The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	242996	278068	5001754	holin,lysis,portal,integrase,coat,terminase	Enterobacteria_phage(61.4%)	59	275149:275164	282655:282670
WP_059319821.1|242996_243263_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	88.1	3.6e-32
WP_106888416.1|243333_243819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888417.1|243909_245907_-	DNA transfer protein	NA	Q716G2	Shigella_phage	96.5	0.0e+00
WP_106888418.1|245906_247295_-	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	65.3	1.3e-152
WP_021562334.1|247304_247997_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	99.6	3.5e-111
WP_000614031.1|247999_248455_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	1.5e-86
WP_032351131.1|248454_249303_-	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	99.6	1.1e-103
WP_106888419.1|249302_250721_-	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	99.2	1.3e-274
WP_001054834.1|250720_251221_-	DNA recombination protein RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
WP_000115360.1|251198_251786_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	63.0	2.0e-62
WP_001196946.1|251829_253125_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.3	9.4e-243
WP_000373006.1|253124_254036_-	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	100.0	1.3e-161
WP_106888420.1|254049_256215_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.7	0.0e+00
WP_106888421.1|256215_257715_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.2	2.0e-305
WP_106888422.1|257692_258181_-	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	99.4	1.1e-87
WP_000807792.1|258260_258503_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	2.9e-36
WP_001109020.1|258712_259255_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|259461_259614_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_106888424.1|259601_260039_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	96.6	2.5e-70
WP_106888425.1|260035_260512_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	1.9e-87
WP_000783734.1|260495_260819_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_106888426.1|261495_262119_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	8.9e-114
WP_000994515.1|262115_262304_-	protein ninH	NA	K7PH29	Enterobacteria_phage	100.0	1.9e-27
WP_001008210.1|262300_262663_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	2.7e-62
WP_021499323.1|262659_262950_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	1.7e-51
WP_001279421.1|262949_263219_-	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000950962.1|263211_263388_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_106888427.1|263387_263747_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	3.5e-62
WP_001254255.1|263749_263926_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814617.1|263922_264333_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	1.1e-69
WP_089615022.1|264532_264853_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	73.6	2.2e-36
WP_000818849.1|264870_265077_-	hypothetical protein	NA	G9L683	Escherichia_phage	86.8	1.6e-24
WP_001248388.1|265149_266526_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_106888428.1|266522_267344_-	replication protein	NA	K7P707	Enterobacteria_phage	99.6	1.5e-153
WP_000424164.1|267526_267805_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	100.0	3.6e-43
WP_000620665.1|267913_268108_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_000428318.1|268214_268931_+	helix-turn-helix domain-containing protein	NA	K7PGR7	Enterobacteria_phage	100.0	9.2e-123
WP_000233126.1|268948_269317_+	hypothetical protein	NA	K7PJJ3	Enterobacteria_phage	100.0	1.3e-56
WP_106888429.1|269684_269990_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	91.8	2.9e-25
WP_000394299.1|270320_270572_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_106888430.1|270611_270908_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	93.9	2.3e-48
WP_000865176.1|270907_271096_+	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	59.3	3.8e-12
WP_014532157.1|271176_271452_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	98.9	5.9e-46
WP_000604111.1|271536_271845_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_106888431.1|271841_272744_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	88.4	5.2e-147
WP_000041322.1|272727_273210_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	99.4	8.4e-80
WP_000753555.1|273221_273536_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_024215524.1|273552_273834_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	3.3e-44
WP_001214456.1|273830_273995_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_106888432.1|273991_274468_+	hypothetical protein	NA	K7P729	Enterobacteria_phage	89.9	1.4e-74
WP_072019243.1|274464_274707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001350881.1|274699_274909_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	98.6	2.0e-33
WP_106888433.1|274905_275358_+	ead/Ea22-like family protein	NA	K7PK20	Enterobacteria_phage	89.4	2.6e-46
275149:275164	attL	GTGCTGGCGCTGCTGG	NA	NA	NA	NA
WP_106888434.1|275362_275896_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	61.9	1.1e-43
WP_106888435.1|275892_276153_+	eaa protein	NA	A0A077SLR0	Escherichia_phage	95.3	3.9e-39
WP_148934116.1|276259_276559_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	98.0	5.1e-51
WP_000545734.1|276594_276762_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|276801_277020_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533656.1|276997_278068_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.5e-201
282655:282670	attR	CCAGCAGCGCCAGCAC	NA	NA	NA	NA
>prophage 2
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	500406	556919	5001754	portal,lysis,integrase,capsid,head,terminase,tail,transposase,protease	Enterobacteria_phage(69.64%)	70	508884:508930	556933:556979
WP_106888444.1|500406_501543_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383932.1|501808_504046_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001612570.1|504032_507005_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001612569.1|507005_507896_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|508078_508840_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
508884:508930	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_106888445.1|509354_510308_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_106888446.1|510494_511979_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937500.1|512161_512467_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|512523_513192_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885570.1|513246_513831_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_106888447.1|513830_516857_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	69.1	2.1e-67
WP_032236520.1|516921_517521_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	1.7e-106
WP_048943199.1|517588_521068_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_159026620.1|521128_521731_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	2.1e-88
WP_106888449.1|521667_522411_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	3.0e-145
WP_001152612.1|522416_523115_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_097336391.1|523114_523444_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.7e-52
