The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	258565	320756	5065883	transposase,tRNA,protease,plate	Emiliania_huxleyi_virus(12.5%)	52	NA	NA
WP_001295561.1|258565_259918_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|259947_262380_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|262501_262987_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|262990_264016_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|264120_264576_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565961.1|264579_265368_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139658.1|265367_266516_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|266512_267109_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_106884309.1|267145_270628_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	8.2e-209
WP_000055741.1|270640_271600_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|271698_273840_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|273896_274286_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|274350_275649_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|275697_275958_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|275944_276145_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185293.1|276310_276856_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|276852_277275_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|277288_277999_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|278248_279229_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|279431_280256_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260716.1|280308_282027_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|282137_282845_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|282841_283246_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|283363_284179_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|284218_284872_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|284864_285896_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|286083_286659_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997048.1|292416_293220_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648580.1|293216_294131_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|294371_295172_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|295249_296020_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644683.1|296067_297426_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|297497_298253_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|298286_299009_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|299005_299473_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|299537_300269_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086143.1|300804_301590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|301726_302206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|302215_303130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|303173_303656_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087588.1|303679_305032_-	membrane protein	NA	NA	NA	NA	NA
WP_122985860.1|305042_308477_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_028985905.1|308585_309998_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|310002_310746_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614366.1|310742_313508_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.9	1.4e-81
WP_000343298.1|313516_314278_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246437.1|314282_315614_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|315616_316141_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113721.1|316137_317418_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|317442_318525_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|318488_320339_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|320342_320756_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	633751	700757	5065883	head,portal,terminase,protease,lysis,capsid,transposase,tail,tRNA,integrase	Enterobacteria_phage(63.16%)	78	643913:643959	692231:692277
WP_000912345.1|633751_635137_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|635172_635694_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|635801_636014_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|636015_636882_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001369891.1|637362_637905_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988366.1|638124_638817_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001356128.1|638847_641457_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691050.1|641469_642477_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|642487_643003_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805435.1|643005_643638_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
643913:643959	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|643972_645136_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000446905.1|644991_645363_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|645334_645613_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763342.1|645660_645879_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.6e-33
WP_001386642.1|645977_646259_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000129285.1|646269_646827_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|646819_646981_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186826.1|646977_647658_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	3.3e-130
WP_000100847.1|647654_648440_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995443.1|648445_648742_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	4.7e-49
WP_122990138.1|648817_649108_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	3.8e-27
WP_000338655.1|649505_650447_-	hypothetical protein	NA	Q8LTB7	Lactobacillus_phage	33.1	9.8e-32
WP_000712396.1|650520_651213_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|651323_651551_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182883.1|651581_652121_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_001385711.1|652207_653137_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	2.0e-109
WP_000788886.1|653133_653835_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.6	9.9e-130
WP_000145915.1|653831_654134_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|654201_654534_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001299444.1|654581_654731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|654788_656315_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001385712.1|656779_657331_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|657340_658138_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|658254_658356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|658352_658808_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|658807_658978_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|658970_659261_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|659257_659620_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971068.1|659616_659757_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|659842_660226_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|660414_661497_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|662086_662302_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|662301_662799_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|663015_663198_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001385713.1|663288_663582_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	89.7	2.9e-43
WP_001307652.1|663942_664137_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|664525_665071_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|665045_666971_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|666967_667174_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001385714.1|667170_668772_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	3.2e-309
WP_028985732.1|668752_670072_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001295978.1|670081_670414_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063280.1|670469_671495_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158905.1|671536_671935_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000752979.1|671946_672300_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_106884311.1|672311_672890_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	2.7e-80
WP_000683145.1|672886_673282_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_021514938.1|673289_674030_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	4.7e-130
WP_000479139.1|674045_674468_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_000459480.1|674449_674884_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000840354.1|674876_677438_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000847347.1|677434_677764_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152653.1|677763_678462_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	4.7e-132
