The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027371	Escherichia coli strain 2015C-3905 chromosome, complete genome	4901620	438381	505247	4901620	tail,protease,lysis,capsid,portal,tRNA,transposase,terminase,head,integrase	Enterobacteria_phage(55.17%)	79	448543:448589	496721:496767
WP_000912345.1|438381_439767_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143565.1|439802_440324_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|440431_440644_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|440645_441512_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|441992_442535_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_106879065.1|442754_443447_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001356128.1|443477_446087_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_106879066.1|446099_447107_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250424.1|447117_447633_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|447635_448268_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
448543:448589	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|448602_449766_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|449621_449993_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|449964_450243_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|450290_450509_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|450607_450889_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|450899_451091_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|451063_451246_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|451242_451923_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|451919_452705_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995453.1|452710_453007_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.8e-48
WP_023143023.1|453082_453373_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.6	4.2e-26
WP_000858975.1|453884_454574_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|454678_454909_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182893.1|454978_455518_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	66.5	2.2e-60
WP_001378761.1|455604_456534_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	67.6	1.0e-110
WP_000788786.1|456530_457232_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.6	1.3e-129
WP_000145915.1|457228_457531_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070442.1|457598_457931_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032139864.1|458022_458130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709069.1|458187_459714_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	6.1e-31
WP_001365992.1|459936_460074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000068668.1|460347_461277_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_001309322.1|461375_461477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053033.1|461473_461929_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.7e-61
WP_000224919.1|461928_462099_+	NinE family protein	NA	NA	NA	NA	NA
WP_000774488.1|462091_462382_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099700.1|462378_462741_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	7.3e-60
WP_000971068.1|462737_462878_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|462963_463347_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|463536_464634_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|465222_465438_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|465437_465935_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|466151_466334_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|466424_466718_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|467077_467272_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_063082806.1|467660_468206_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027283.1|468180_470106_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|470102_470309_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|470305_471907_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123309.1|471887_473207_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_001378764.1|473216_473549_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	4.2e-54
WP_000063221.1|473604_474630_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	8.1e-189
WP_000158880.1|474671_475067_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000752981.1|475078_475432_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975110.1|475443_476022_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	5.0e-79
WP_000683142.1|476018_476414_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_001378767.1|476421_477162_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	6.8e-129
WP_000479193.1|477177_477600_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|477581_478016_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001774776.1|478008_480588_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
WP_000847379.1|480584_480914_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|480913_481612_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194783.1|481617_482361_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|482297_482930_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_061091987.1|482990_486404_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.6	0.0e+00
WP_001233071.1|486474_487074_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|487138_490099_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|490098_490674_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|490771_491362_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|491678_491912_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|491980_492094_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|492459_493128_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226378.1|493673_495158_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|495344_496298_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|496810_497572_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
496721:496767	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|497754_498645_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|498645_501618_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383945.1|501604_503842_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000394594.1|504110_505247_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP027371	Escherichia coli strain 2015C-3905 chromosome, complete genome	4901620	772789	883271	4901620	tail,protease,lysis,capsid,portal,transposase,terminase,head,plate,integrase	Salmonella_phage(60.38%)	108	798515:798530	813591:813606