WP_097336390.1|523440_525990_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	89.1	0.0e+00
WP_000459457.1|525982_526417_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_106888450.1|526398_526821_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	1.2e-58
WP_106888569.1|526836_527577_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	5.0e-132
WP_000683105.1|527584_527980_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|527976_528555_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000753007.1|528566_528920_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158905.1|528931_529330_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063277.1|529371_530397_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001295978.1|530453_530786_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123218.1|530795_532115_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001581760.1|532095_533697_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|533693_533900_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027259.1|533896_535822_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|535796_536342_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_053266578.1|536730_536925_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|537284_537578_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|537668_537851_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135280.1|538067_538565_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_000839596.1|538564_538780_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737283.1|539368_540466_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|540655_541039_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000971055.1|541124_541265_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|541261_541624_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|541620_541911_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224914.1|541903_542074_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053027.1|542073_542529_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	2.2e-61
WP_072097297.1|542525_542627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990013.1|542723_543233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338664.1|543467_543791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709099.1|543902_545429_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
WP_001348591.1|545486_545636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|545684_546017_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145901.1|546084_546387_-	protein ren	NA	M1FPD5	Enterobacteria_phage	97.8	6.1e-44
WP_000788890.1|546383_547085_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_159026626.1|547081_548011_-	Replication protein O	NA	M1FN81	Enterobacteria_phage	66.7	3.7e-108
WP_001566184.1|548097_548637_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_000184665.1|548667_548895_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_024185289.1|549005_549698_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.7	2.5e-109
WP_000654525.1|549821_550844_+	hypothetical protein	NA	U5P4L0	Shigella_phage	52.0	1.2e-96
WP_000841194.1|550865_551372_+	hypothetical protein	NA	U5P455	Shigella_phage	32.7	1.2e-07
WP_123002837.1|551769_552060_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	89.7	1.8e-29
WP_000904075.1|552064_552370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000995439.1|552508_552805_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|552810_553596_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_106888452.1|553592_554273_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000149544.1|554269_554452_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_085455316.1|554424_554622_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	95.4	1.2e-24
WP_001443983.1|554632_554914_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763385.1|555012_555231_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|555278_555557_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000446905.1|555528_555900_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|555755_556919_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
556933:556979	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 3
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	891499	919581	5001754	transposase,plate	Clostridioides_phage(25.0%)	24	NA	NA
WP_001612413.1|891499_891997_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_000056850.1|892172_892922_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|893131_893392_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_024171431.1|893394_893673_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|893828_894569_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|894539_895307_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|895512_896091_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001612411.1|896330_898775_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000532698.1|898817_899291_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118037.1|899444_900212_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_059321394.1|900685_901822_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001077738.1|902290_902668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888458.1|902667_907173_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	6.2e-23
WP_001612407.1|907248_909390_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	5.3e-25
WP_001142958.1|909599_910118_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|910815_911316_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|911350_911575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|911625_913101_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|913107_913521_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_032300587.1|913524_915375_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001612404.1|915338_916421_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113713.1|916445_917726_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|917722_918247_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001612403.1|918249_919581_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 4
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	1328384	1386852	5001754	transposase,protease	Klosneuvirus(11.11%)	59	NA	NA
WP_001162171.1|1328384_1329737_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001719346.1|1329830_1330382_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|1330537_1331911_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|1332086_1333085_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596014.1|1333117_1334113_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001719344.1|1334099_1335122_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001719343.1|1335135_1336638_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	1.4e-19
