The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	399304	513102	5671594	portal,integrase,capsid,holin,transposase,head,terminase,protease,tail,lysis	Enterobacteria_phage(34.94%)	118	408295:408313	482552:482570
WP_000140570.1|399304_400207_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|400400_401591_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209922.1|401587_402847_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|402836_404465_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|404737_406096_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|406100_407177_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|407639_408290_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
408295:408313	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000135040.1|408343_408598_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|408597_409728_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|409816_412102_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_032276943.1|412797_416532_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_000990754.1|416659_417382_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|417528_420156_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012302.1|420304_421993_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215756.1|421989_422595_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|422609_423680_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|423657_423876_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|423981_424326_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|424444_424687_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001345188.1|424761_425112_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_001289868.1|425108_425714_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_000763358.1|425710_425932_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001444000.1|426030_426312_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|426322_426514_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|426486_426669_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_032284635.1|426668_427346_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.6	2.3e-131
WP_000100847.1|427342_428128_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|428133_428430_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372926.1|428484_428649_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_001198860.1|428617_428782_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065385.1|428854_429223_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167595.1|429372_429843_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000930321.1|429976_430315_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000256573.1|430317_430623_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_106907844.1|430937_431588_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	99.5	1.4e-122
WP_000276885.1|431668_431854_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035947.1|431963_432260_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000185462.1|432292_433231_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000788878.1|433227_433929_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|433925_434216_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|434288_434495_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|434502_434949_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|434945_435473_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|435469_435652_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001429269.1|436155_437991_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|438508_439075_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|439049_439652_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|439648_440314_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|440310_440934_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|441186_441930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|442015_442174_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|442254_442653_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|442795_443011_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075153.1|443010_443508_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_001228695.1|443724_443907_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|443997_444291_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|444650_444845_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000235436.1|445239_445749_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001444182.1|445720_447430_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	2.9e-239
WP_001238637.1|447442_447649_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_000258991.1|447632_447839_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000827572.1|447835_449428_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_001254039.1|449417_450923_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256849.1|450959_451307_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_000522643.1|451364_452249_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000201528.1|452300_452675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|452667_453021_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|453035_453611_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|453607_454003_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|454010_454763_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|454776_455208_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533403.1|455234_455648_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082375.1|455628_458190_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000847413.1|458186_458516_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_001152619.1|458515_459214_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194778.1|459219_459963_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_000090884.1|459899_460532_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_032284631.1|460592_463892_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000839179.1|463920_464325_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|464321_464669_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|464717_466256_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001230644.1|466318_466534_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_001228241.1|466601_467201_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_000279018.1|467265_468579_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001023380.1|468580_468850_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_001025664.1|470416_471739_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001676637.1|472540_476935_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_032276988.1|476935_478585_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|478589_479366_+	YfaP family protein	NA	NA	NA	NA	NA
WP_032277553.1|479640_482490_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	9.2e-41
WP_001061917.1|482575_483226_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
482552:482570	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_001249127.1|483242_485915_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|486653_487745_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|487856_488912_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|488985_490050_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|490049_490700_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422231.1|490775_492419_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758074.1|492636_494283_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|494431_494920_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_001296837.1|495055_495220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000686723.1|495328_495823_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|495812_496076_+	chaperone NapD	NA	NA	NA	NA	NA
WP_032277551.1|496072_498559_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000091291.1|498565_499261_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013509.1|499247_500111_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|500107_500557_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|500566_501169_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|501187_501805_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971723.1|501801_502464_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|502505_503243_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|503239_503449_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|503445_503925_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982426.1|503921_505865_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|505861_506419_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211567.1|506415_507468_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|507502_508150_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001369202.1|511527_512451_-|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.9	1.2e-13
WP_001229488.1|512613_513102_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	41.7	3.9e-24
>prophage 2
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	590615	600543	5671594	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001240401.1|590615_591347_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|591568_593254_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|593250_593970_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|594016_594487_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000998019.1|594918_596304_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|596353_596701_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|596697_597078_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001342301.1|597409_599410_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|599406_600543_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 3
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	834021	890932	5671594	portal,capsid,integrase,transposase,holin,head,plate,terminase,tail	Enterobacteria_phage(80.0%)	66	853701:853760	891039:891159
WP_000826451.1|834021_835185_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	8.9e-200
WP_000334586.1|835169_835841_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	5.6e-82
WP_000790504.1|835949_836183_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118901.1|836179_837385_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|837571_837985_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245684.1|838018_839506_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015030.1|839583_839949_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000287768.1|839948_840359_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000079829.1|842041_843616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032276834.1|843780_844500_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_106907850.1|844545_845097_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001317901.1|845184_845985_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128238.1|846089_847076_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158220.1|847090_847759_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001272994.1|847755_848508_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001154265.1|848737_849460_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106474.1|849527_849752_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001342215.1|849738_849915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611328.1|850210_850867_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283424.1|850863_852696_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|852752_853301_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
853701:853760	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_001303543.1|854293_854575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078920.1|854763_854904_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|855094_855355_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|855644_856784_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000132847.1|857183_858284_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_032250563.1|858441_859626_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	2.2e-222
WP_000665308.1|860193_860559_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|860594_860723_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000853454.1|860709_863517_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000979948.1|863529_864018_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	2.6e-84
WP_000954196.1|864174_864747_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|864790_865369_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_032276832.1|865368_867501_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.4	2.7e-130
WP_000071738.1|867503_868034_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111967.1|868026_868923_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000213447.1|868926_869277_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|869273_869855_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_032276831.1|869851_870487_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001342220.1|870479_870947_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000202144.1|870970_872848_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_000780555.1|872986_873394_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072343.1|873390_873783_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_001342221.1|873779_874103_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864911.1|874105_874306_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000063100.1|874305_874800_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_106907851.1|874901_875702_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	2.2e-125
WP_024219921.1|875747_876800_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.6	4.9e-189