WP_000399648.1|772789_773770_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|774025_775291_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114234.1|775442_776258_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|776403_778836_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|778841_779741_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000424890.1|779871_780534_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_000829258.1|780609_781359_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397404.1|781358_782594_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|782797_783763_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_001296993.1|783749_785621_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090130.1|785640_787179_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|787196_788117_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|788119_789031_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001307078.1|789208_791557_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086910.1|791564_792893_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|792939_794265_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|794477_794861_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555035.1|794971_796087_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001295292.1|796083_796710_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000195961.1|796956_798159_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450133.1|798205_798964_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
798515:798530	attL	GGCGTTGCTGGCGTGA	NA	NA	NA	NA
WP_000892317.1|799021_799618_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180098.1|799902_801135_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|801175_801460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297001.1|801545_802361_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217848.1|802360_803569_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|803652_804189_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001032044.1|804339_804609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290938.1|804667_805699_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
WP_023150405.1|805782_807459_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
WP_106879071.1|807479_808076_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_000188448.1|808171_808393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460901.1|808425_808935_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_023150404.1|808942_809143_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
WP_000963472.1|809106_809448_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244165.1|809515_809749_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752613.1|809748_809976_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_106879072.1|809972_810830_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	3.9e-160
WP_106879073.1|810826_813241_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_001154428.1|813394_813583_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	93.4	5.1e-25
WP_106879074.1|813753_814914_+	hypothetical protein	NA	NA	NA	NA	NA
813591:813606	attR	GGCGTTGCTGGCGTGA	NA	NA	NA	NA
WP_052928646.1|815280_816348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086258518.1|816350_816665_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_130723475.1|816670_817159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104807779.1|817243_818269_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.2	1.4e-172
WP_089640747.1|818268_820035_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_106879075.1|820177_821011_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.5	7.7e-121
WP_106879076.1|821027_822086_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	1.9e-180
WP_106879077.1|822089_822740_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.3e-111
WP_106879078.1|822835_823300_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	3.2e-76
WP_000868192.1|823299_823503_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000171568.1|823506_823722_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001573376.1|823702_824218_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	1.6e-89
WP_096970344.1|824214_824643_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	90.1	3.6e-58
WP_001039945.1|824738_825170_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_106879079.1|825162_825609_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	3.0e-63
WP_039516405.1|825677_826256_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	3.6e-93
WP_106879080.1|826252_826612_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	1.6e-51
WP_000268301.1|826598_827507_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001086820.1|827499_828105_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_000905033.1|831054_831621_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_001726272.1|831762_832935_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_001504081.1|832944_833460_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281013.1|833514_833817_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|833831_833951_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_046201501.1|833943_837021_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.4	0.0e+00
WP_000980396.1|837017_837503_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_046201500.1|837499_838600_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.5	1.7e-176
WP_106879081.1|838690_838936_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	6.5e-20
WP_001024876.1|839142_840828_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|841097_841475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|841504_841762_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|841921_842209_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_106879082.1|842192_842915_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|842975_843878_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|843965_844442_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126055.1|844792_845905_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996018.1|845999_847133_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093862.1|847142_848096_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|848092_848938_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|848997_849486_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149739.1|849526_850654_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	6.0e-28
WP_001295905.1|850828_851560_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000399648.1|852010_852991_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000464491.1|853130_853799_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|853798_854515_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|854521_855253_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|855270_855999_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270735.1|856216_856732_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|856857_857181_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|857177_858008_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|858004_859018_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|859116_860547_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|860557_861559_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_106879083.1|861595_863314_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.8e-31