WP_032301153.1|1336737_1337703_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|1338012_1338543_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_001219160.1|1338922_1339264_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001719340.1|1339266_1343046_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|1343042_1344776_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|1344981_1345620_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|1345942_1347286_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|1347347_1347554_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|1347878_1348433_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_001719338.1|1348522_1349434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886909.1|1349645_1350386_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_001719337.1|1350575_1352519_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001317588.1|1352647_1353028_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032301152.1|1353116_1353977_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_032301151.1|1354084_1355050_+	DMT family transporter	NA	NA	NA	NA	NA
WP_001719334.1|1355157_1355820_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|1355864_1357277_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|1357585_1358206_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|1358423_1359062_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_106888468.1|1359196_1360405_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	6.4e-209
WP_000604912.1|1360412_1360844_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001308220.1|1361467_1362262_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|1362332_1362782_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|1362823_1363051_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|1363055_1363370_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|1363376_1363772_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|1364098_1364374_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|1364502_1365189_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000949511.1|1365188_1366043_-	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001719329.1|1366052_1366703_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776543.1|1366716_1367181_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|1367190_1367496_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_032201196.1|1367511_1368909_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|1369263_1370328_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|1370435_1371191_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001719327.1|1371187_1371937_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|1372118_1372448_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|1372596_1372872_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001719326.1|1372988_1374614_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|1374697_1375861_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|1375863_1376502_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1376511_1376910_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1376927_1377587_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1377637_1378336_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1378354_1378756_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1378882_1379614_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|1379794_1382236_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177644.1|1382274_1382700_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1382904_1384203_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1384306_1384504_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1384585_1385590_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1385592_1386852_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 5
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	2982995	2990135	5001754		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2982995_2983634_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001613685.1|2983630_2984893_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|2984889_2985798_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001613684.1|2985993_2986761_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001613683.1|2986811_2987468_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	6.6e-51
WP_001272907.1|2987573_2990135_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
>prophage 6
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	3026831	3145144	5001754	tRNA,portal,lysis,plate,capsid,head,terminase,tail	Salmonella_phage(67.27%)	116	NA	NA
WP_000047196.1|3026831_3029462_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|3029696_3029882_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|3031072_3031639_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|3031635_3032064_+	DedA family protein	NA	NA	NA	NA	NA
WP_001613656.1|3032136_3033693_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|3033842_3034358_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001613653.1|3035515_3036223_-	RNA ligase family protein	NA	NA	NA	NA	NA
WP_001295176.1|3036480_3038019_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001613652.1|3038035_3039208_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|3039334_3039865_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119749.1|3039955_3040291_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|3040280_3041018_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000165699.1|3041141_3042326_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216525.1|3042517_3043510_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|3043566_3044631_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985494.1|3044623_3045826_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|3046180_3047140_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_001613651.1|3047149_3049294_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	5.4e-195
WP_000080944.1|3049266_3049677_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|3049673_3049919_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|3050166_3050496_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_001613650.1|3050647_3050992_+	YgaC family protein	NA	NA	NA	NA	NA
WP_106888510.1|3051028_3051478_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|3052145_3052550_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229467.1|3052596_3053121_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|3053130_3053430_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|3053612_3053771_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|3053854_3054304_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|3054304_3054967_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|3054987_3056388_-	GABA permease	NA	NA	NA	NA	NA
WP_001613645.1|3056625_3057906_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	1.6e-32
WP_000772847.1|3057919_3059368_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001613643.1|3059390_3060659_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001613642.1|3060678_3061656_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_001613641.1|3061991_3064244_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001613640.1|3065630_3066980_+	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_071589635.1|3067358_3067577_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	72.0	4.1e-10
WP_001120794.1|3067731_3067851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001613639.1|3067915_3072502_+	adhesin-like autotransporter YpjA/EhaD	NA	NA	NA	NA	NA
WP_042017594.1|3072792_3073839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042017593.1|3074871_3075504_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.6	2.7e-65
