The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	473	9912	5077228		Escherichia_phage(81.82%)	17	NA	NA
WP_000753060.1|473_650_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001224672.1|642_825_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_106884582.1|969_1275_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	1.3e-49
WP_106884707.1|1271_1553_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	76.7	1.6e-30
WP_106884583.1|1585_2302_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.7	5.8e-77
WP_158707421.1|2335_2878_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	3.6e-79
WP_136719337.1|2789_3821_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	70.4	5.3e-87
WP_000693925.1|3889_4315_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047083516.1|4298_4574_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	51.2	2.4e-15
WP_033812093.1|4681_5182_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_033812094.1|5199_5391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033812095.1|5390_5681_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_106884585.1|5949_6102_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	5.6e-06
WP_028985610.1|6113_6488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450221.1|7001_7190_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|7186_7375_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106884587.1|7467_9912_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.2	2.2e-176
>prophage 2
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	245177	343493	5077228	tRNA,portal,lysis,protease,terminase,plate,tail,transposase,head,integrase,capsid	Salmonella_phage(54.24%)	97	238132:238147	346438:346453
238132:238147	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|245177_246470_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067767.1|246560_247904_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|247914_248526_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077054.1|248680_252748_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|252882_253377_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|253921_254887_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043602.1|255009_256776_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001202179.1|256776_258498_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	6.4e-21
WP_001241678.1|258539_259244_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|259528_259747_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000350179.1|260729_261284_-	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001029754.1|261294_262296_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	39.9	1.8e-47
WP_000120900.1|262306_263230_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_000415804.1|263226_264534_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001101569.1|264864_268098_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.8	2.8e-62
WP_000097888.1|268094_269078_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	2.9e-42
WP_000934053.1|270330_272607_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000241204.1|272637_272958_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|273280_273505_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|273577_275524_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|275520_276636_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|276786_277743_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|277739_279398_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001356126.1|279823_280519_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|281013_281913_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|282056_283709_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|283720_284689_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_106879083.1|284821_286540_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.8e-31
WP_000566372.1|286576_287578_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|287588_289019_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|289117_290131_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|290127_290958_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|290954_291278_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270735.1|291403_291919_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|292136_292865_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|292882_293614_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|293620_294337_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|294336_295005_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_000399648.1|295144_296125_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001295905.1|296575_297307_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_106884590.1|297481_298609_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_000389260.1|298649_299138_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|299197_300043_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093862.1|300039_300993_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996018.1|301002_302136_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126055.1|302230_303343_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|303693_304170_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|304257_305160_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189120.1|305220_305943_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|305926_306214_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|306373_306631_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|306660_307038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|307307_308993_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|309228_309447_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_046201500.1|309537_310638_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.5	1.7e-176
WP_000980396.1|310634_311120_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_046201501.1|311116_314194_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.4	0.0e+00
WP_000763311.1|314186_314306_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281013.1|314320_314623_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_001504081.1|314677_315193_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001726272.1|315202_316375_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_000905033.1|316516_317083_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_071886254.1|317110_317500_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	70.0	2.8e-09
WP_106884591.1|317501_317945_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.4	2.7e-56
WP_000367939.1|317916_318519_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	7.8e-99