WP_000178677.1|863446_864415_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|864426_866079_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|866222_867122_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001356126.1|867616_868312_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|868737_870396_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|870392_871349_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|871499_872615_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|872611_874558_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|874630_874855_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000241204.1|875177_875498_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934053.1|875528_877805_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097888.1|879057_880041_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	2.9e-42
WP_001101569.1|880037_883271_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.8	2.8e-62
>prophage 3
NZ_CP027371	Escherichia coli strain 2015C-3905 chromosome, complete genome	4901620	981254	1050246	4901620	tail,holin,head,capsid,terminase,protease,integrase	Escherichia_phage(42.59%)	79	996350:996409	1045512:1045573
WP_106879087.1|981254_983015_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877158.1|983200_983653_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750419.1|983727_984780_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|985136_985646_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_106879088.1|985864_986494_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875044.1|986456_988619_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261231.1|988628_989075_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420533.1|989197_991252_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|991283_991742_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|991837_992500_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|992672_993086_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|993130_993448_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|993505_994696_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048243.1|994790_995069_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|995065_995395_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|995485_996145_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
996350:996409	attL	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGAC	NA	NA	NA	NA
WP_001367167.1|996552_997572_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.3	2.6e-86
WP_000273163.1|997540_997792_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000092782.1|1000340_1000529_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1000525_1000714_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_106879207.1|1001568_1001784_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	84.2	4.1e-10
WP_000380319.1|1001939_1002092_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000948456.1|1002403_1002880_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000712070.1|1003004_1003328_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.4e-09
WP_000693925.1|1003311_1003737_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_159029519.1|1003805_1004837_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	69.5	9.9e-86
WP_072130322.1|1004748_1005291_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_106879089.1|1005324_1006041_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.0	1.1e-72
WP_074398695.1|1006073_1006355_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.2	7.2e-31
WP_064506980.1|1006351_1006657_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.1	4.4e-50
WP_044527398.1|1006643_1007246_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	49.5	5.3e-39
WP_044527399.1|1007343_1007769_+	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	85.1	1.2e-16
WP_000206823.1|1008282_1008627_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	93.0	3.3e-54
WP_000967410.1|1008860_1009073_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	97.1	2.8e-27
WP_044527401.1|1009241_1009514_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	2.1e-11
WP_064506981.1|1009515_1010565_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.6e-115
WP_001204806.1|1010582_1010963_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_000917735.1|1011178_1011376_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|1011526_1012585_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_032360617.1|1012967_1013927_+	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	2.1e-175
WP_000738072.1|1013938_1014208_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_047090759.1|1014505_1014829_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	98.1	6.5e-60
WP_106879090.1|1015072_1017010_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.2	0.0e+00
WP_000143458.1|1017148_1017328_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1017368_1017614_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284490.1|1017691_1017907_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_039264424.1|1017910_1018702_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|1019213_1019747_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_051694738.1|1019903_1020086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135301858.1|1020454_1020640_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.1e-16
WP_000828070.1|1021040_1021367_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1021498_1021699_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|1021740_1022106_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958387.1|1022395_1022959_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_106879091.1|1022955_1024617_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_096633151.1|1024680_1026618_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.5	0.0e+00
WP_001063099.1|1026662_1026884_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125990.1|1029248_1029575_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007902.1|1029584_1029935_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_106879092.1|1029931_1030378_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.0	4.9e-74
WP_000133383.1|1030374_1030719_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_039264404.1|1030785_1031502_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	8.9e-126
WP_000710934.1|1031516_1031891_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_122993267.1|1031986_1032196_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_106879093.1|1032243_1035486_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.8	0.0e+00