WP_001262655.1|876823_877660_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613774.1|877814_879566_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|879565_880612_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001289969.1|881103_881694_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000211289.1|881757_882069_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|882073_883033_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000564221.1|885947_886337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|886660_886864_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|886950_887064_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|887060_887303_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|887314_887593_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|887603_887954_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|887975_888179_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|888250_888388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|888477_888882_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|888897_889548_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|889577_889925_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|889930_890932_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
891039:891159	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 4
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	974968	1056542	5671594	portal,integrase,holin,head,tRNA,terminase,protease,tail,lysis	Escherichia_phage(32.76%)	92	967239:967253	987994:988008
967239:967253	attL	TCCGGCGCTTCAGGT	NA	NA	NA	NA
WP_000916763.1|974968_975199_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|975337_975712_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|975715_976588_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|976600_976942_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189091.1|977334_978411_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_001443927.1|978376_978658_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|978764_978953_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|978945_979140_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000105101.1|979999_982651_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001307773.1|982749_983025_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_001427414.1|983098_983269_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560218.1|983268_983490_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427316.1|983910_984063_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_001303511.1|984349_984628_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|984629_984821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|984841_985213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|985310_985613_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|985609_986035_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444941.1|986057_987020_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000450872.1|987793_988555_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
987994:988008	attR	ACCTGAAGCGCCGGA	NA	NA	NA	NA
WP_000603384.1|988587_988869_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|988865_989093_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|989085_989397_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|989524_989743_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|989744_990302_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|990535_990748_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|990867_991212_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|991333_991606_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_032284663.1|991607_992657_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001217413.1|992669_993044_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|993040_993862_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_106907853.1|995032_996883_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_000411802.1|997330_997537_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|997536_998034_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|998030_998468_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|998617_999235_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|999422_999617_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001027379.1|1000524_1002450_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1002446_1002653_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|1002649_1004251_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_001299443.1|1005561_1005894_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_001695575.1|1007018_1007414_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_000752994.1|1007425_1007779_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|1007790_1008369_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683124.1|1008365_1008761_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	91.6	3.7e-65
WP_032284487.1|1008768_1009521_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	2.4e-134
WP_000479045.1|1009534_1009957_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1009983_1010397_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081793.1|1010377_1012990_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
WP_000847280.1|1012986_1013316_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_032284485.1|1013315_1014014_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_100038583.1|1014024_1014768_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.4	1.6e-146
WP_072148784.1|1014713_1015346_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_106907854.1|1015591_1018984_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.8	0.0e+00
WP_001230428.1|1019051_1019651_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_032284483.1|1019715_1021029_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_001023379.1|1021030_1021300_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000491545.1|1021440_1022316_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|1022540_1023191_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000812724.1|1024145_1024802_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|1024802_1024994_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1025098_1025335_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|1025452_1026892_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|1026971_1029605_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|1029573_1030857_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|1030986_1031484_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|1031580_1032279_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001427396.1|1032298_1034347_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000984517.1|1034538_1035420_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|1035465_1036839_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|1037015_1037807_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|1037949_1038189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1038347_1038491_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|1038565_1038853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|1039521_1039665_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|1039677_1039887_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|1040052_1040862_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|1040858_1041425_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|1041853_1042312_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|1042366_1043218_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|1043230_1044031_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|1044093_1045065_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|1045527_1047084_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_001295494.1|1047087_1048686_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|1048816_1050181_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|1050364_1050943_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|1050946_1052308_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1052381_1052561_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|1052680_1053040_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1053402_1053747_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|1053878_1055789_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|1055846_1056542_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	1266971	1333085	5671594	portal,integrase,capsid,holin,transposase,head,terminase,protease,tail,lysis	Escherichia_phage(31.58%)	77	1281598:1281612	1289899:1289913
WP_001260840.1|1266971_1267793_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1267892_1267976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|1268068_1268404_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1268800_1270054_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|1270160_1271054_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1271188_1272409_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|1272533_1273229_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|1273181_1274474_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1274632_1275247_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|1275289_1276144_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1276145_1276763_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|1276773_1279197_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
1281598:1281612	attL	CCTGCAGCCAGCGCC	NA	NA	NA	NA
WP_001307224.1|1281881_1282187_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1282294_1283005_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138576.1|1283007_1283568_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1283602_1283944_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1284078_1284405_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|1284610_1285825_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|1285836_1286856_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_072095801.1|1286913_1287024_+	transporter	NA	NA	NA	NA	NA
WP_001206148.1|1287043_1288339_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_001368608.1|1288358_1288595_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048585.1|1288679_1291151_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
1289899:1289913	attR	CCTGCAGCCAGCGCC	NA	NA	NA	NA
WP_001098307.1|1291244_1291436_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1291432_1291621_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133037.1|1292188_1292398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1292398_1293037_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000379562.1|1293048_1293201_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_000362153.1|1293466_1293886_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|1293986_1294268_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693888.1|1294251_1294677_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095674.1|1294699_1295668_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	52.7	1.8e-73
WP_000790459.1|1295674_1296415_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_000450862.1|1296444_1297215_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	3.7e-85
WP_001141099.1|1297230_1297623_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_024182342.1|1297619_1297916_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.9	2.3e-48
WP_001018050.1|1297912_1298194_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	80.9	1.8e-34
WP_001002668.1|1298433_1298745_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	9.0e-51
WP_000256992.1|1298872_1299091_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_032244186.1|1299092_1299629_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	55.2	1.7e-60
WP_000787530.1|1299628_1300024_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_000128514.1|1300258_1300471_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001341388.1|1300638_1300917_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265151.1|1300918_1301968_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	3.2e-108
WP_001217425.1|1301980_1302340_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001064874.1|1302336_1303005_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	8.7e-59
WP_032284474.1|1303709_1305560_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000411802.1|1306007_1306214_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|1306213_1306711_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|1306707_1307145_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|1307294_1307912_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|1308099_1308294_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1308682_1309228_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1309202_1311128_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1311124_1311331_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024026143.1|1311327_1312929_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	2.1e-308
WP_000123236.1|1312909_1314229_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001299443.1|1314238_1314571_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063258.1|1314626_1315652_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001695575.1|1315693_1316089_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	93.9	8.2e-57
WP_000752994.1|1316100_1316454_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|1316465_1317044_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683124.1|1317040_1317436_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	91.6	3.7e-65
WP_032284487.1|1317443_1318196_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.8	2.4e-134
WP_000479045.1|1318209_1318632_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|1318658_1319072_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081793.1|1319052_1321665_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.1	0.0e+00