WP_001086820.1|320055_320661_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_000268301.1|320653_321562_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_106879080.1|321548_321908_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	1.6e-51
WP_039516405.1|321904_322483_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
WP_106879079.1|322551_322998_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	3.0e-63
WP_001039945.1|322990_323422_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_096970344.1|323517_323946_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	90.1	3.6e-58
WP_001573376.1|323942_324458_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	1.6e-89
WP_000171568.1|324438_324654_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868192.1|324657_324861_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_106879078.1|324860_325325_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	3.2e-76
WP_106879077.1|325420_326071_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_106879076.1|326074_327133_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	1.9e-180
WP_106879075.1|327149_327983_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.5	7.7e-121
WP_089640747.1|328125_329892_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_104807779.1|329891_330917_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.2	1.4e-172
WP_130723475.1|331001_331490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086258518.1|331495_331810_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_052928646.1|331812_332880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032248694.1|333246_334407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001154428.1|334577_334766_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	93.4	5.1e-25
WP_106879073.1|334919_337334_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_106879072.1|337330_338188_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	3.9e-160
WP_000752613.1|338184_338412_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244165.1|338411_338645_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000963472.1|338712_339054_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_023150404.1|339017_339218_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
WP_000460901.1|339225_339735_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000188448.1|339767_339989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106879071.1|340084_340681_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_023150405.1|340701_342378_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
WP_000290938.1|342461_343493_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
346438:346453	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 3
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	644903	704087	5077228	portal,lysis,protease,terminase,tail,transposase,head,integrase,capsid	Enterobacteria_phage(57.63%)	72	653384:653430	704101:704147
WP_000394594.1|644903_646040_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383945.1|646308_648546_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|648532_651505_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224567.1|651505_652396_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|652578_653340_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
653384:653430	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|653852_654806_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|654992_656477_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|656660_656966_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239874.1|657022_657691_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|658056_658170_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|658238_658472_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|658788_659379_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|659476_660052_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001233071.1|663075_663675_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_061091987.1|663745_667159_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_000090895.1|667219_667852_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|667788_668532_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152639.1|668537_669236_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847379.1|669235_669565_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001774776.1|669561_672141_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
WP_000459457.1|672133_672568_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|672549_672972_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_001378767.1|672987_673728_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000683142.1|673735_674131_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_000975110.1|674127_674706_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	5.0e-79
WP_000752994.1|674717_675071_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158880.1|675082_675478_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000063221.1|675519_676545_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_001378764.1|676600_676933_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	4.2e-54
WP_000123309.1|676942_678262_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_001369921.1|678242_679844_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000198149.1|679840_680047_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027283.1|680043_681969_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_063082806.1|681943_682489_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001415975.1|682877_683072_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000738423.1|683431_683725_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|683815_683998_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|684214_684712_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|684711_684927_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|685515_686613_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_001204791.1|686802_687186_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971068.1|687271_687412_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001099700.1|687408_687771_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000774488.1|687767_688058_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000080195.1|688125_689739_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|689769_690120_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|690116_690542_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_106884597.1|690623_690761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|690760_691216_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_001309322.1|691212_691314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|691412_692342_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001365992.1|692615_692753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|692975_694502_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_032139864.1|694559_694667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|694758_695091_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|695158_695461_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788786.1|695457_696159_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.3e-129