WP_032211877.1|678466_679210_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	1.1e-142
WP_000090856.1|679146_679779_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	5.0e-96
WP_028985733.1|679839_683238_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230388.1|683304_683904_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_028985734.1|683968_687331_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885603.1|687330_687915_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|687969_688638_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937500.1|688694_689000_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226370.1|689183_690668_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201841.1|690854_691808_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|692320_693082_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
692231:692277	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224602.1|693264_694155_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662364.1|694155_697128_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|697114_699352_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|699620_700757_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	972433	1079086	5065883	head,portal,terminase,protease,lysis,plate,capsid,transposase,tail,tRNA,integrase	Salmonella_phage(63.46%)	109	1001155:1001171	1026956:1026972
WP_000399597.1|972433_973414_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|973674_974940_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114234.1|975091_975907_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209359.1|976052_978485_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001307076.1|978490_979390_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001351540.1|979520_980183_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	1.6e-25
WP_000829244.1|980270_981020_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397360.1|981019_982255_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513775.1|982458_983424_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_024210898.1|983410_985282_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_000090130.1|985301_986840_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|986857_987778_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|987780_988692_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001385729.1|988869_991218_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_028985776.1|991225_992554_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|992600_993926_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|994138_994522_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000554959.1|994632_995748_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001295292.1|995744_996371_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001300708.1|996617_997820_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
WP_000450121.1|997866_998625_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_001385730.1|998682_999279_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_028985775.1|999563_1000565_+	MFS transporter	NA	NA	NA	NA	NA
WP_000480894.1|1000605_1000890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345670.1|1000974_1001790_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
1001155:1001171	attL	GACCACCACTTCGCTGT	NA	NA	NA	NA
WP_000217839.1|1001789_1002998_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|1003081_1003618_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000014148.1|1003763_1004249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077745083.1|1004289_1005411_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	54.9	3.0e-104
WP_000900883.1|1005521_1005713_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_028985773.1|1005729_1006299_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.8e-39
WP_000188450.1|1006444_1006648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460892.1|1006712_1007222_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956192.1|1007229_1007526_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|1007643_1007985_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_028985772.1|1008052_1008286_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752610.1|1008285_1008513_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001544405.1|1008509_1009367_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_028985771.1|1009363_1011778_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.3	0.0e+00
WP_001154431.1|1011930_1012119_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|1012129_1012363_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_032211916.1|1012507_1014367_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_028985770.1|1014363_1015407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001146828.1|1016002_1016917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185757.1|1016913_1017654_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000518064.1|1017688_1018726_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_001098422.1|1018725_1020492_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_028985769.1|1020634_1021468_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	89.9	1.8e-122
WP_028985768.1|1021484_1022540_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.3	1.9e-180
WP_028985767.1|1022543_1023194_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	5.6e-111
WP_028985766.1|1023289_1023754_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	9.3e-76
WP_000868175.1|1023753_1023957_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1023960_1024176_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001442491.1|1024195_1024669_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000727855.1|1024670_1025048_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	6.7e-16
WP_001337513.1|1025044_1025473_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_001039944.1|1025568_1026000_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_028985764.1|1025992_1026439_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_028985763.1|1026507_1027086_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	1.0e-92
1026956:1026972	attR	ACAGCGAAGTGGTGGTC	NA	NA	NA	NA
WP_000177580.1|1027082_1027442_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_021533276.1|1027428_1028337_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.6e-143
WP_001086820.1|1028329_1028935_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_021533315.1|1030669_1030933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905027.1|1031758_1032325_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_028985748.1|1032467_1033640_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.5e-204
WP_001207660.1|1033649_1034165_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_023145595.1|1034219_1034522_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	1.2e-39
WP_000763311.1|1034536_1034656_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_000980419.1|1037721_1038207_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_001011797.1|1038203_1039304_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000972391.1|1039394_1039613_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1039848_1041534_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1041803_1042181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195225.1|1042210_1042468_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_001201555.1|1042627_1042915_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1042898_1043621_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684332.1|1043681_1044584_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	5.7e-37
WP_000203025.1|1044671_1045148_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126074.1|1045499_1046612_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996026.1|1046706_1047840_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_001093858.1|1047849_1048803_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1048799_1049645_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1049704_1050193_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149707.1|1050233_1051361_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	6.0e-28
WP_001295905.1|1051535_1052267_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1052558_1053227_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1053226_1053943_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1053949_1054681_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1054698_1055427_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270735.1|1055644_1056160_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1056285_1056609_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255146.1|1056605_1057436_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	29.4	1.3e-06