WP_000847280.1|1321661_1321991_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_032284485.1|1321990_1322689_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.1	4.9e-129
WP_100038583.1|1322699_1323443_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	96.4	1.6e-146
WP_072148784.1|1323388_1324021_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_078187845.1|1327810_1328410_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_106907856.1|1328474_1329788_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001023998.1|1329789_1330059_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	2.3e-42
WP_122988840.1|1330169_1330247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993102.1|1330461_1331475_+	peptidase M85	NA	NA	NA	NA	NA
WP_097451673.1|1331928_1333085_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	7.5e-66
>prophage 6
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	1533880	1589981	5671594	capsid,integrase,holin,head,tRNA,terminase,tail	Escherichia_phage(46.03%)	67	1531592:1531606	1589142:1589156
1531592:1531606	attL	CAGAAAAAAGCGCGC	NA	NA	NA	NA
WP_000837924.1|1533880_1535014_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|1535154_1535589_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|1536529_1537171_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|1537252_1537882_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131657.1|1537954_1538530_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001023379.1|1538642_1538912_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_106875415.1|1538913_1540227_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	2.8e-77
WP_001233130.1|1540291_1540891_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_106907860.1|1540958_1544435_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
WP_072148784.1|1544680_1545313_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	2.9e-104
WP_024236318.1|1545258_1546002_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.9e-147
WP_001375577.1|1546007_1546706_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000847304.1|1546705_1547035_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|1547031_1549611_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000479086.1|1550032_1550464_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_032325228.1|1550477_1551230_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000683137.1|1551237_1551633_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|1551629_1552208_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|1552219_1552573_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1552584_1552980_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1553021_1554047_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1554102_1554435_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000198153.1|1557342_1557549_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|1557545_1559471_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_032284653.1|1559445_1559991_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.4	4.3e-80
WP_001300236.1|1560385_1560610_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|1560691_1561006_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1561533_1561719_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1561940_1562054_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_000992045.1|1562274_1562808_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_071528021.1|1562919_1563180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411802.1|1563684_1563891_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|1564338_1566189_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|1567359_1568181_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1568177_1568552_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_106907861.1|1568564_1569614_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	3.4e-110
WP_001341382.1|1569615_1569894_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000018421.1|1570061_1570274_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001278454.1|1570463_1570568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207986.1|1570683_1571553_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_000224233.1|1571563_1571827_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_042350895.1|1571828_1571993_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000935420.1|1572078_1572291_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000403777.1|1572341_1572698_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_001209480.1|1572675_1573137_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266134.1|1573133_1573430_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001151124.1|1573426_1573849_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_000450674.1|1573864_1574626_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_000788968.1|1574648_1575395_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000899746.1|1575401_1576259_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693802.1|1576271_1576694_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001072343.1|1576690_1576945_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000233320.1|1577024_1577444_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001427316.1|1577742_1577895_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560223.1|1578315_1578537_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|1578536_1578707_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|1578781_1579057_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105150.1|1579158_1581759_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.0e-248
WP_000166313.1|1581751_1582561_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_001443846.1|1582616_1582766_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_001302840.1|1582803_1582992_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|1583091_1583307_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040851.1|1583308_1584544_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_001157401.1|1584595_1585531_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.1e-144
WP_000123745.1|1585659_1587033_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|1587510_1588494_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|1588748_1589981_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
1589142:1589156	attR	GCGCGCTTTTTTCTG	NA	NA	NA	NA
>prophage 7
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	1666523	1742611	5671594	capsid,integrase,transposase,holin,head,terminase,tail,protease	Stx2-converting_phage(35.29%)	81	1680302:1680329	1742748:1742775
WP_000422045.1|1666523_1667573_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|1667792_1668551_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_001278906.1|1668547_1669138_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|1669177_1670050_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001342101.1|1670150_1670771_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285661.1|1670767_1671649_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1671786_1671831_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194584.1|1671922_1673485_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|1673484_1675080_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001342102.1|1675083_1676442_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	1.5e-36
WP_000209520.1|1676453_1677647_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|1677646_1678453_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|1678833_1679013_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|1679098_1679599_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079509.1|1679644_1680151_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
1680302:1680329	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000147167.1|1680652_1680871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144877.1|1683633_1684224_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|1684407_1685055_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|1685191_1685338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|1685765_1686044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|1687211_1687781_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|1687846_1688758_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|1688864_1688987_-	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001023357.1|1692932_1693202_-|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_001339397.1|1693262_1693940_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1693939_1694287_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_106875440.1|1694306_1695878_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_000216552.1|1695910_1697224_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_001228278.1|1697375_1697975_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000902073.1|1698042_1699092_-	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_000612626.1|1700700_1701048_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839170.1|1701044_1701449_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	2.5e-69
WP_096958157.1|1701526_1703977_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.8	0.0e+00
WP_050439450.1|1704319_1704952_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194723.1|1704897_1705641_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001335877.1|1705651_1706350_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|1706349_1706691_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000212980.1|1706683_1709926_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.0	0.0e+00
WP_001513217.1|1709973_1710183_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|1710278_1710653_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_058157545.1|1710667_1711384_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	95.8	3.0e-121
WP_000133388.1|1711449_1711794_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|1711790_1712237_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1712233_1712584_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|1712594_1712921_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|1715447_1715669_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_106907862.1|1715713_1717492_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	91.3	0.0e+00
WP_033800465.1|1717555_1719217_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.3	0.0e+00
WP_000958380.1|1719213_1719777_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|1720065_1720431_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_001428130.1|1720472_1720658_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000347013.1|1720787_1720928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|1721284_1721509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|1721573_1721780_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|1722007_1722154_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1722153_1722723_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992092.1|1722993_1723527_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.9	2.5e-101
WP_000731221.1|1723577_1723922_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000284522.1|1723926_1724142_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000023141.1|1724291_1726145_-	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_032284729.1|1727669_1728359_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	5.3e-59
WP_000140002.1|1728355_1728721_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265290.1|1728721_1729777_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_010917803.1|1729778_1730057_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|1730126_1730384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|1730604_1730817_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|1731095_1731854_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|1732552_1732717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157825328.1|1733480_1734023_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000705622.1|1734945_1735497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|1735480_1735708_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|1735784_1736192_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|1736456_1736756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|1736828_1737047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032277386.1|1737455_1737689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001342117.1|1737682_1737850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449172.1|1738249_1738438_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|1738434_1738623_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048478.1|1738718_1741190_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|1741254_1741503_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|1741480_1742611_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
1742748:1742775	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 8
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	1846685	1862894	5671594	portal,capsid,head,tRNA,terminase,protease	uncultured_Caudovirales_phage(90.0%)	19	NA	NA
WP_001297484.1|1846685_1847792_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|1847827_1848469_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|1848472_1849843_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_000735412.1|1850682_1852143_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133415.1|1852758_1853040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127884.1|1853053_1854715_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	2.2e-276
WP_000113646.1|1854698_1855055_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	3.6e-51
WP_001145906.1|1855343_1855784_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