WP_001378761.1|696155_697085_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	67.6	1.0e-110
WP_001182893.1|697171_697711_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	66.5	2.2e-60
WP_001067458.1|697780_698011_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|698115_698805_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_023143023.1|699316_699607_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.6	4.2e-26
WP_000995453.1|699682_699979_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.8e-48
WP_000100847.1|699984_700770_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|700766_701447_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|701443_701626_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|701598_701790_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|701800_702082_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|702180_702399_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|702446_702725_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|702696_703068_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|702923_704087_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
704101:704147	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 4
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	1017473	1079794	5077228	plate,tRNA,protease,transposase	Cronobacter_phage(12.5%)	52	NA	NA
WP_000611742.1|1017473_1017887_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|1017890_1019741_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|1019704_1020787_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113703.1|1020811_1022092_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080144.1|1022088_1022613_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|1022615_1023947_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|1023951_1024713_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614336.1|1024721_1027481_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	8.0e-82
WP_000088873.1|1027477_1028221_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240543.1|1028225_1029641_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_136760237.1|1029749_1033184_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000377959.1|1033194_1034547_+	membrane protein	NA	NA	NA	NA	NA
WP_001284199.1|1034570_1035053_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|1035096_1036011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064549407.1|1036020_1036500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|1036636_1037422_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|1037961_1038693_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|1038757_1039225_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1039221_1039944_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|1039977_1040733_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1040804_1042163_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211710.1|1042210_1042981_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1043058_1043859_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|1044099_1045014_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053276656.1|1045010_1045814_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	3.2e-39
WP_001140187.1|1051699_1052275_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1052462_1053494_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1053486_1054140_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874226.1|1054179_1054995_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1055112_1055517_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|1055513_1056221_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|1056331_1058050_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001346133.1|1058102_1058927_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|1059130_1060111_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|1060360_1061071_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|1061084_1061507_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|1061503_1062049_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|1062214_1062415_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|1062401_1062662_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176573.1|1062710_1064009_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|1064073_1064463_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|1064519_1066661_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|1066759_1067719_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_106884605.1|1067731_1071214_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	8.2e-209
WP_053276502.1|1071250_1071847_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.5	2.7e-27
WP_000139654.1|1071843_1072992_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|1072991_1073780_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|1073783_1074239_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|1074343_1075369_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|1075372_1075858_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|1075979_1078412_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001325807.1|1078441_1079794_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 5
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	1714387	1762288	5077228	tRNA,holin,portal,lysis,protease,terminase,tail,integrase	Escherichia_phage(45.76%)	60	1710839:1710852	1732183:1732196
1710839:1710852	attL	GCTGACGATATTCA	NA	NA	NA	NA
WP_000543828.1|1714387_1715425_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|1715513_1716611_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_001217557.1|1716672_1716921_+	DinI family protein	NA	S5MQI1	Escherichia_phage	100.0	8.3e-39
WP_001373129.1|1717190_1717865_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_099528419.1|1718099_1719758_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.4	5.9e-72
WP_000078855.1|1719901_1720042_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	93.5	8.5e-17
WP_106884614.1|1720240_1723927_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.3	0.0e+00
WP_136754566.1|1724167_1724800_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.0	3.7e-99