WP_001338420.1|1057432_1058446_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1058544_1059975_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|1059985_1060987_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815352.1|1061023_1062742_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	8.9e-31
WP_000178673.1|1062874_1063843_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|1063854_1065507_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1065650_1066550_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000488716.1|1067006_1067702_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|1068127_1069786_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|1069782_1070739_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|1070889_1072005_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188193.1|1072001_1073948_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|1074020_1074245_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1074567_1074888_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1074918_1077195_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1077878_1078097_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1078381_1079086_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	1334920	1395445	5065883	head,portal,terminase,capsid,holin,tail,tRNA,integrase	Escherichia_phage(37.25%)	70	1326186:1326203	1384679:1384696
1326186:1326203	attL	TGGATGATTTTTCAGATT	NA	NA	NA	NA
WP_000578146.1|1334920_1336114_+	ATP-binding protein	NA	A0A0P0IKU8	Acinetobacter_phage	36.6	5.6e-56
WP_000042165.1|1336113_1336656_+	hypothetical protein	NA	A0A0P0I467	Acinetobacter_phage	25.9	4.5e-05
WP_028985807.1|1336836_1337955_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.7	2.6e-84
WP_000003739.1|1337923_1338193_-	excisionase	NA	NA	NA	NA	NA
WP_000102188.1|1338254_1340798_-	exonuclease	NA	V5UQJ3	Shigella_phage	69.8	1.6e-233
WP_000199482.1|1340890_1341079_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450219.1|1341075_1341264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559918.1|1341792_1342308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|1342421_1342574_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000367559.1|1342742_1343132_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|1343235_1343511_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693899.1|1343494_1343920_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032211818.1|1343942_1344896_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	50.8	3.1e-73
WP_000790459.1|1344902_1345643_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450863.1|1345672_1346443_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	1.8e-84
WP_001141100.1|1346458_1346851_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	61.2	3.8e-38
WP_000072553.1|1346956_1347169_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
WP_000209146.1|1347201_1347420_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_024213791.1|1347421_1347685_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	2.6e-30
WP_000207997.1|1347695_1347863_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000206828.1|1347859_1348204_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	98.2	1.1e-57
WP_000902695.1|1348438_1348651_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	1.4e-26
WP_024210728.1|1349164_1349443_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_001265189.1|1349444_1350494_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904136.1|1350506_1350869_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|1350861_1351527_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|1351779_1352493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|1352666_1352864_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000483502.1|1353015_1354074_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.9	2.0e-206
WP_000271627.1|1354554_1354983_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382066.1|1355678_1356404_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106884314.1|1358268_1360233_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.3	4.0e-293
WP_000284510.1|1360601_1360817_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_032211991.1|1360821_1361355_+	lysozyme	NA	S5MQK2	Escherichia_phage	96.0	1.8e-99
WP_001208682.1|1361571_1361778_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735656.1|1361842_1362067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102157.1|1362512_1363061_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	60.0	4.6e-58
WP_096859070.1|1363053_1364961_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	6.0e-262
WP_000259002.1|1364944_1365151_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_028985950.1|1365147_1366740_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	2.5e-184
WP_028985949.1|1366729_1368235_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.2	1.9e-98
WP_028985948.1|1368271_1368619_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	59.1	1.2e-22
WP_000522632.1|1368676_1369705_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	2.9e-114
WP_028985947.1|1369756_1370140_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_106884315.1|1370132_1370486_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	2.8e-40
WP_028985945.1|1370501_1371077_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.3	6.4e-50
WP_028985944.1|1371073_1371469_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	83.2	1.4e-59
WP_001563054.1|1371476_1372226_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	96.0	6.6e-132
WP_028985943.1|1372242_1372674_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	4.1e-41
WP_028985942.1|1372700_1373114_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_096859069.1|1373094_1375674_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.7	0.0e+00
WP_096859068.1|1375670_1376000_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	98.2	4.7e-58
WP_001370900.1|1375999_1376698_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	3.1e-131
WP_001380365.1|1376708_1377452_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	2.3e-148
WP_077632782.1|1377397_1378030_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_106884316.1|1378270_1381738_+	host specificity protein J	NA	S5MW25	Escherichia_phage	98.2	0.0e+00
WP_000078852.1|1381936_1382077_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_088376948.1|1382220_1383621_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	93.2	2.4e-151
WP_001367204.1|1383630_1383855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047084173.1|1383851_1384526_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	87.9	1.4e-112
WP_001367470.1|1384689_1385019_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
1384679:1384696	attR	TGGATGATTTTTCAGATT	NA	NA	NA	NA
WP_000799399.1|1385183_1386047_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1386030_1387167_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359460.1|1387416_1388646_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1388791_1389913_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735406.1|1389988_1391449_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1391448_1392120_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423732.1|1392287_1393658_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1393661_1394303_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1394338_1395445_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	2077057	2175182	5065883	head,terminase,protease,lysis,capsid,holin,transposase,tail,tRNA,integrase	Enterobacteria_phage(28.57%)	106	2141992:2142007	2175549:2175564
WP_000984517.1|2077057_2077939_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055776.1|2078130_2080179_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	4.4e-85