WP_000134114.1|1855783_1856080_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001020669.1|1856076_1856415_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_001398592.1|1856411_1857587_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504047.1|1857624_1858197_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_001137338.1|1858236_1859394_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	8.1e-137
WP_001132080.1|1859685_1859910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233311.1|1860035_1860308_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126670.1|1860320_1860731_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001368652.1|1860740_1860929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080642.1|1861042_1861294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833614.1|1861496_1862894_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	4.3e-116
>prophage 9
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	1866326	1936368	5671594	integrase,capsid,holin,head,terminase,protease,tail,lysis	Escherichia_phage(23.81%)	83	1920482:1920500	1936693:1936711
WP_000085269.1|1866326_1867556_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000456506.1|1867804_1868926_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359438.1|1869071_1870301_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|1870550_1871687_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799399.1|1871670_1872534_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_001132165.1|1872807_1873398_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144080.1|1873580_1874231_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001299273.1|1874305_1875364_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_012816780.1|1875491_1876127_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001118085.1|1876194_1876776_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001131642.1|1877066_1877642_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_101946255.1|1877755_1878025_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	96.6	2.1e-43
WP_001216290.1|1879404_1880028_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_106907865.1|1880096_1883573_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.4	0.0e+00
WP_050439450.1|1883915_1884548_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194723.1|1884493_1885237_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001335877.1|1885247_1885946_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_000807940.1|1885945_1886287_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_000710952.1|1889869_1890244_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_058157545.1|1890258_1890975_-|tail	phage tail protein	tail	B6DZA6	Enterobacteria_phage	95.8	3.0e-121
WP_000133388.1|1891040_1891385_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|1891381_1891828_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1891824_1892175_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|1892185_1892512_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|1895039_1895261_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|1895305_1897243_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_106907866.1|1897306_1898968_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_000958380.1|1898964_1899528_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001427183.1|1899821_1900187_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	9.9e-65
WP_000095736.1|1900228_1900456_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000736096.1|1900824_1901049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001427182.1|1901045_1901540_-|lysis	lysis protein	lysis	Q7AYI6	Enterobacteria_phage	97.4	1.4e-74
WP_032140280.1|1901541_1901628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003120.1|1902182_1902716_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	3.6e-100
WP_000138558.1|1902875_1903148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|1903404_1903611_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000261909.1|1906675_1907389_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303877.1|1907483_1907723_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000265267.1|1908009_1908828_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|1908979_1909351_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|1909340_1909712_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265140.1|1909724_1910774_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001341388.1|1910775_1911054_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013636.1|1911221_1911434_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000955173.1|1911478_1911616_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_106907867.1|1911981_1912755_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|1913106_1913520_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|1913535_1914306_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788758.1|1914327_1915074_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.4	9.0e-113
WP_096850689.1|1915080_1916172_-	DNA-binding protein	NA	V5URT9	Shigella_phage	70.0	3.0e-133
WP_000273724.1|1916250_1916706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|1916911_1917337_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|1917320_1917593_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|1917701_1918103_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|1918130_1918322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|1918321_1918609_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|1918885_1919041_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|1919182_1919572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|1919758_1919944_-	hypothetical protein	NA	NA	NA	NA	NA
1920482:1920500	attL	CACCGCATCACAAAATTCA	NA	NA	NA	NA
WP_000413705.1|1920517_1920706_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1920702_1920894_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032278809.1|1920987_1923459_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|1923526_1923769_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|1923746_1924766_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_001427258.1|1925582_1926014_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	6.2e-66
WP_000762928.1|1926579_1927401_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|1927397_1927772_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_106875428.1|1927784_1928834_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	2.2e-109
WP_000191872.1|1928835_1929108_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1929229_1929574_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_001013638.1|1929693_1929906_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	3.1e-26
WP_000104474.1|1930139_1930697_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683607.1|1930698_1930917_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	73.6	6.2e-22
WP_001365112.1|1931019_1931355_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.4	2.0e-48
WP_000699809.1|1931347_1931575_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1931571_1931853_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_032284689.1|1931885_1932647_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.9	1.9e-73
WP_000788750.1|1932668_1933415_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_001262374.1|1933421_1934492_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	66.2	7.7e-65
WP_000693928.1|1934563_1934989_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|1934972_1935296_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|1935420_1935897_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000379610.1|1936215_1936368_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
1936693:1936711	attR	TGAATTTTGTGATGCGGTG	NA	NA	NA	NA
>prophage 10
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	2111005	2288576	5671594	integrase,capsid,transposase,holin,head,terminase,tail,protease	Escherichia_phage(29.33%)	209	2234532:2234591	2287651:2287715
WP_000998026.1|2111005_2112538_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	3.5e-297
WP_000233452.1|2113294_2115655_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000282084.1|2115809_2116373_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335695.1|2117193_2118627_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|2118845_2119043_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|2119278_2119575_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_096949893.1|2120686_2122504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|2122690_2123893_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_001297190.1|2124518_2124974_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_001307105.1|2125785_2126709_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001199164.1|2127192_2128464_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154411.1|2128469_2129597_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497942.1|2129654_2130485_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018496.1|2131150_2132659_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979516.1|2132817_2133027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341463.1|2133081_2137044_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191700.1|2137083_2137722_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001297176.1|2138009_2139101_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001307708.1|2139100_2139793_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126777.1|2139804_2140191_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001341462.1|2140198_2140999_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001171.1|2141008_2141599_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028095.1|2141609_2142104_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001240628.1|2142124_2143453_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001273658.1|2143535_2143709_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|2144082_2144679_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|2144699_2144927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001044313.1|2144964_2146206_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_000097601.1|2146497_2147757_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420629.1|2148016_2148937_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024561.1|2148936_2149242_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|2149334_2149934_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|2149930_2152477_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|2152476_2153649_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|2153778_2154471_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264955.1|2154443_2155472_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001121564.1|2155943_2156597_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_001002867.1|2156609_2157308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001131653.1|2157508_2158090_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_106420821.1|2158080_2158275_-	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_000767050.1|2158219_2158762_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023995.1|2158983_2159253_-|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000279017.1|2159254_2160568_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001230429.1|2160632_2161232_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_106875412.1|2161298_2164775_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	97.2	0.0e+00
WP_096844540.1|2165010_2165643_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106907871.1|2165588_2166332_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	9.2e-150
WP_001357740.1|2166337_2167036_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|2167035_2167377_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212878.1|2167369_2170612_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.1	0.0e+00
WP_001453698.1|2170663_2170873_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030040.1|2170968_2171343_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|2171348_2172065_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|2172131_2172476_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2172472_2172919_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2172915_2173266_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2173275_2173602_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2175966_2176188_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_044165196.1|2176232_2178170_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_106907872.1|2178216_2179896_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.9	0.0e+00
WP_000958380.1|2179892_2180456_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000829192.1|2180744_2181110_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_032277401.1|2181151_2181352_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	95.5	2.8e-29
WP_000828068.1|2181483_2181810_-	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_001109019.1|2182155_2182707_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	100.0	4.5e-101
WP_071529499.1|2182945_2183131_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001280922.1|2183353_2183485_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000661712.1|2183579_2184275_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000087733.1|2184548_2185082_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001072901.1|2185086_2185302_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2185379_2185625_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2185665_2185845_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_106907873.1|2185980_2187918_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.5	0.0e+00