WP_001365876.1|1725498_1726197_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000847298.1|1726196_1726526_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_047087056.1|1726522_1729168_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.2	0.0e+00
WP_000532074.1|1729211_1729520_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	100.0	7.8e-55
WP_000479054.1|1729546_1729969_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_000174601.1|1729984_1730734_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	99.6	4.7e-138
WP_000682704.1|1730741_1731140_-	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000974964.1|1731149_1731776_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_001281344.1|1731778_1732060_-	hypothetical protein	NA	S5MDP9	Escherichia_phage	100.0	7.2e-47
WP_001097058.1|1732052_1732379_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	100.0	6.1e-50
1732183:1732196	attR	TGAATATCGTCAGC	NA	NA	NA	NA
WP_001114418.1|1732466_1734491_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	100.0	0.0e+00
WP_000974564.1|1734435_1735938_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102415.1|1735937_1736150_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_047087055.1|1736146_1738270_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.6	0.0e+00
WP_000348565.1|1738266_1738743_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_032307093.1|1739195_1739663_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	86.5	4.8e-64
WP_032307092.1|1739659_1740193_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	93.8	6.9e-99
WP_000406285.1|1740317_1740605_+	hypothetical protein	NA	I6S632	Salmonella_phage	55.8	1.4e-21
WP_001371270.1|1740609_1740837_-	DUF1327 domain-containing protein	NA	Q5G8W5	Enterobacteria_phage	50.7	4.6e-12
WP_032307095.1|1740864_1741422_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.7	8.9e-49
WP_000284506.1|1741425_1741641_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|1741718_1741964_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|1742004_1742184_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_047086944.1|1742333_1744280_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	96.5	0.0e+00
WP_000738072.1|1744792_1745062_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_032360617.1|1745073_1746033_-	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	2.1e-175
WP_000483502.1|1746415_1747474_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	2.0e-206
WP_000917735.1|1747625_1747823_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_001204806.1|1748038_1748419_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_001202275.1|1748436_1749426_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.7e-194
WP_001061404.1|1749433_1750231_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_000767113.1|1750250_1750640_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210167.1|1750636_1750963_-	LexA family transcriptional regulator	NA	S5FXP5	Shigella_phage	99.1	2.7e-53
WP_001355692.1|1750959_1751613_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_032307264.1|1751707_1752526_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZCQ6	Stx2-converting_phage	98.5	1.1e-119
WP_032307262.1|1752522_1752747_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	97.3	3.1e-37
WP_032307261.1|1752743_1753895_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	98.4	2.6e-212
WP_000515856.1|1753891_1754443_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	100.0	3.4e-101
WP_001191670.1|1754435_1754696_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
WP_001020631.1|1754793_1755486_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	1.4e-120
WP_000135680.1|1756264_1756627_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1756692_1757517_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008232.1|1757644_1758181_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_001242733.1|1758171_1758534_+	phage protein	NA	S5MC15	Escherichia_phage	100.0	1.6e-67
WP_000111288.1|1758530_1758734_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	100.0	4.7e-32
WP_000476212.1|1758726_1758966_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	100.0	4.4e-37
WP_001289980.1|1758962_1759517_+	ead/Ea22-like family protein	NA	S5M7T0	Escherichia_phage	100.0	1.8e-102
WP_001014290.1|1759518_1759710_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	98.4	3.3e-27
WP_001094869.1|1759712_1760447_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	100.0	2.2e-140
WP_001061345.1|1760446_1761019_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	100.0	2.4e-110
WP_001093917.1|1761055_1761337_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_000956557.1|1761754_1762288_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 6
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	3300046	3307186	5077228		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3300046_3300685_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590397.1|3300681_3301944_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3301940_3302849_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|3303044_3303812_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141325.1|3303862_3304519_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.6e-49
WP_001272897.1|3304624_3307186_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 7
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	3379579	3387342	5077228	integrase,transposase	Escherichia_phage(66.67%)	6	3370739:3370752	3387652:3387665
3370739:3370752	attL	TACCGCCGCAGTCA	NA	NA	NA	NA
WP_085947771.1|3379579_3380741_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000577258.1|3380893_3382612_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	95.5	5.2e-305
WP_000214990.1|3382613_3384362_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000448925.1|3384432_3384849_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001341819.1|3384887_3386117_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000162574.1|3386859_3387342_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3387652:3387665	attR	TGACTGCGGCGGTA	NA	NA	NA	NA
>prophage 8
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	3871671	3959605	5077228	tRNA,holin,portal,lysis,terminase,tail,head,integrase,capsid	Enterobacteria_phage(42.86%)	88	3869272:3869305	3949562:3949595
3869272:3869305	attL	TATACTCGTCATACTTCAAGTTGCATGTGCTGCG	NA	NA	NA	NA
WP_000968208.1|3871671_3872367_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_001295452.1|3872363_3872762_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_001264868.1|3873000_3873951_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|3874338_3874422_-	protein YohP	NA	NA	NA	NA	NA