WP_000431370.1|2080198_2080897_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2080993_2081491_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207283.1|2081620_2082904_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2082872_2085506_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|2085585_2087025_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|2087142_2087379_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|2087483_2087675_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|2087675_2088332_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|2088727_2089069_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|2089081_2089954_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|2089957_2090332_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2090470_2090701_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2090802_2091459_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2091482_2092145_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936923.1|2092141_2094202_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2094410_2095070_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2095396_2095753_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2095819_2096110_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|2096243_2097422_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|2097477_2098119_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069469.1|2098155_2099967_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301730.1|2100201_2101677_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	5.8e-79
WP_001056706.1|2102014_2102884_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091148.1|2103011_2104454_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2104584_2105556_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2105675_2106998_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|2107013_2107946_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2108024_2108780_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2108776_2109562_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2109708_2110719_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580328.1|2110727_2111339_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2111477_2111543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024917.1|2111613_2112216_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2112217_2112739_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2112773_2113514_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|2113542_2113995_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|2114112_2115885_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2116194_2116761_+	hydrolase	NA	NA	NA	NA	NA
WP_001261927.1|2117078_2117327_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	85.4	5.2e-33
WP_000547693.1|2117596_2118268_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	100.0	1.4e-125
WP_052920791.1|2118309_2120037_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.6	1.4e-230
WP_000078853.1|2120181_2120322_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106884321.1|2120520_2123988_-	host specificity protein J	NA	S5MW25	Escherichia_phage	98.4	0.0e+00
WP_072121435.1|2124902_2125535_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	4.3e-100
WP_062881343.1|2125480_2126224_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	3.3e-147
WP_001385822.1|2126234_2126933_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	2.1e-132
WP_000738904.1|2127143_2128307_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_000343412.1|2128505_2128847_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_000212966.1|2128839_2132106_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.8	0.0e+00
WP_122993267.1|2132153_2132363_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710952.1|2132458_2132833_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275447.1|2132847_2133564_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	1.4e-126
WP_000133383.1|2133630_2133975_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573359.1|2133971_2134418_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_001029274.1|2134414_2134765_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000125990.1|2134774_2135101_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063099.1|2137627_2137849_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|2137893_2139831_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_024210905.1|2139894_2141556_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_000958387.1|2141552_2142116_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
2141992:2142007	attL	TTTGCCAGCTGCGAGC	NA	NA	NA	NA
WP_000829192.1|2142406_2142772_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|2142813_2143014_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828069.1|2143145_2143472_-	TonB family protein	NA	H6WZK5	Escherichia_phage	97.2	1.8e-54
WP_000999673.1|2143915_2144296_-	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	5.5e-66
WP_001109018.1|2144454_2144997_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	99.4	3.1e-99
WP_001385819.1|2145199_2145637_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	97.9	2.5e-70
WP_000455399.1|2145644_2145794_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	97.9	2.6e-16
WP_001056870.1|2145793_2146366_-	hypothetical protein	NA	A0A088CD55	Shigella_phage	98.9	2.5e-107
WP_001092896.1|2146640_2147174_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	1.4e-99
WP_001385817.1|2147210_2147768_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	2.1e-50
WP_000284506.1|2147771_2147987_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_106884322.1|2148484_2150449_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.3	3.0e-293
WP_032212063.1|2150693_2151017_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	98.1	1.7e-60
WP_000738080.1|2151314_2151584_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649753.1|2151595_2152555_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_047084243.1|2152937_2153996_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000917768.1|2154146_2154344_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000043971.1|2154598_2155630_+	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	100.0	1.3e-189
WP_001385857.1|2155700_2156162_+	hypothetical protein	NA	A0A0P0ZCX2	Stx2-converting_phage	98.7	6.2e-72
WP_001205471.1|2156183_2156525_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	100.0	1.6e-61
WP_001385858.1|2156542_2157532_-	DUF968 domain-containing protein	NA	A0A0P0ZD76	Stx2-converting_phage	99.4	1.1e-193
WP_001065348.1|2157583_2157841_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	69.7	6.2e-21
WP_000184327.1|2157837_2159238_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.8	7.1e-244
WP_028985667.1|2159234_2160125_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	64.1	2.0e-82
WP_000095570.1|2160144_2161056_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	90.3	1.9e-141
WP_157908499.1|2161121_2161382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622005.1|2161464_2162124_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	79.9	1.3e-94
WP_000636505.1|2162120_2162972_-	peptidase	NA	K7PLX4	Enterobacteria_phage	83.2	6.4e-123
WP_000794367.1|2162968_2163793_-	transporter	NA	Q8W644	Enterobacteria_phage	99.6	1.0e-157
WP_001098349.1|2163845_2164553_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	78.3	1.7e-97
WP_000786996.1|2164549_2164813_-	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	52.9	1.8e-12
WP_000010195.1|2164936_2165641_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.8	8.3e-68
WP_047084244.1|2166024_2166489_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	76.8	1.6e-22
WP_000147367.1|2166494_2166695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553978.1|2166892_2167075_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.1e-08
WP_001385860.1|2167080_2167653_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	70.2	3.0e-76
WP_000720005.1|2168022_2168850_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.1	9.9e-129
WP_001484100.1|2168890_2169262_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_000063650.1|2169740_2171027_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_095585797.1|2171043_2171808_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.6e-72
WP_000252980.1|2171860_2172256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2172296_2173040_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564742.1|2173036_2174008_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|2174201_2175182_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
2175549:2175564	attR	TTTGCCAGCTGCGAGC	NA	NA	NA	NA
>prophage 6
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	2367171	2430524	5065883	head,portal,terminase,lysis,plate,capsid,holin,tail,tRNA,integrase	Escherichia_phage(46.51%)	71	2372229:2372255	2403249:2403275
WP_000675148.1|2367171_2368575_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|2368571_2369294_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2369484_2369817_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2370025_2370322_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2370323_2370620_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2370722_2372084_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2372229:2372255	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|2372356_2372575_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882940.1|2372656_2373820_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|2373819_2374299_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069939.1|2374313_2376761_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.4	0.0e+00