WP_000752026.1|2188417_2188687_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2188696_2189644_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000144759.1|2190576_2190771_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107963.1|2190767_2191373_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_001004024.1|2191372_2192095_-	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_000211422.1|2192169_2192904_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|2193178_2193361_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|2193357_2193885_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|2193881_2194328_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|2194284_2194521_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|2194531_2194747_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|2194879_2195158_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|2195228_2195519_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_106907874.1|2195515_2196217_-	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	99.6	2.9e-129
WP_000185456.1|2196213_2197152_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000438542.1|2197184_2197481_-	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_001180318.1|2197619_2197847_-	transcriptional regulator	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|2197925_2198633_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001133195.1|2198802_2199705_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	86.5	2.2e-150
WP_000198444.1|2200216_2200600_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000248817.1|2200810_2201125_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.0	2.3e-54
WP_000065373.1|2201275_2201644_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198858.1|2201716_2201857_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361826.1|2201849_2201993_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_000995407.1|2202068_2202365_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000100847.1|2202370_2203156_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186781.1|2203152_2203833_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000682304.1|2203829_2204012_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548528.1|2203984_2204176_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001386642.1|2204186_2204468_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763378.1|2204566_2204788_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289864.1|2204784_2205192_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582235.1|2205193_2205949_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	7.1e-142
WP_000208003.1|2205959_2206742_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	67.8	1.1e-47
WP_000376716.1|2206741_2207020_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_001368678.1|2207177_2207477_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000545713.1|2207512_2207680_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001281197.1|2207708_2208053_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001303849.1|2208170_2208389_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|2208366_2209440_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_106907875.1|2209534_2212279_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_000818472.1|2212350_2213424_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2213471_2213645_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|2213634_2213865_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|2213839_2214028_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|2214038_2214251_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|2214536_2214749_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|2215190_2215496_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|2215602_2216247_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|2216243_2216990_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742348.1|2216989_2219086_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|2219131_2220271_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|2220258_2220705_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_032276985.1|2220724_2222905_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|2223019_2224318_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000399648.1|2224581_2225562_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000270305.1|2225676_2225769_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|2225781_2226918_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071527988.1|2226929_2228426_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|2228608_2229466_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063972.1|2229462_2229861_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|2229857_2230445_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|2230441_2231149_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2231167_2232961_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2232957_2234076_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
2234532:2234591	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_095585410.1|2234672_2234825_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|2235201_2236563_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|2237017_2237287_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381395.1|2237324_2238896_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2238915_2239263_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_106907876.1|2239262_2239940_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	45.2	1.2e-20
WP_106875435.1|2239989_2241309_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	98.4	7.5e-78
WP_001230428.1|2241373_2241973_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_158708131.1|2245758_2246391_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.9e-103
WP_106907878.1|2246336_2247080_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	4.3e-147
WP_001357740.1|2247085_2247784_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|2247783_2248125_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212878.1|2248117_2251360_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.1	0.0e+00
WP_001453698.1|2251411_2251621_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030040.1|2251716_2252091_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.9e-64
WP_001275476.1|2252096_2252813_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|2252879_2253224_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2253220_2253667_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2253663_2254014_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|2254024_2254351_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|2256877_2257099_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|2257143_2259081_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_106907879.1|2259145_2260807_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000958380.1|2260803_2261367_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001375434.1|2261660_2262026_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
WP_001448509.1|2262067_2262292_+	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_001302717.1|2262373_2262688_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2263213_2263399_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000455402.1|2263626_2263776_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001056883.1|2263775_2264345_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000087714.1|2264619_2265153_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001072901.1|2265157_2265373_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2265450_2265696_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2265736_2265916_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_106875437.1|2266051_2267989_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000466957.1|2268466_2268898_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|2269347_2270061_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917770.1|2270195_2270393_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640048.1|2270634_2271165_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904103.1|2271173_2271533_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_001265113.1|2271545_2272592_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001342259.1|2272593_2272866_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001260977.1|2273001_2273259_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220601.1|2273264_2273564_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_000206830.1|2273768_2274113_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_001229296.1|2274109_2274475_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000209152.1|2274476_2274695_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001289353.1|2274782_2275418_-	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_001224662.1|2275583_2275766_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000935422.1|2275799_2276012_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_000403783.1|2276062_2276419_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_001209480.1|2276396_2276858_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_001266133.1|2276854_2277151_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001040234.1|2277147_2277540_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_000450641.1|2277555_2278281_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_072096947.1|2278314_2278857_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000729535.1|2278768_2279779_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_000693932.1|2279865_2280303_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_001172789.1|2280299_2280560_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000578360.1|2280686_2281079_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001022415.1|2281125_2281485_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000692026.1|2281487_2281790_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_024182289.1|2282203_2282404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|2282496_2282715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|2282718_2282883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2283283_2283472_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2283468_2283657_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048499.1|2283751_2286202_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|2286269_2286512_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2286489_2287509_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375138.1|2287916_2288576_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
2287651:2287715	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 11
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	2545101	2629462	5671594	portal,integrase,transposase,holin,head,terminase,protease,tail,lysis	Enterobacteria_phage(44.44%)	103	2546227:2546261	2630896:2630930
WP_000399648.1|2545101_2546082_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
2546227:2546261	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001145128.1|2546341_2546824_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001218655.1|2546943_2549094_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_000386551.1|2549121_2550084_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443534.1|2550224_2551310_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_001296991.1|2553134_2553806_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|2553808_2554804_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|2554796_2556533_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|2556525_2557659_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|2557669_2558776_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|2558737_2559148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113363.1|2559280_2560042_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|2560038_2561280_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045454.1|2561279_2562236_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446932.1|2562271_2562985_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|2563189_2563894_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|2564030_2564483_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|2564484_2564730_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|2564722_2565208_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|2565210_2565723_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|2565744_2566734_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|2567130_2568039_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|2568230_2570252_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|2570830_2571508_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|2571500_2572256_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|2572242_2573397_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|2573393_2574434_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001443724.1|2574520_2575810_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|2575868_2576345_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_032324251.1|2576848_2577502_+	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_000354291.1|2577514_2577736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|2577819_2578200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448642.1|2578400_2578976_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001339397.1|2579036_2579714_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2579713_2580061_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_106875440.1|2580080_2581652_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	2.2e-169
WP_021351651.1|2582126_2582498_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652081.1|2582621_2583449_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_000950982.1|2583672_2584554_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|2584659_2584929_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_032284503.1|2584930_2586145_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	4.0e-78