WP_001078114.1|3874645_3876082_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079526.1|3876134_3876896_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001296821.1|3877025_3877604_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|3877773_3878361_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001319943.1|3878534_3879467_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_106884636.1|3879504_3881220_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_053276441.1|3881415_3883713_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001130306.1|3883923_3884841_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221805.1|3884847_3886005_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569329.1|3885997_3886924_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|3886928_3887660_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|3887640_3887748_-	protein YohO	NA	NA	NA	NA	NA
WP_042101647.1|3887807_3888494_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
WP_000063646.1|3888529_3889816_-|integrase	site-specific integrase	integrase	A0A0N7KZF5	Stx2-converting_phage	100.0	5.8e-253
WP_001193437.1|3889849_3890104_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001373430.1|3890295_3890667_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	4.7e-62
WP_000720075.1|3890707_3891535_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	98.9	4.8e-131
WP_032253186.1|3891904_3892477_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	70.7	1.0e-76
WP_000553978.1|3892482_3892665_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.1e-08
WP_000147360.1|3892862_3893063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387833.1|3893068_3893761_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.0e-38
WP_000800143.1|3893908_3894598_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	87.8	6.8e-115
WP_000944728.1|3894754_3894988_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_001090267.1|3895069_3895777_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	81.6	3.8e-105
WP_040077782.1|3895796_3895976_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	86.4	1.7e-25
WP_024173711.1|3895953_3896817_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	82.5	8.8e-128
WP_106884637.1|3896813_3897038_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	2.2e-14
WP_000095568.1|3897034_3897961_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	93.2	2.5e-157
WP_106884638.1|3897971_3898850_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	95.6	7.8e-140
WP_000203853.1|3898846_3900247_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	4.1e-244
WP_106884639.1|3900243_3900501_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	2.8e-21
WP_001202274.1|3900553_3901543_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	2.0e-192
WP_001204795.1|3901560_3901953_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	57.6	2.7e-36
WP_000917741.1|3902870_3903068_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_000935527.1|3903218_3904277_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.6	1.9e-193
WP_001365055.1|3904659_3905619_+	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000738072.1|3905630_3905900_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_047090759.1|3906197_3906521_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	98.1	6.5e-60
WP_106884640.1|3906764_3908729_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.6	4.2e-295
WP_000284490.1|3909223_3909439_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001041949.1|3909442_3910234_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_024199769.1|3910322_3910610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092875.1|3910744_3911278_+	lysozyme	NA	Q08J98	Stx2-converting_phage	95.5	1.1e-99
WP_001056888.1|3911552_3912125_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_000443009.1|3912124_3912274_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.6	6.7e-12
WP_032209690.1|3912276_3912714_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_001109017.1|3912916_3913459_+	hypothetical protein	NA	A0A088CBJ5	Shigella_phage	98.9	4.1e-99
WP_001102148.1|3914121_3914670_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	82.7	1.0e-57
WP_106884642.1|3914599_3916570_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.2	1.2e-260
WP_000259002.1|3916553_3916760_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021293160.1|3916756_3918349_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	3.4e-186
WP_047091051.1|3918338_3919844_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.0e-99
WP_000256803.1|3919880_3920228_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522634.1|3920285_3921314_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.3e-114
WP_001373367.1|3921365_3921749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204531.1|3921741_3922095_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.8e-40
WP_000974993.1|3922110_3922686_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_000683075.1|3922682_3923078_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_000235126.1|3923085_3923835_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_001373378.1|3923850_3924282_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	8.2e-42
WP_000533452.1|3924308_3924722_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	84.8	1.9e-43
WP_106884643.1|3924702_3927276_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.6	0.0e+00
WP_000847280.1|3927272_3927602_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_106884644.1|3927601_3928300_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_106884645.1|3928310_3929054_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	93.9	5.4e-142
WP_136757970.1|3928999_3929596_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	72.9	1.0e-79
WP_106884647.1|3930505_3934192_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.0	0.0e+00
WP_000078853.1|3934390_3934531_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_064579206.1|3934675_3936388_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.7	5.9e-67
WP_000438829.1|3936397_3936610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064579209.1|3936621_3937296_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.7	5.6e-114
WP_001217533.1|3937565_3937814_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	86.6	1.0e-33
WP_001295431.1|3938328_3940014_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3940010_3940730_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|3940776_3941247_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|3941286_3941748_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001356047.1|3941872_3943873_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001292774.1|3943869_3945006_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001294360.1|3944998_3947278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074859.1|3947288_3948377_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636923.1|3949616_3949934_-	hypothetical protein	NA	NA	NA	NA	NA
