_2772866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001306186.1|2772908_2773949_-	peptidase S74	NA	A0A0E3M4A9	Enterobacteria_phage	67.6	6.4e-125
WP_000654169.1|2773958_2774240_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	9.1e-18
WP_001560746.1|2774239_2776615_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.5	4.3e-169
WP_001228249.1|2776679_2777279_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_106907609.1|2777346_2780826_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001311619.1|2780886_2781558_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.6	3.1e-104
WP_106907568.1|2781455_2782199_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.0e-148
WP_001152461.1|2782203_2782902_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.0	1.2e-130
WP_000847355.1|2782901_2783231_-|tail	tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_021552712.1|2783227_2785789_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	88.4	0.0e+00
WP_106907610.1|2785781_2786216_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	2.9e-63
WP_000479202.1|2786197_2786611_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	7.0e-67
WP_001306179.1|2786626_2787367_-|tail	tail protein	tail	A0A2I6TC77	Escherichia_phage	99.6	7.8e-133
WP_021552710.1|2787374_2787770_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	4.2e-69
WP_000975067.1|2787766_2788345_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_001204538.1|2788355_2788709_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	66.7	3.1e-39
WP_077634771.1|2788701_2789124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541217.1|2789127_2790156_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	3.5e-115
WP_000256840.1|2790213_2790561_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253996.1|2790597_2792103_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001306178.1|2792092_2793685_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.9e-184
WP_001452166.1|2793681_2793819_-|head	head completion protein	head	K7PM10	Enterobacteria_phage	58.5	2.5e-05
WP_085949836.1|2793828_2795042_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
WP_106907611.1|2795062_2795149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106907612.1|2795132_2797061_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.5e-260
WP_001519435.1|2797032_2797539_-	hypothetical protein	NA	O64316	Escherichia_phage	48.5	3.3e-34
WP_001300120.1|2797966_2798161_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000548592.1|2798411_2798618_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|2798913_2799087_-	protein GnsB	NA	NA	NA	NA	NA
WP_001443523.1|2799259_2799415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|2799562_2799751_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2799761_2799974_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|2800337_2800835_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001101173.1|2800831_2801365_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001306174.1|2801478_2801739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193256.1|2801686_2802238_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	50.6	1.1e-35
WP_000839580.1|2802242_2802458_-|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	1.9e-31
WP_000066486.1|2803210_2803426_-	cold-shock protein CspB	NA	A0A1W6JNX5	Morganella_phage	75.0	5.9e-25
WP_000087755.1|2803725_2803938_+	cold-shock protein CspF	NA	NA	NA	NA	NA
WP_106907613.1|2804360_2805113_-	antitermination protein	NA	Q8SBE4	Shigella_phage	96.4	1.5e-131
WP_001372091.1|2805126_2806116_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.4	1.2e-194
WP_021536723.1|2806123_2806933_-	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	95.5	5.7e-145
WP_000767113.1|2806952_2807342_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_077473450.1|2807338_2807698_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	95.4	7.2e-52
WP_106907614.1|2807664_2808159_-	hypothetical protein	NA	K7PJR0	Enterobacteria_phage	98.1	1.4e-85
WP_042098550.1|2808155_2808974_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	8.9e-122
WP_000620701.1|2808970_2809195_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	9.7e-39
WP_106907615.1|2809191_2810343_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	97.9	2.0e-212
WP_000515842.1|2810339_2810891_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.3	3.2e-99
WP_001401082.1|2810883_2811144_-	XRE family transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	97.7	3.9e-39
WP_023154561.1|2811115_2811268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311077.1|2811241_2811934_+	XRE family transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_032149880.1|2812013_2812268_+	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.7e-13
WP_000135680.1|2812656_2813019_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|2813084_2813909_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008174.1|2814036_2814573_+	HD family hydrolase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_001565177.1|2814563_2814926_+	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_106907616.1|2814925_2815705_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	71.4	6.7e-103
WP_001061359.1|2815704_2815899_+	DNA-binding protein	NA	A5LH59	Enterobacteria_phage	95.3	4.9e-31
WP_106907617.1|2816181_2816901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402824.1|2817187_2818411_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.3	3.1e-235
2821584:2821609	attR	CGGATGCGGCGTGAACGCCTTATCCG	NA	NA	NA	NA
>prophage 7
NZ_CP027579	Escherichia coli strain 2013C-4282 chromosome, complete genome	5030044	4701499	4708639	5030044		Escherichia_phage(83.33%)	6	NA	NA
WP_088542239.1|4701499_4702138_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	6.3e-83
WP_106907761.1|4702134_4703397_-	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	61.2	1.4e-134
WP_000847985.1|4703393_4704302_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001295181.1|4704497_4705265_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_046081189.1|4705315_4705972_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	5.0e-51
WP_105267251.1|4706077_4708639_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.9e-30
>prophage 1
NZ_CP027581	Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence	118822	57833	66665	118822	integrase	Escherichia_phage(25.0%)	12	55455:55467	58771:58783
55455:55467	attL	TAATAATCAATAA	NA	NA	NA	NA
WP_052892429.1|57833_58643_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000239527.1|58780_59056_-	hypothetical protein	NA	NA	NA	NA	NA
58771:58783	attR	TTATTGATTATTA	NA	NA	NA	NA
WP_000633912.1|59049_59694_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	1.9e-39
WP_001103695.1|59922_60894_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_077630267.1|60862_61291_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_001365560.1|61295_61544_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.0	1.5e-19
WP_001365565.1|61573_62566_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
WP_000109074.1|62565_63003_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
WP_000618108.1|62999_63248_-	protein ImpC	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_077629773.1|63523_64426_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032236829.1|64429_64735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000125552.1|64964_66665_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.4	1.1e-171