WP_001233130.1|2586209_2586809_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_032284504.1|2586876_2590353_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_058157573.1|2590591_2591224_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	2.9e-104
WP_032284506.1|2591169_2591913_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.0e-148
WP_001357740.1|2591918_2592617_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847304.1|2592616_2592946_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|2592942_2595522_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|2595502_2595916_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|2595942_2596374_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|2596387_2597140_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_032284507.1|2597147_2597516_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_000099160.1|2597512_2599051_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2599099_2599447_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2599443_2599848_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001254029.1|2599925_2600102_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_106875443.1|2600091_2601684_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	1.6e-183
WP_000259002.1|2601680_2601887_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_009442816.1|2601870_2603799_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235451.1|2603770_2604280_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_001307652.1|2604675_2604870_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|2605057_2605675_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|2605824_2606262_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|2606258_2606756_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|2606755_2606962_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000499454.1|2609572_2609731_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2609816_2610560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|2610744_2611434_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|2611448_2611571_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|2611910_2612870_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|2613082_2613271_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|2613267_2613630_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|2613626_2613917_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|2613916_2614639_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|2614631_2614841_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_000924601.1|2614800_2615202_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|2615204_2615381_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|2615377_2615788_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|2615759_2616116_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000145926.1|2616412_2616703_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_032278733.1|2616699_2617380_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	1.4e-125
WP_000438538.1|2618356_2618656_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000064150.1|2618794_2619028_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000428099.1|2619141_2619846_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000193240.1|2620114_2620477_+	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000088201.1|2621083_2621356_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000073663.1|2621379_2621919_-	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_001341800.1|2622282_2623143_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|2623167_2623299_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|2623283_2623436_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|2623692_2624298_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|2624297_2624681_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|2624704_2624998_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|2625008_2625173_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|2625169_2625727_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034231.1|2625723_2626281_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|2626282_2626900_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_012817743.1|2626896_2627199_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000002107.1|2627191_2627476_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545733.1|2627548_2627716_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|2627744_2628089_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|2628195_2628414_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|2628391_2629462_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
2630896:2630930	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 12
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	2857995	2907700	5671594	portal,capsid,integrase,transposase,head,terminase,tail,protease,lysis	Enterobacteria_phage(58.93%)	65	2857527:2857573	2907714:2907760
2857527:2857573	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2857995_2858949_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|2859135_2860620_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|2860803_2861109_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|2861165_2861834_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000279150.1|2862473_2865434_-	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_001230523.1|2865498_2866098_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000515439.1|2866168_2869582_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090884.1|2869642_2870275_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152557.1|2870960_2871659_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000847347.1|2871658_2871988_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|2871984_2874546_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|2874538_2874973_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|2874954_2875377_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|2875392_2876133_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|2876140_2876536_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|2876532_2877111_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|2877101_2877476_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|2877487_2877883_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|2877924_2878950_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|2879005_2879338_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000088640.1|2879347_2880226_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_032284515.1|2880266_2880944_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2880943_2881291_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2881310_2882882_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001444138.1|2883354_2884956_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000198149.1|2884952_2885159_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_052922144.1|2885155_2887081_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453558.1|2887055_2887601_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001427981.1|2887989_2888184_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_106875444.1|2888301_2889514_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_157825797.1|2889480_2889648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738423.1|2889855_2890149_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2890239_2890422_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135274.1|2890638_2891136_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839596.1|2891135_2891351_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737278.1|2891939_2893022_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_001204791.1|2893210_2893594_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|2893679_2893820_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|2893816_2894179_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|2894175_2894466_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|2894458_2894629_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|2894628_2895084_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|2895080_2895182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|2895305_2895707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|2895685_2896102_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|2896401_2897010_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|2897762_2898110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788789.1|2898314_2899016_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_001342088.1|2899012_2899942_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_001182773.1|2900028_2900568_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|2900637_2900868_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|2900972_2901662_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000066829.1|2901743_2902007_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|2902142_2902463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206913.1|2902929_2903220_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_000995439.1|2903295_2903592_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001427106.1|2903597_2904383_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000611716.1|2904379_2905060_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|2905056_2905239_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|2905211_2905403_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|2905413_2905695_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763390.1|2905793_2906012_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|2906059_2906338_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|2906309_2906681_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|2906536_2907700_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
2907714:2907760	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 13
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	3648862	3690108	5671594	integrase,transposase	Stx2-converting_phage(57.14%)	40	3676267:3676281	3690278:3690292
WP_000099160.1|3648862_3650401_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|3650449_3650797_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|3650793_3651198_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_077221339.1|3651647_3651926_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001344112.1|3652559_3652736_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001339397.1|3652803_3653481_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3653480_3653828_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3653847_3655419_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000221529.1|3656158_3656728_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271003.1|3656893_3657295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|3657282_3657717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133395011.1|3658137_3658452_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.0	4.5e-50
WP_000612591.1|3658448_3658796_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|3658845_3660231_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|3660469_3661828_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|3662560_3662818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|3664568_3665090_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068905.1|3665086_3666040_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188267.1|3666126_3668451_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|3668495_3669398_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125190.1|3669394_3670393_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|3670389_3671346_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3671346_3672114_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|3672671_3672929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227281.1|3674282_3674855_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|3674903_3675728_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
3676267:3676281	attL	CGAAGGCCGGACTCG	NA	NA	NA	NA
WP_000016235.1|3676633_3678967_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000842358.1|3678981_3679305_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001014979.1|3679301_3679526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761643.1|3679525_3680074_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001084853.1|3680070_3680331_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000214377.1|3681245_3681998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991130.1|3681994_3682549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185332.1|3682550_3682823_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000381395.1|3683132_3684704_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3684723_3685071_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3685070_3685748_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000091133.1|3686037_3687624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032276966.1|3687762_3688602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772685.1|3688845_3690108_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
3690278:3690292	attR	CGAAGGCCGGACTCG	NA	NA	NA	NA
>prophage 14
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	3711382	3771954	5671594	protease,transposase	Stx2-converting_phage(25.0%)	58	NA	NA