3949562:3949595	attR	TATACTCGTCATACTTCAAGTTGCATGTGCTGCG	NA	NA	NA	NA
WP_000356746.1|3949994_3953627_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_053276442.1|3953636_3957431_-	WGR and DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001295427.1|3957571_3959605_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 9
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	4493979	4555741	5077228	holin,portal,protease,terminase,tail,integrase	Escherichia_phage(44.23%)	71	4522347:4522363	4541613:4541629
WP_001760064.1|4493979_4496406_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_001356084.1|4496604_4496910_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001704511.1|4497017_4497728_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|4497730_4498291_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705198.1|4498325_4498667_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001295394.1|4499332_4500547_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001696244.1|4500558_4501578_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	1.9e-17
WP_072094462.1|4501635_4501743_+	transporter	NA	NA	NA	NA	NA
WP_106884659.1|4501771_4503046_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	61.5	5.2e-153
WP_001368608.1|4503081_4503318_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000034486.1|4503403_4505875_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	2.4e-53
WP_000092782.1|4505970_4506159_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|4506155_4506344_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000389971.1|4506890_4507076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993601.1|4507156_4507414_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	1.4e-09
WP_000380319.1|4507569_4507722_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000948456.1|4508034_4508511_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000712070.1|4508635_4508959_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.4e-09
WP_000693925.1|4508942_4509368_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_137533924.1|4509436_4510468_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	71.2	1.3e-88
WP_158707423.1|4510379_4510922_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.3e-78
WP_047082289.1|4510955_4511672_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	8.7e-73
WP_053294093.1|4511981_4512287_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.1	1.7e-49
WP_001224672.1|4512434_4512617_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_001289992.1|4512782_4513298_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.6	1.1e-37
WP_096955108.1|4513531_4513744_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	78.6	6.6e-21
WP_032245807.1|4514183_4515233_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	8.5e-109
WP_000904153.1|4515245_4515605_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	5.6e-36
WP_106884661.1|4515613_4516144_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	8.7e-70
WP_000917741.1|4516386_4516584_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_106884662.1|4516735_4517794_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.3	9.5e-193
WP_000649753.1|4518175_4519135_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738072.1|4519146_4519416_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_106884663.1|4519927_4521874_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.8	0.0e+00
WP_000143459.1|4522024_4522204_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_001290230.1|4522244_4522490_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
4522347:4522363	attL	GAAGCGCGTCTTGATGC	NA	NA	NA	NA
WP_000284506.1|4522567_4522783_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_106884712.1|4522786_4523272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092868.1|4523783_4524317_+	lysozyme	NA	G9L6J6	Escherichia_phage	95.5	1.1e-99
WP_012816791.1|4524835_4525021_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373398.1|4525495_4525972_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	98.7	1.8e-82
WP_001077607.1|4525968_4526976_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	100.0	8.2e-202
WP_106884664.1|4527137_4528376_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	1.5e-59
WP_106884665.1|4528368_4528593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106884666.1|4529374_4530460_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_106884667.1|4530449_4530689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032308184.1|4530681_4530915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204993.1|4530907_4531141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|4531146_4531446_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_060612367.1|4531442_4532852_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	59.5	6.9e-114
WP_077632764.1|4533054_4533312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581018.1|4533301_4533574_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860398.1|4534223_4536113_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.4	3.6e-182
WP_000133409.1|4536370_4536652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102415.1|4538144_4538357_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|4538356_4539859_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_158707424.1|4539803_4541828_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.4	0.0e+00
4541613:4541629	attR	GAAGCGCGTCTTGATGC	NA	NA	NA	NA
WP_001097065.1|4541915_4542242_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_047082261.1|4542234_4542516_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	6.1e-46
WP_106884668.1|4542518_4543142_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	98.6	2.9e-104
WP_000682716.1|4543154_4543553_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_106884669.1|4543560_4544310_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.0	1.1e-129
WP_032330778.1|4544329_4544761_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	1.5e-40
WP_047081971.1|4544787_4545192_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	77.5	4.5e-42
WP_106884670.1|4545181_4547788_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
WP_000847279.1|4547784_4548114_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_106884671.1|4548113_4548812_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.6	3.0e-134
WP_106884672.1|4548822_4549566_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	9.5e-147
WP_122993618.1|4549511_4550144_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_000078853.1|4554269_4554410_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106884673.1|4554553_4555741_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.1e-55