WP_000785970.1|2376753_2376873_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2376905_2377181_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2377237_2377756_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286723.1|2377768_2378959_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	2.1e-225
WP_000220361.1|2379369_2380788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001164094.1|2380902_2381430_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	93.1	3.7e-89
WP_021517189.1|2381433_2383752_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	67.2	5.7e-214
WP_028985810.1|2383762_2384293_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	3.9e-102
WP_001121474.1|2384285_2385194_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127163.1|2385198_2385546_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_028985811.1|2385542_2386178_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	1.6e-110
WP_028985812.1|2386244_2386697_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
WP_000917139.1|2386689_2387157_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_001355820.1|2387246_2387690_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	6.4e-66
WP_028985813.1|2387677_2388103_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	7.5e-56
WP_001144101.1|2388117_2388615_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|2388614_2388896_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|2388899_2389103_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|2389102_2389612_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203462.1|2389711_2390455_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_001248558.1|2390458_2391532_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_028985814.1|2391590_2392445_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.4	1.6e-137
WP_000156861.1|2392618_2394391_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038188.1|2394390_2395425_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_028985815.1|2395780_2397253_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_028985816.1|2397344_2399597_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	92.3	0.0e+00
WP_000027674.1|2399586_2399862_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113271.1|2399858_2400083_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	8.5e-35
WP_001512913.1|2400082_2400385_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	95.0	1.2e-44
WP_000557703.1|2400384_2400609_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217671.1|2400672_2401173_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000043869.1|2401350_2401626_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2401740_2402040_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_001512914.1|2402155_2403169_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	3.7e-194
WP_001352710.1|2403434_2403752_-	hypothetical protein	NA	NA	NA	NA	NA
2403249:2403275	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000807362.1|2404166_2405066_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|2405147_2405927_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844200.1|2406026_2407067_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490692.1|2407114_2408470_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823287.1|2408473_2408758_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182903.1|2408788_2409241_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853886.1|2409250_2410513_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|2410541_2411396_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2411703_2412756_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858498.1|2413012_2414290_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|2414286_2415291_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_028985817.1|2415287_2416253_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2416226_2416973_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001307284.1|2417024_2417843_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822274.1|2417907_2418708_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|2418704_2419493_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2419715_2419988_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134576.1|2420108_2420933_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|2421151_2421490_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026151.1|2421571_2422606_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945409.1|2422619_2425100_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677398.1|2425115_2425790_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2425870_2426413_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001447395.1|2426705_2426987_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2427249_2428359_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|2428490_2430524_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 7
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	2444167	2452476	5065883		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001326004.1|2444167_2446168_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2446292_2446754_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2446794_2447265_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2447311_2448031_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2448027_2449713_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2449934_2450666_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|2450725_2450833_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2450813_2451545_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|2451549_2452476_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 8
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	2840821	2966119	5065883	portal,terminase,protease,lysis,holin,tail,tRNA,integrase	Escherichia_phage(44.64%)	115	2874816:2874847	2961942:2961973
WP_001107167.1|2840821_2842096_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000551807.1|2842206_2843325_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001090850.1|2843351_2844365_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000003317.1|2844649_2845804_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_000963837.1|2845953_2846385_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
WP_001137682.1|2846533_2848846_-	peptidoglycan glycosyltransferase PbpC	NA	NA	NA	NA	NA
WP_000736307.1|2848846_2853808_-	alpha2-macroglobulin	NA	NA	NA	NA	NA
WP_000108626.1|2854014_2854860_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_001297328.1|2855352_2856129_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_000133582.1|2856270_2857554_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|2857731_2857932_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|2857943_2858279_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196597.1|2858280_2860131_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	7.2e-103
WP_000384411.1|2860147_2860663_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2860758_2861082_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2861098_2861485_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2861512_2862727_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_001241356.1|2862838_2863327_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_000940018.1|2863627_2864365_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553451.1|2864483_2865287_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_001297705.1|2865431_2866286_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000983006.1|2866476_2867757_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_000244193.1|2867748_2868888_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000423256.1|2869047_2869938_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
WP_000211172.1|2870073_2871435_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_001276072.1|2871431_2871950_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_001080102.1|2871949_2872270_+	bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_001281377.1|2872266_2873079_+	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	NA	NA	NA	NA
WP_000660797.1|2873088_2874291_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
WP_001094724.1|2874387_2874810_+	DoxX family protein	NA	NA	NA	NA	NA
2874816:2874847	attL	ATGCCGGATGCGGCGTGAACGCCTTATCCGGC	NA	NA	NA	NA
WP_000158540.1|2874857_2875730_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_000855625.1|2875741_2876803_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_001276663.1|2876868_2877867_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000493473.1|2877891_2879403_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