WP_000399685.1|3711382_3712363_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000471889.1|3712590_3715287_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|3715427_3715481_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181312.1|3715665_3716613_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001297258.1|3716731_3718153_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001341327.1|3718202_3719858_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187778.1|3720251_3722390_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|3722548_3723013_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000839179.1|3723448_3723853_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|3723849_3724197_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|3724245_3725784_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001162171.1|3726088_3727441_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166267.1|3727534_3728086_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|3728241_3729615_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|3729790_3730789_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|3730821_3731817_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|3731803_3732826_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205813.1|3732839_3734342_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|3734481_3735438_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|3735747_3736278_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|3736357_3736708_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|3736701_3736953_-	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_001219160.1|3737164_3737506_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060926.1|3737508_3741288_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|3741284_3743018_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|3743223_3743862_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|3744184_3745528_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|3745589_3745796_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|3746120_3746678_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|3746667_3747408_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589460.1|3747597_3749541_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|3749669_3750050_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560553.1|3750138_3750999_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|3751106_3752072_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|3752179_3752842_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001345317.1|3753088_3754156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062220.1|3754254_3754689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000228344.1|3754955_3756359_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|3756667_3757288_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|3757506_3758145_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000440544.1|3758279_3759488_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	6.4e-209
WP_072097616.1|3759495_3760110_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
WP_001427815.1|3760549_3761344_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|3761414_3761864_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|3761905_3762133_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|3762137_3762452_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|3762458_3762854_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|3763180_3763456_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|3763584_3764271_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949511.1|3764270_3765125_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000056760.1|3765134_3765785_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|3765798_3766263_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|3766272_3766578_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001295191.1|3768345_3769410_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|3769517_3770273_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569731.1|3770269_3771019_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|3771200_3771530_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|3771678_3771954_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
>prophage 15
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	3783666	3831590	5671594	integrase,tRNA,protease,transposase	Vibrio_phage(20.0%)	45	3797182:3797196	3829243:3829257
WP_001232412.1|3783666_3784671_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3784673_3785933_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460361.1|3786018_3787299_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3787375_3787684_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|3787769_3788720_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|3788712_3790560_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|3790569_3791907_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|3791925_3792387_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_106907892.1|3792358_3793906_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294203.1|3793904_3795044_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_100699686.1|3795026_3795080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|3795944_3796490_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|3796584_3797637_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
3797182:3797196	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934920.1|3797733_3798702_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|3798723_3802047_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|3802075_3802390_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|3802386_3802701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|3802752_3804255_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|3804473_3805451_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|3805775_3807584_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|3807576_3808311_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|3808321_3808717_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|3808727_3809087_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|3809149_3810283_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|3810371_3810905_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3810901_3811219_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3811400_3811547_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|3811657_3811783_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3811834_3812401_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|3812442_3813471_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|3813860_3814730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399685.1|3814978_3815959_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|3816211_3816565_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3816702_3818349_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3818392_3818686_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|3818961_3820218_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|3820233_3820710_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_001427817.1|3821046_3822483_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3822600_3823902_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883338.1|3824017_3824356_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|3824331_3826029_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|3826065_3826641_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|3827020_3828286_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000704132.1|3828402_3829974_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
3829243:3829257	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
WP_001375513.1|3829970_3831590_-|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	4499823	4602442	5671594	portal,integrase,capsid,transposase,holin,head,tRNA,plate,terminase,protease,tail,lysis	Escherichia_phage(55.32%)	105	4532863:4532909	4564336:4564382
WP_000560983.1|4499823_4500261_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4500305_4501247_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4501310_4502219_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4502447_4502759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4502759_4503050_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4503655_4503874_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086390.1|4504092_4504335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399648.1|4504563_4505544_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000027708.1|4505943_4506873_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829008.1|4506869_4507505_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4507501_4508404_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4508416_4511467_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|4511660_4512494_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001298963.1|4512646_4513687_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931345.1|4513736_4515485_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000446023.1|4516545_4517997_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729592.1|4518007_4518454_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4518766_4519081_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009269.1|4519077_4520226_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179751.1|4520297_4521122_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_032277158.1|4521204_4522464_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144123.1|4522460_4523930_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_001341797.1|4524217_4524694_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001341961.1|4524668_4525055_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001369519.1|4525038_4525977_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063496.1|4525973_4527008_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4527292_4527913_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|4528172_4529156_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270270.1|4529304_4529979_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4530120_4531494_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4531490_4532189_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4532338_4532839_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4532863:4532909	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|4533025_4534006_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4534075_4534369_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4534505_4534778_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4534947_4535448_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4535511_4535736_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|4535735_4536038_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|4536037_4536262_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|4536258_4536534_+	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_032277160.1|4536523_4538800_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.9	0.0e+00
WP_001143636.1|4539000_4539945_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	76.1	2.5e-144
WP_000142509.1|4539952_4540942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559725.1|4540931_4542053_-	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	62.2	1.2e-97
WP_000038159.1|4542467_4543502_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.1e-200
WP_032277161.1|4543501_4545274_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_016237183.1|4545447_4546302_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MK3	Enterobacteria_phage	99.6	5.6e-135
WP_016242816.1|4546360_4547434_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	4.3e-201
WP_032277162.1|4547437_4548181_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	96.8	1.8e-121
WP_000988633.1|4548280_4548790_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_032277163.1|4548789_4548993_+|tail	tail protein X	tail	M1RZ22	Escherichia_phage	97.0	9.8e-30
WP_000123124.1|4548996_4549278_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|4549277_4549775_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_032277164.1|4549789_4550215_+	hypothetical protein	NA	Q858W1	Yersinia_virus	88.7	4.2e-59
WP_021548485.1|4550202_4550628_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.0	1.2e-64
WP_001440152.1|4550599_4550773_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917189.1|4550735_4551203_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	2.5e-81
WP_028985812.1|4551195_4551648_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.4e-76
WP_032277166.1|4551714_4552350_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	98.1	4.2e-111
WP_032277167.1|4552346_4552694_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121474.1|4552698_4553607_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285337.1|4553599_4554211_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_000376436.1|4556116_4556536_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_077628649.1|4556539_4556941_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	38.4	4.5e-10
WP_000905108.1|4556968_4557562_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	8.7e-103
WP_001286716.1|4557621_4558812_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|4558824_4559343_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031312.1|4559399_4559675_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4559707_4559827_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_032277172.1|4559819_4562267_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	93.1	0.0e+00
WP_000978890.1|4562281_4562761_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.1e-84
WP_032277174.1|4562760_4563924_+	phage late control D family protein	NA	M1SV93	Escherichia_phage	99.2	1.4e-205