>prophage 10
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	4840145	4908085	5077228	holin,lysis,protease,terminase,tail,head,integrase,capsid	Stx2-converting_phage(26.53%)	73	4853924:4853951	4908234:4908261
WP_000422045.1|4840145_4841195_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559283.1|4841414_4842173_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_001278904.1|4842169_4842760_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|4842799_4843672_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|4843772_4844393_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|4844389_4845271_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|4845408_4845453_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194590.1|4845544_4847107_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|4847106_4848702_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001297118.1|4848705_4850064_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000209520.1|4850075_4851269_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_106884681.1|4851268_4852075_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|4852455_4852635_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|4852720_4853221_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|4853266_4853773_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
4853924:4853951	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000211405.1|4854419_4854980_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
WP_106884682.1|4855491_4857450_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.6	7.7e-172
WP_001270059.1|4857601_4858225_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_141068677.1|4862897_4863530_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	5.1e-101
WP_106884683.1|4863475_4864219_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	1.2e-149
WP_001365876.1|4864229_4864928_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_000343411.1|4864927_4865269_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_106884684.1|4865261_4868504_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.9	0.0e+00
WP_001513217.1|4868551_4868761_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|4868856_4869231_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_106884685.1|4869245_4869962_-|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	8.0e-127
WP_106884686.1|4870027_4870372_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	97.4	2.3e-55
WP_000573358.1|4870368_4870815_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_001029274.1|4870811_4871162_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_106884687.1|4871171_4871498_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.0e-53
WP_001063099.1|4874024_4874246_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|4874290_4876228_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_106884688.1|4876291_4877953_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_062873395.1|4877949_4878507_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	76.7	5.8e-64
WP_000829192.1|4878790_4879156_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|4879197_4879398_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|4879529_4879856_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000881332.1|4880192_4880807_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	1.1e-63
WP_024210595.1|4880918_4881386_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	3.6e-67
WP_072024677.1|4881534_4881717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050877483.1|4881873_4882407_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	3.6e-100
WP_001041949.1|4882918_4883710_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284490.1|4883713_4883929_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_001290210.1|4884006_4884252_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000142780.1|4884292_4884472_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_106884689.1|4884606_4886571_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.2	5.9e-297
WP_000382065.1|4888433_4889159_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000271629.1|4889855_4890284_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_032308170.1|4890763_4891822_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000917733.1|4891973_4892171_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000342738.1|4892344_4893058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050868118.1|4893311_4893977_-	antiterminator	NA	I6PDF8	Cronobacter_phage	52.4	9.3e-61
WP_000904136.1|4893969_4894332_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001265189.1|4894344_4895394_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_064758325.1|4895395_4895665_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	7.9e-11
WP_001452497.1|4895718_4895946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050868074.1|4896534_4896852_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|4896954_4897167_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_050868072.1|4897381_4897933_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	57.1	7.2e-43
WP_000215512.1|4898284_4898470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|4898529_4899291_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|4899320_4900061_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000054520.1|4900067_4901033_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000705131.1|4901013_4901535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021293151.1|4901518_4901749_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_021293150.1|4901832_4902240_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	53.1	2.9e-12
WP_106884690.1|4902404_4902557_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	52.1	5.1e-07
WP_106884714.1|4902568_4902937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|4903720_4903909_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092783.1|4903905_4904094_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106884692.1|4904189_4906661_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	3.1e-53
WP_000113186.1|4906725_4906974_+	excisionase	NA	NA	NA	NA	NA
WP_044862987.1|4906951_4908085_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.1	5.8e-103
4908234:4908261	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 11
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	5011664	5028105	5077228	tRNA,portal,protease,terminase,head,capsid	uncultured_Caudovirales_phage(90.0%)	19	NA	NA
WP_001297484.1|5011664_5012771_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|5012806_5013448_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423750.1|5013451_5014822_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