WP_000343411.1|1035478_1035820_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_001499019.1|1035819_1036518_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.7	2.1e-132
WP_039264406.1|1036528_1037272_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	3.8e-148
WP_122993618.1|1037217_1037850_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	1.9e-100
WP_106879094.1|1038089_1041776_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	88.4	0.0e+00
WP_000078853.1|1041974_1042115_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_039264410.1|1042259_1043972_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.0	1.2e-67
WP_000438829.1|1043981_1044194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064506743.1|1044205_1044880_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	9.6e-114
WP_022581964.1|1045043_1045373_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001295940.1|1046027_1047146_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1045512:1045573	attR	TTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107384.1|1047142_1048936_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1048954_1049662_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003663.1|1049658_1050246_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP027371	Escherichia coli strain 2015C-3905 chromosome, complete genome	4901620	1194285	1276473	4901620	tail,holin,lysis,capsid,portal,transposase,tRNA,terminase,head,integrase	Escherichia_phage(40.3%)	103	1236444:1236461	1275567:1275584
WP_000952736.1|1194285_1195107_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_001620651.1|1195245_1195773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|1195916_1196342_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1196338_1196689_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|1196719_1198333_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001373091.1|1198443_1198908_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	3.2e-44
WP_000950104.1|1198859_1199210_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.1e-39
WP_000080210.1|1199240_1200833_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.9e-174
WP_106879104.1|1200819_1201074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341497.1|1201070_1201532_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759309.1|1201589_1202636_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1202632_1203427_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074972.1|1203593_1204712_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.5e-82
WP_000003742.1|1204680_1204950_-	excisionase	NA	NA	NA	NA	NA
WP_032284903.1|1205011_1207456_-	exonuclease	NA	V5UQJ3	Shigella_phage	57.9	4.2e-175
WP_000092784.1|1207548_1207737_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1207733_1207922_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000559920.1|1208450_1208966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000367379.1|1209079_1209232_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.1e-06
WP_001303511.1|1209522_1209801_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1209802_1209994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169685.1|1210014_1210386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032279888.1|1210482_1210785_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	1.1e-05
WP_000693925.1|1210781_1211207_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_044527394.1|1211275_1212307_+	phage replisome organiser	NA	A0A0U2RT81	Escherichia_phage	70.4	6.9e-87
WP_072130322.1|1212218_1212761_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_106879105.1|1212794_1213511_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	6.0e-74
WP_000017341.1|1213507_1213825_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_072094475.1|1213821_1214127_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.1	8.3e-49
WP_001224672.1|1214274_1214457_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_001289995.1|1214622_1215138_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	9.5e-37
WP_001398606.1|1215371_1215584_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	1.2e-25
WP_001219083.1|1215828_1216188_+	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.0	2.7e-22
WP_000284536.1|1216190_1216667_+	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_024200925.1|1217099_1217378_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_050868115.1|1217379_1218429_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.7	1.9e-116
WP_001204796.1|1218446_1218839_+	antitermination protein Q	NA	Q5MBW8	Stx1-converting_phage	62.7	4.7e-36
WP_001005105.1|1218905_1219523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917741.1|1219758_1219956_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_106879106.1|1220106_1221165_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	99.1	4.0e-207
WP_050864278.1|1221548_1222508_+	Shiga toxin Stx2a subunit A	NA	Q776Q3	Enterobacteria_phage	99.7	3.6e-175
WP_000738072.1|1222519_1222789_+	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_064549419.1|1223290_1225228_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.2	0.0e+00
WP_000143458.1|1225365_1225545_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1225585_1225831_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1225908_1226124_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_039264424.1|1226127_1226919_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|1227430_1227964_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_001056888.1|1228238_1228811_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_000443009.1|1228810_1228960_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.6	6.7e-12
WP_032209690.1|1228962_1229400_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_001109017.1|1229602_1230145_+	hypothetical protein	NA	A0A088CBJ5	Shigella_phage	98.9	4.1e-99
WP_001405844.1|1230855_1231362_+	DNA-packaging protein	NA	O64316	Escherichia_phage	48.5	1.6e-33
WP_001499025.1|1231333_1233262_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	3.7e-259
WP_000259002.1|1233245_1233452_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001398667.1|1233448_1235041_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.6	1.5e-186
WP_001253971.1|1235030_1236536_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.6	4.6e-100
1236444:1236461	attL	GCGAACCATTCACCGGCA	NA	NA	NA	NA
WP_000256813.1|1236571_1236919_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522633.1|1236976_1238005_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	6.6e-114
WP_000201497.1|1238057_1238441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204259.1|1238433_1238787_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.1e-40
WP_000974993.1|1238802_1239378_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	2.9e-50
WP_000683075.1|1239374_1239770_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_106879107.1|1239777_1240527_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.2	1.2e-128