WP_000468308.1|4564005_4564224_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4564460_4565363_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4564336:4564382	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4565543_4566506_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045673.1|4566824_4567814_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708994.1|4567920_4568676_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000802226.1|4569606_4570206_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4570306_4570747_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4570958_4571258_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4571284_4571713_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4571717_4572464_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4572560_4573571_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4573705_4575214_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4575236_4576082_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4576506_4576752_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4576836_4577322_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4577414_4578341_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|4578407_4579739_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4579748_4580279_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4580371_4581331_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4581422_4582448_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001341957.1|4582603_4584802_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4585004_4585217_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_106875459.1|4585376_4589549_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
WP_000644414.1|4589550_4589787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797347.1|4590779_4591388_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|4591571_4591889_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_001341952.1|4592165_4593326_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110785.1|4593328_4595761_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_000007523.1|4596109_4597000_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001297636.1|4597328_4599509_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001341951.1|4599602_4600508_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_000647882.1|4600534_4601152_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|4601461_4602442_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	4795325	4834210	5671594	integrase,transposase,head,plate,tail,protease	Shigella_phage(56.76%)	57	4791719:4791733	4805493:4805507
4791719:4791733	attL	CATCAGCGTGCGTTC	NA	NA	NA	NA
WP_001056416.1|4795325_4795910_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001310454.1|4796077_4796326_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289295.1|4796327_4798418_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
WP_000129790.1|4798489_4799422_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000257930.1|4799424_4799646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|4799658_4799913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4799914_4800196_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|4800192_4800465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|4800469_4800763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|4800774_4801305_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_106907905.1|4801402_4801906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578573.1|4801948_4802482_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000465562.1|4802481_4802997_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|4803000_4803552_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633440.1|4803548_4803860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|4803874_4804225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|4804240_4804573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|4804565_4804763_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|4804752_4805049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|4805045_4805555_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
4805493:4805507	attR	GAACGCACGCTGATG	NA	NA	NA	NA
WP_000852377.1|4805624_4806050_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|4806121_4806622_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|4806656_4807085_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122253.1|4807068_4807287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|4807297_4807525_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|4807505_4807814_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|4807810_4808101_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|4808103_4808685_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|4808684_4810349_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|4810348_4811938_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|4811921_4813253_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000094808.1|4813374_4813848_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|4814024_4815149_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|4815148_4816096_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002057.1|4816139_4816526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|4816522_4816942_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|4816938_4817499_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|4817499_4817745_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|4817741_4819244_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|4819252_4819618_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|4819632_4820109_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113523.1|4820235_4822311_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000146116.1|4822297_4823647_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|4823630_4824755_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|4824744_4825359_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|4825351_4825789_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|4825788_4826871_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|4826861_4827422_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_010917875.1|4828105_4828309_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|4828388_4828910_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000904930.1|4829391_4829952_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|4830051_4832091_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|4832237_4832420_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|4832455_4832701_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|4832739_4833204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|4833318_4833519_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|4833472_4834210_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
>prophage 18
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	5369188	5377137	5671594	integrase,transposase	Stx2-converting_phage(42.86%)	7	5370080:5370096	5379165:5379181
WP_001272558.1|5369188_5369944_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
5370080:5370096	attL	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000935135.1|5370230_5371838_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_000852869.1|5371830_5372490_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000082600.1|5373398_5374127_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_001339397.1|5374521_5375199_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5375198_5375546_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5375565_5377137_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
5379165:5379181	attR	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 19
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	5529364	5536504	5671594		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|5529364_5530003_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|5529999_5531262_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|5531258_5532167_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|5532362_5533130_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_032276729.1|5533180_5533837_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	3.6e-49
WP_001272924.1|5533942_5536504_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 20
NZ_CP027472	Escherichia coli strain 2014C-3050 chromosome, complete genome	5671594	5609121	5660730	5671594	integrase,capsid,holin,head,terminase,tail	Stx2-converting_phage(41.07%)	59	5612843:5612857	5624885:5624899
WP_000577251.1|5609121_5610840_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000214985.1|5610841_5612590_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000448925.1|5612661_5613078_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
5612843:5612857	attL	ATATCGCCTTGATCA	NA	NA	NA	NA
WP_001427612.1|5613116_5614337_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.3	3.5e-231
WP_001431537.1|5614635_5615544_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_000516611.1|5616025_5617201_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_000557643.1|5617373_5617520_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000457722.1|5617523_5617766_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000206753.1|5617850_5618714_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000034210.1|5618715_5619045_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000158004.1|5619274_5619478_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000335005.1|5619474_5620353_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000008174.1|5620343_5620880_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_032277355.1|5621008_5621833_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.5	8.6e-149
WP_000135680.1|5621898_5622261_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|5622927_5623602_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|5623692_5623893_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|5623936_5624488_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087337.1|5624484_5625321_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.6	8.7e-149
5624885:5624899	attR	TGATCAAGGCGATAT	NA	NA	NA	NA
WP_001444024.1|5625325_5625550_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	94.6	2.5e-34
WP_000061512.1|5625546_5626365_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	95.6	3.0e-117
WP_001447905.1|5626361_5626856_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	1.2e-86
WP_001427609.1|5626855_5627509_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_000210162.1|5627505_5627832_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	99.1	1.2e-53
WP_000767105.1|5627828_5628218_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_001061413.1|5628237_5629035_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_001427606.1|5629042_5630032_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	1.6e-194
WP_001205460.1|5630049_5630391_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131907.1|5630403_5630952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|5630938_5631865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106907916.1|5632984_5634922_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_000143462.1|5635057_5635237_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290231.1|5635277_5635550_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284519.1|5635626_5635842_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731236.1|5635846_5636191_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992122.1|5636241_5636775_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_047091958.1|5637293_5637479_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000736096.1|5637564_5637789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095736.1|5638157_5638385_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001365481.1|5638426_5638792_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	98.3	5.8e-65
WP_000958416.1|5639081_5639645_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001457603.1|5639641_5641303_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_032284581.1|5641366_5643304_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063106.1|5643348_5643570_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	98.6	2.2e-35
WP_000125984.1|5646096_5646423_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|5646433_5646784_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5646780_5647227_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|5647223_5647568_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000710952.1|5648365_5648740_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_122993730.1|5648835_5649045_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	92.8	2.6e-30
WP_000212998.1|5649095_5652338_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.5	0.0e+00
WP_000807927.1|5652330_5652672_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_001163793.1|5652671_5653370_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.7e-129
WP_032284643.1|5653380_5654124_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	4.5e-149
WP_058157573.1|5654069_5654702_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	2.9e-104
WP_106907917.1|5654940_5658414_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.7	0.0e+00
WP_001427270.1|5658481_5659081_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000268987.1|5659145_5660459_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001023420.1|5660460_5660730_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
>prophage 1
NZ_CP027473	Escherichia coli strain 2014C-3050 plasmid unnamed	81624	11040	17073	81624	transposase	Stx2-converting_phage(66.67%)	6	NA	NA
WP_106907920.1|11040_12255_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_106907921.1|13060_14059_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.7	8.1e-101
WP_001341442.1|14201_14429_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_106907922.1|14482_15157_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	30.1	3.1e-11
WP_000631725.1|15153_15501_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|15504_17073_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