WP_001124909.1|2879425_2880409_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001367847.1|2880505_2883787_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_001299519.1|2883904_2885098_+	ROK family protein	NA	NA	NA	NA	NA
WP_000919159.1|2885161_2886415_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883124.1|2886743_2887934_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2887978_2888317_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|2888377_2889712_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215888.1|2889701_2890415_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001297612.1|2890579_2892007_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970143.1|2892582_2896470_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.7e-130
WP_000734212.1|2896727_2898284_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001295367.1|2898280_2898817_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190655.1|2898841_2899477_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|2899685_2900534_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000547693.1|2901238_2901910_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	100.0	1.4e-125
WP_106884330.1|2901951_2903679_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.4	1.4e-230
WP_000078858.1|2903821_2903962_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_106884331.1|2904160_2907628_-	host specificity protein J	NA	S5MW25	Escherichia_phage	98.6	0.0e+00
WP_001385846.1|2907868_2908507_-|tail	tail assembly protein	tail	S5MDP1	Escherichia_phage	99.4	6.5e-96
WP_106884333.1|2908404_2909148_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	99.6	6.3e-151
WP_032209675.1|2909158_2909857_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	100.0	1.3e-134
WP_000847279.1|2909856_2910186_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	100.0	5.6e-59
WP_000918278.1|2910182_2912777_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	100.0	0.0e+00
WP_000532074.1|2912820_2913129_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	100.0	7.8e-55
WP_000479054.1|2913155_2913578_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	100.0	5.1e-73
WP_000174601.1|2913593_2914343_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	99.6	4.7e-138
WP_000682704.1|2914350_2914749_-	hypothetical protein	NA	S5MW30	Escherichia_phage	100.0	2.7e-71
WP_000974964.1|2914758_2915385_-	hypothetical protein	NA	S5MBY4	Escherichia_phage	100.0	7.8e-102
WP_001281344.1|2915387_2915669_-	hypothetical protein	NA	S5MDP9	Escherichia_phage	100.0	7.2e-47
WP_001097058.1|2915661_2915988_-	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	100.0	6.1e-50
WP_001114418.1|2916075_2918100_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	100.0	0.0e+00
WP_000974568.1|2918044_2919547_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|2919546_2919759_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_087634876.1|2919755_2921879_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.9	0.0e+00
WP_000373411.1|2921875_2922352_-	DUF1441 family protein	NA	S5MQK0	Escherichia_phage	100.0	1.9e-84
WP_001255340.1|2922764_2923232_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	87.2	4.4e-65
WP_000087456.1|2923228_2923762_-	lysozyme	NA	S5MQK2	Escherichia_phage	100.0	7.9e-103
WP_000284506.1|2923766_2923982_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_106884334.1|2924476_2926450_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	78.5	2.6e-300
WP_000738072.1|2926961_2927231_-	Shiga toxin Stx2a subunit B	NA	Q6DWN4	Enterobacteria_phage	100.0	1.2e-43
WP_106884335.1|2927242_2928202_-	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	99.4	6.2e-175
WP_001561877.1|2928539_2928962_-	hypothetical protein	NA	S5M7R9	Escherichia_phage	34.4	2.1e-13
WP_001561878.1|2929618_2931838_-	hypothetical protein	NA	W8CQP1	Croceibacter_phage	27.0	2.0e-22
WP_000204616.1|2931841_2932066_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001046700.1|2932173_2932803_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	42.2	1.4e-34
WP_000051351.1|2933676_2934579_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_106884336.1|2934581_2935883_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	2.0e-131
WP_000694661.1|2935898_2936447_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.4	1.6e-66
WP_001561882.1|2936829_2937594_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	56.7	7.0e-28
WP_000379840.1|2937708_2938308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235335.1|2940876_2941638_+	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	76.1	6.7e-39
WP_000008823.1|2941690_2941906_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000637722.1|2941902_2942202_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	64.2	5.5e-29
WP_024213691.1|2942191_2942461_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	1.8e-26
WP_001367526.1|2942457_2942634_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000043909.1|2942602_2942932_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_024213692.1|2943326_2944016_+	DNA-binding protein	NA	B1GS65	Salmonella_phage	44.2	6.1e-15
WP_044697664.1|2944060_2945455_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.8	1.1e-215
WP_001138329.1|2945648_2947046_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000054752.1|2947260_2947521_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_000128776.1|2947714_2947795_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_000986029.1|2948213_2948594_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001297412.1|2948593_2949325_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399393.1|2949336_2950065_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020737.1|2950076_2950982_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|2950978_2951659_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002548.1|2951931_2952906_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|2952921_2954721_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589068.1|2954918_2955398_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812036.1|2955394_2956351_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|2956350_2957001_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|2957033_2957609_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|2957605_2957761_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094499.1|2958016_2959639_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001298974.1|2959623_2960361_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219195.1|2960492_2961821_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2962029_2962911_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2961942:2961973	attR	GCCGGATAAGGCGTTCACGCCGCATCCGGCAT	NA	NA	NA	NA
WP_000189207.1|2963013_2963601_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2963656_2964040_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2964344_2965034_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2965081_2966119_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	2985161	3025281	5065883	head,portal,terminase,protease,plate,capsid,holin,tail,integrase	Enterobacteria_phage(84.78%)	54	2979606:2979619	3022662:3022675
2979606:2979619	attL	TCCAGTACCTGCAA	NA	NA	NA	NA
WP_000215756.1|2985161_2985968_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_001353016.1|2985912_2986110_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|2986302_2986599_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|2986734_2986875_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488108.1|2987065_2987326_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132787.1|2987368_2988478_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	6.9e-194
WP_000005366.1|2988635_2989820_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	9.9e-223
WP_000651582.1|2990386_2990761_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	74.0	3.1e-37
WP_000333503.1|2990769_2990925_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_106884337.1|2990911_2993719_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.3	0.0e+00
WP_000979946.1|2993731_2994220_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954196.1|2994376_2994949_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_096849568.1|2994992_2995571_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	90.1	1.4e-97
WP_000631344.1|2995579_2996482_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	63.9	6.8e-99
WP_106884338.1|2996478_2998275_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	93.3	1.1e-103
WP_032198064.1|2998799_2999696_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	1.8e-155