WP_052903904.1|1240546_1240978_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.4	6.2e-42
WP_072126353.1|1241004_1241409_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	83.8	4.5e-42
WP_106879108.1|1241389_1243969_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	78.0	0.0e+00
WP_000847279.1|1243965_1244295_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_106879109.1|1244294_1244993_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	1.8e-131
WP_044808579.1|1245003_1245747_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.0	5.9e-149
WP_136755463.1|1245692_1246325_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	89.5	2.1e-99
WP_000078853.1|1251122_1251263_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_000438829.1|1253129_1253342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373129.1|1253353_1254028_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_022581964.1|1254190_1254520_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|1254683_1255547_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1255530_1256667_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359461.1|1256916_1258146_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1258291_1259413_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032326825.1|1259661_1260891_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	1.5e-133
WP_000953271.1|1261265_1261454_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000182306.1|1261697_1261901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103621.1|1261958_1262138_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.5e-10
WP_000190551.1|1262643_1262823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106879110.1|1263015_1263213_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_047091603.1|1263205_1263418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106879111.1|1263407_1263872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047091601.1|1263864_1264098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|1264103_1264403_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_106879112.1|1264399_1265806_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.8e-114
WP_032307310.1|1266007_1266259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032307311.1|1266255_1266678_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032308115.1|1267095_1267302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032308116.1|1267301_1268357_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	3.5e-70
WP_000380882.1|1268368_1268704_+|head	head decoration protein	head	NA	NA	NA	NA
WP_032308117.1|1268716_1269130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1269335_1269878_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1270133_1270415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1271016_1272477_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1272476_1273148_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423750.1|1273315_1274686_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
WP_001297479.1|1274689_1275331_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1275366_1276473_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1275567:1275584	attR	TGCCGGTGAATGGTTCGC	NA	NA	NA	NA
>prophage 5
NZ_CP027371	Escherichia coli strain 2015C-3905 chromosome, complete genome	4901620	1380054	1450432	4901620	tail,holin,protease,lysis,capsid,portal,transposase,terminase,head,integrase	Escherichia_phage(27.78%)	78	1379876:1379903	1436627:1436654
1379876:1379903	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113693.1|1380054_1381185_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.0e-104
WP_000113183.1|1381162_1381411_-	excisionase	NA	NA	NA	NA	NA
WP_106879115.1|1381475_1382531_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.4e-55
WP_089538410.1|1382546_1383702_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
WP_000092839.1|1385309_1385498_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1385494_1385683_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|1386457_1386826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|1386837_1386990_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|1387179_1387587_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|1387664_1387892_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|1387875_1388397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|1388377_1389343_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790460.1|1389349_1390090_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000450858.1|1390119_1390881_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	64.0	8.4e-74
WP_000215513.1|1390940_1391135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|1391476_1392028_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882661.1|1392242_1392455_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	5.6e-28
WP_000042395.1|1392557_1392875_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001452497.1|1393463_1393691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024199763.1|1393744_1394014_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	1.2e-11
WP_050877448.1|1394015_1395065_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_000904164.1|1395077_1395440_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|1395432_1396098_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|1396351_1397065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1397238_1397436_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_064579144.1|1397586_1398645_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	4.4e-206
WP_000271629.1|1399125_1399554_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382067.1|1400250_1400976_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062878147.1|1402840_1404805_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.3	8.0e-294
WP_000142780.1|1404939_1405119_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	93.2	5.4e-24
WP_001290230.1|1405159_1405405_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1405482_1405698_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_039264424.1|1405701_1406493_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_001092874.1|1407004_1407538_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_072024677.1|1407694_1407877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024173692.1|1408025_1408493_+|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.1	7.9e-67
WP_000877795.1|1408673_1409219_+	hypothetical protein	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	7.4e-64
WP_000828070.1|1409555_1409882_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|1410013_1410214_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829191.1|1410255_1410621_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	1.0e-61