WP_001265481.1|5014989_5015661_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|5015660_5017121_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133415.1|5017970_5018252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127881.1|5018265_5019927_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
WP_000113645.1|5019910_5020267_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|5020555_5020996_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134113.1|5020995_5021292_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020671.1|5021288_5021627_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	1.5e-30
WP_001398592.1|5021623_5022799_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504057.1|5022836_5023409_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001137342.1|5023448_5024606_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_001142405.1|5024897_5025122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106884694.1|5025522_5025933_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032317163.1|5025942_5026140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024200918.1|5026253_5026505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833612.1|5026707_5028105_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.2	1.5e-113
>prophage 12
NZ_CP027449	Escherichia coli strain 2014C-3097 chromosome, complete genome	5077228	5031282	5076955	5077228	holin,portal,terminase,tail,head,integrase,capsid	Escherichia_phage(33.33%)	50	5031221:5031235	5032577:5032591
5031221:5031235	attL	TTGTTTCACGTTGTA	NA	NA	NA	NA
WP_032326825.1|5031282_5032512_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.5e-133
WP_001295435.1|5032760_5033882_+	cupin domain-containing protein	NA	NA	NA	NA	NA
5032577:5032591	attR	TACAACGTGAAACAA	NA	NA	NA	NA
WP_000359461.1|5034027_5035257_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|5035506_5036643_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799399.1|5036626_5037490_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_022581964.1|5037655_5037985_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001373129.1|5038148_5038823_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_000438830.1|5038834_5039047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106884695.1|5039056_5040715_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	53.6	2.0e-72
WP_000078853.1|5040858_5040999_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106884696.1|5041197_5044884_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.1	0.0e+00
WP_136757970.1|5045793_5046390_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	72.9	1.0e-79
WP_106884697.1|5046335_5047079_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	94.3	1.6e-141
WP_106884698.1|5047089_5047788_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	4.0e-131
WP_000738904.1|5047998_5049162_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_106884699.1|5049360_5049702_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	9.9e-51
WP_106884700.1|5049694_5052937_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.9	0.0e+00
WP_122993267.1|5052984_5053194_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710934.1|5053289_5053664_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_044803714.1|5053678_5054395_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	4.0e-126
WP_000133383.1|5054461_5054806_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573358.1|5054802_5055249_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_001029274.1|5055245_5055596_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000125990.1|5055605_5055932_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_106884701.1|5055928_5058514_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.7	0.0e+00
WP_001063099.1|5058459_5058681_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|5058725_5060663_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001376400.1|5060726_5062388_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_062873395.1|5062384_5062942_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	76.7	5.8e-64
WP_044808587.1|5063225_5063591_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000095744.1|5063632_5063833_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828070.1|5063964_5064291_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000735655.1|5064635_5064860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|5064924_5065131_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_062896309.1|5065499_5065682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106884702.1|5065838_5066372_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	9.0e-99
WP_050487815.1|5066883_5067369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000284510.1|5067372_5067588_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290208.1|5067665_5067911_-	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000143459.1|5067951_5068131_-	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_106884703.1|5068266_5070204_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	93.8	0.0e+00
WP_044803553.1|5070447_5070771_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	99.1	5.9e-61
WP_000738072.1|5071068_5071338_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_000649751.1|5071349_5072309_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_106884704.1|5072691_5073750_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	8.9e-207
WP_000917735.1|5073901_5074099_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_001367730.1|5074340_5074871_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	71.4	6.0e-71
WP_158707425.1|5076119_5076302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341173.1|5076303_5076576_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_106884706.1|5076742_5076955_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	65.7	7.1e-15
>prophage 1
NZ_CP027451	Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence	173649	92417	97581	173649		Cronobacter_phage(33.33%)	8	NA	NA
WP_000587689.1|92417_93044_-	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
WP_001369986.1|93239_93473_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	56.6	2.0e-18
WP_001365565.1|93517_94510_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
WP_000109075.1|94493_94946_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	52.0	1.1e-25
WP_000618108.1|94942_95191_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_001373099.1|95609_96512_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032236829.1|96515_96821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086114.1|96897_97581_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.1e-30