WP_000213447.1|2999699_3000050_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_062857876.1|3000046_3000628_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	4.3e-102
WP_032198067.1|3000624_3001260_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_032198068.1|3001252_3001720_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	7.6e-86
WP_062874569.1|3001857_3002265_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	7.9e-63
WP_001761063.1|3002261_3002654_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	4.9e-70
WP_000104350.1|3002650_3002974_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|3002976_3003177_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063094.1|3003176_3003671_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632366.1|3003772_3004573_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	4.6e-131
WP_096849564.1|3004618_3005671_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	5.0e-194
WP_001262673.1|3005694_3006531_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613772.1|3006685_3008437_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_096849563.1|3008436_3009483_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	1.7e-205
WP_029396213.1|3009994_3010258_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	71.3	2.6e-30
WP_089529418.1|3010752_3011184_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	45.4	5.5e-22
WP_000211292.1|3011203_3011518_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_106884339.1|3011522_3012482_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	2.2e-180
WP_137534664.1|3012558_3015381_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.1	0.0e+00
WP_000599382.1|3015387_3015753_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_106884340.1|3015749_3016370_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	2.6e-09
WP_021514992.1|3016425_3017250_-|protease	serine protease	protease	A0A0A7NPW9	Enterobacteria_phage	96.3	8.7e-125
WP_001036814.1|3017246_3017459_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	86.6	7.6e-25
WP_021514993.1|3017470_3017770_-	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.1e-40
WP_000153700.1|3017766_3018033_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|3018029_3018233_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|3018256_3018667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021656.1|3018760_3018874_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|3018870_3019113_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158971.1|3019124_3019412_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_032218642.1|3019422_3019764_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	6.6e-55
WP_001001394.1|3019782_3020109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|3020204_3020507_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_032218640.1|3020573_3021563_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	2.0e-99
WP_001700969.1|3021730_3021778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200100.1|3021875_3023036_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
3022662:3022675	attR	TTGCAGGTACTGGA	NA	NA	NA	NA
WP_000225221.1|3023078_3024200_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|3024210_3025281_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 10
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	3118001	3125141	5065883		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3118001_3120563_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|3120668_3121325_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|3121375_3122143_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3122338_3123247_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3123243_3124506_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3124502_3125141_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 11
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	3427438	3438923	5065883	transposase	Stx2-converting_phage(33.33%)	12	NA	NA
WP_001034012.1|3427438_3431533_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.0	5.9e-299
WP_000789660.1|3431836_3432028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997724.1|3432038_3432404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000264910.1|3432413_3432605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323309.1|3432638_3432848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001376509.1|3433345_3433990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226517.1|3434010_3434280_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502848.1|3434358_3434997_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_001285503.1|3434981_3436214_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.8	7.7e-61
WP_000422741.1|3436506_3436932_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624720.1|3436928_3437279_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_000080191.1|3437309_3438923_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	2.8e-183
>prophage 12
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	4205259	4292679	5065883	head,protease,plate,transposase,tail,tRNA,integrase	Shigella_phage(51.22%)	88	4204900:4204915	4281750:4281765
4204900:4204915	attL	GTCAGCCCCGGTAAAG	NA	NA	NA	NA
WP_001070177.1|4205259_4205949_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678429.1|4205954_4208036_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000747337.1|4208020_4208887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468836.1|4208889_4210095_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|4210374_4211766_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001307467.1|4211886_4213596_+	AsmA family protein	NA	NA	NA	NA	NA
WP_001391753.1|4213648_4215847_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|4215975_4217358_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_001218916.1|4218043_4219249_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.4	2.2e-161
WP_001046155.1|4220970_4221336_-	ribonuclease toxin immunity protein CdiI	NA	NA	NA	NA	NA
WP_075825994.1|4231117_4232896_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	3.5e-22
WP_000833176.1|4233394_4233784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000273207.1|4233847_4234906_+	methyltransferase	NA	NA	NA	NA	NA
WP_001385948.1|4234946_4235669_+	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_001385949.1|4235665_4236487_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_001148685.1|4236461_4236719_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_000132060.1|4236730_4236982_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_001385950.1|4236986_4237568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001562308.1|4237564_4238923_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_001385951.1|4238909_4239263_+	hydroxymyristoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000077537.1|4240767_4241298_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|4241488_4241737_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_106884350.1|4241738_4243829_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.5	2.3e-166
WP_000129790.1|4243900_4244833_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268104.1|4244835_4245057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057197.1|4245069_4245324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000827937.1|4245325_4245607_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	3.7e-11
WP_000049426.1|4245603_4245876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049309.1|4245880_4246174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|4246185_4246716_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323215.1|4246813_4247356_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	1.0e-28
WP_000564286.1|4247359_4247893_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	68.4	4.8e-68
WP_000465547.1|4247892_4248408_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	54.2	1.5e-45
WP_000977062.1|4248411_4248963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633438.1|4248959_4249271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145585.1|4249267_4249636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|4249651_4249984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|4249976_4250174_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|4250163_4250460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214357.1|4250456_4250966_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	43.4	1.1e-26
WP_000852377.1|4251035_4251461_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125314.1|4251532_4252033_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.9e-27