WP_000958387.1|1410909_1411473_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001373204.1|1411469_1413131_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000172990.1|1413194_1415132_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|1415176_1415398_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001365916.1|1415343_1417929_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.3	0.0e+00
WP_000126028.1|1417925_1418252_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	97.2	3.9e-52
WP_001007902.1|1418262_1418613_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	99.1	2.0e-59
WP_000573397.1|1418609_1419056_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_000133383.1|1419052_1419397_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275414.1|1419463_1420180_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	98.7	1.5e-125
WP_000710936.1|1420194_1420569_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	3.9e-64
WP_122993267.1|1420664_1420874_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000212873.1|1420922_1424165_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.5	0.0e+00
WP_000343408.1|1424157_1424499_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	81.2	7.6e-51
WP_000738904.1|1424697_1425861_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_106879109.1|1426071_1426770_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	1.8e-131
WP_050878055.1|1426780_1427524_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.1	3.7e-143
WP_135301496.1|1427469_1428102_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	6.7e-101
WP_106879117.1|1429011_1432698_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.9	0.0e+00
WP_000078853.1|1432896_1433037_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_000290874.1|1433181_1434450_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	99.1	6.5e-55
WP_001049904.1|1434518_1435190_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.4	9.6e-106
WP_000211405.1|1435597_1436158_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	5.4e-54
WP_001079509.1|1436804_1437311_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1436627:1436654	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|1437356_1437857_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1437942_1438122_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|1438502_1439309_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1439308_1440502_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001297118.1|1440513_1441872_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1441875_1443471_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|1443470_1445033_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1445124_1445169_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1445306_1446188_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1446184_1446805_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1446905_1447778_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1447817_1448408_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559283.1|1448404_1449163_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	8.8e-07
WP_000422045.1|1449382_1450432_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP027371	Escherichia coli strain 2015C-3905 chromosome, complete genome	4901620	2288549	2297990	4901620		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2288549_2289686_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001356047.1|2289682_2291683_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001295429.1|2291807_2292269_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2292308_2292779_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2292825_2293545_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2293541_2295227_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2295448_2296180_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2296239_2296347_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2296327_2297059_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|2297063_2297990_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 7
NZ_CP027371	Escherichia coli strain 2015C-3905 chromosome, complete genome	4901620	2796639	2804402	4901620	transposase,integrase	Escherichia_phage(66.67%)	6	2794427:2794440	2801539:2801552
2794427:2794440	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2796639_2797122_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2797864_2799094_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2799132_2799549_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|2799619_2801368_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577258.1|2801369_2803088_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	95.5	5.2e-305
2801539:2801552	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_085947771.1|2803239_2804402_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 8
NZ_CP027371	Escherichia coli strain 2015C-3905 chromosome, complete genome	4901620	2876793	2883933	4901620		Escherichia_phage(83.33%)	6	NA	NA
WP_001272897.1|2876793_2879355_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141325.1|2879460_2880117_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.6e-49
WP_001297141.1|2880167_2880935_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2881130_2882039_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590397.1|2882035_2883298_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2883294_2883933_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP027372	Escherichia coli strain 2015C-3905 plasmid unnamed	175427	13393	18565	175427		Cronobacter_phage(33.33%)	8	NA	NA
WP_000086114.1|13393_14077_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.1e-30
WP_032236829.1|14153_14459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001373099.1|14462_15365_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|15783_16032_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_000109075.1|16028_16481_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	52.0	1.1e-25
WP_001365565.1|16464_17457_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
WP_001373062.1|17486_17735_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	58.8	1.7e-20
WP_000587689.1|17938_18565_+	ParA family plasmid-partitioning AAA ATPase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
>prophage 2
NZ_CP027372	Escherichia coli strain 2015C-3905 plasmid unnamed	175427	27837	34348	175427	transposase	Stx2-converting_phage(57.14%)	8	NA	NA
WP_000422741.1|27837_28263_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|28259_28610_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|28640_30254_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_001373091.1|30364_30829_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	3.2e-44
WP_000950104.1|30780_31131_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	3.1e-39
WP_000080210.1|31161_32754_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.9e-174
WP_001278809.1|32958_33375_-	recombinase	NA	NA	NA	NA	NA
WP_000688510.1|33367_34348_-	Plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