WP_115801859.1|4252067_4252496_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122255.1|4252479_4252698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342751.1|4252708_4252936_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|4252916_4253225_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|4253221_4253512_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360582.1|4253514_4254096_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	56.8	5.5e-49
WP_001057665.1|4254095_4255760_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532585.1|4255759_4257349_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.5	9.4e-168
WP_000046907.1|4257332_4258664_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.6	6.0e-152
WP_000094815.1|4258785_4259259_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	1.3e-37
WP_000850820.1|4259434_4260559_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.3	3.7e-78
WP_001142981.1|4260558_4261506_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	66.9	1.2e-122
WP_052920881.1|4261549_4261939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104958.1|4261935_4262355_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	52.9	1.4e-33
WP_000627429.1|4262351_4262915_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	2.2e-42
WP_000207434.1|4262918_4263149_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_000606775.1|4263148_4264630_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	50.9	5.5e-130
WP_000015475.1|4264638_4265004_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000213222.1|4265018_4265495_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_001107492.1|4265622_4267677_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	36.3	3.3e-72
WP_000168759.1|4267663_4269022_+	DMT family permease	NA	A0A0C4UR32	Shigella_phage	31.4	3.2e-52
WP_000097186.1|4269005_4270130_+|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	47.7	3.7e-94
WP_072098124.1|4270119_4270734_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	49.7	8.0e-51
WP_000763304.1|4270726_4271164_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	57.6	1.6e-40
WP_001146842.1|4271163_4272246_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	52.6	1.5e-97
WP_000301574.1|4272236_4272797_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	7.9e-45
WP_000469171.1|4272796_4273708_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	41.7	3.7e-28
WP_001499192.1|4273742_4274264_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	3.0e-46
WP_072127261.1|4275478_4277521_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	82.3	1.0e-283
WP_000144787.1|4277667_4277850_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114107.1|4277885_4278131_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_032164298.1|4278749_4278935_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000527074.1|4278903_4279956_+	DNA cytosine methyltransferase	NA	H9C177	Pectobacterium_phage	63.7	4.1e-119
WP_000930894.1|4280540_4280963_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_106884351.1|4280959_4281565_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000180200.1|4281533_4283852_+	MMPL family transporter	NA	NA	NA	NA	NA
4281750:4281765	attR	GTCAGCCCCGGTAAAG	NA	NA	NA	NA
WP_000597707.1|4283848_4284433_+	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_001385953.1|4284434_4285604_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_000020242.1|4285600_4286065_+	3-hydroxy-fatty acyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000091658.1|4286064_4286796_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_000198475.1|4286792_4288022_+	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000416157.1|4288861_4289893_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000916811.1|4290163_4290607_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705928.1|4290622_4290910_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|4290922_4292179_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000436076.1|4292394_4292679_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	1.5e-23
>prophage 13
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	4881560	4932330	5065883	transposase,tRNA,protease	Vibrio_phage(12.5%)	55	NA	NA
WP_001294219.1|4881560_4882700_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_096859056.1|4882698_4884246_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|4884217_4884679_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990312.1|4884697_4886035_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122487.1|4886044_4887892_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|4887884_4888835_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4888920_4889229_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4889304_4890585_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4890670_4891930_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4891932_4892937_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4893018_4893216_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4893319_4894618_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|4894822_4895248_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4895286_4897728_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4897907_4898639_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4898765_4899167_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4899185_4899884_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_028985842.1|4899934_4900594_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4900611_4901010_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101644.1|4901019_4901658_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943976.1|4901660_4902824_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.3e-81
WP_001339483.1|4902907_4904533_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4904649_4904925_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|4905073_4905403_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|4905584_4906334_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4906330_4907086_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4907193_4908258_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|4908612_4910010_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|4910025_4910331_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|4910340_4910805_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|4910818_4911469_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|4911478_4912333_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|4912332_4913019_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000996728.1|4913115_4913667_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|4913741_4914017_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4914343_4914739_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4914745_4915060_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4915064_4915292_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4915333_4915783_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|4915853_4916648_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|4917270_4917702_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001367946.1|4917709_4918918_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|4919052_4919691_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4919909_4920530_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4920838_4922251_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|4922295_4922958_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001351395.1|4923065_4924031_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560552.1|4924139_4925000_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4925088_4925469_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|4925597_4927541_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|4927730_4928471_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4928460_4929018_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4929342_4929549_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4929610_4930954_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000399648.1|4931349_4932330_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP027366	Escherichia coli strain 89-3156 chromosome, complete genome	5065883	5034142	5038745	5065883	transposase	Stx2-converting_phage(33.33%)	7	NA	NA
WP_000422741.1|5034142_5034568_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624720.1|5034564_5034915_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	6.2e-40
WP_000080191.1|5034945_5036559_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.0	2.8e-183
WP_106884363.1|5036565_5037405_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.7	1.6e-46
WP_073569128.1|5037459_5037945_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.0	2.4e-13
WP_001186726.1|5037960_5038437_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|5038523_5038745_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