WP_000102105.1|3075620_3075863_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_031591568.1|3075895_3076405_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
WP_000956182.1|3076412_3076613_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001311552.1|3076576_3076918_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_042017591.1|3076985_3077219_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_001556503.1|3077218_3077446_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_001556504.1|3077442_3078300_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	1.4e-157
WP_042017590.1|3078296_3080711_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.5	0.0e+00
WP_001154431.1|3080863_3081052_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|3081062_3081296_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001059831.1|3081488_3081824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818977.1|3082356_3084138_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_042017588.1|3084178_3085204_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.1	2.9e-170
WP_042017587.1|3085203_3086970_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	98.6	0.0e+00
WP_042017586.1|3087112_3087946_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.7	9.1e-122
WP_042017585.1|3087962_3089021_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	4.2e-180
WP_000059191.1|3089024_3089675_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_042017584.1|3089770_3090235_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	7.1e-76
WP_000868175.1|3090234_3090438_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|3090441_3090657_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069899.1|3090637_3091150_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.9	1.4e-88
WP_042017583.1|3091151_3091529_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.8e-16
WP_001337513.1|3091525_3091954_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_001039935.1|3092049_3092481_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_042017582.1|3092473_3092920_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	2.3e-63
WP_042017581.1|3092988_3093567_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	82.3	3.5e-88
WP_000177580.1|3093563_3093923_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000268297.1|3093909_3094818_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
WP_001086833.1|3094810_3095416_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_042016842.1|3096855_3097299_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	4.9e-82
WP_042016844.1|3097270_3097873_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	8.3e-101
WP_042016864.1|3098438_3099005_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	6.4e-87
WP_042016863.1|3099147_3100320_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|3100329_3100845_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|3100899_3101202_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|3101216_3101336_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_042016861.1|3101328_3104406_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980391.1|3104402_3104888_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_032253581.1|3104884_3105985_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.3e-176
WP_000980501.1|3106053_3106272_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_000391795.1|3106298_3106781_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	2.7e-17
WP_000162574.1|3107481_3107964_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|3108095_3108572_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001613631.1|3108561_3108852_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3108913_3109255_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001613629.1|3109403_3111065_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|3111150_3112029_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|3112151_3112745_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_032149952.1|3112799_3114086_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|3114106_3114898_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3115064_3116426_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3116562_3116811_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3116829_3117378_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_001613628.1|3117408_3118176_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3118217_3118565_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|3118641_3119124_-	OmpA family protein	NA	NA	NA	NA	NA
WP_001613626.1|3119139_3120366_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|3120355_3120874_-	YfiR family protein	NA	NA	NA	NA	NA
WP_106888511.1|3121023_3121344_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168032.1|3121553_3122624_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001613624.1|3122634_3123756_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|3123798_3124959_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010723158.1|3125057_3125105_-	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000178456.1|3125208_3125550_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3125826_3126564_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079092.1|3126698_3127679_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040122.1|3127675_3128407_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3128536_3131110_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|3136888_3138187_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|3138183_3138507_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|3138552_3139908_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001613623.1|3140021_3142682_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000138184.1|3142713_3143412_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3143480_3143900_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|3144106_3145144_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	3630215	3639660	5001754		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569319.1|3630215_3631142_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|3631146_3631878_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3631858_3631966_-	protein YohO	NA	NA	NA	NA	NA
WP_001240399.1|3632025_3632757_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|3632978_3634664_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3634660_3635380_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3635426_3635897_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3635937_3636399_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001613415.1|3636523_3638527_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.7	0.0e+00
WP_001292770.1|3638523_3639660_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 8
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	3872495	3940092	5001754	holin,lysis,tRNA,integrase,portal,capsid,head,terminase,tail	Escherichia_phage(37.7%)	77	3864999:3865017	3901723:3901741
3864999:3865017	attL	GCATTTTCGGCGGATAAGT	NA	NA	NA	NA
WP_001613267.1|3872495_3874229_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
WP_001295504.1|3874444_3875011_+	VOC family protein	NA	NA	NA	NA	NA
WP_001613265.1|3875024_3875771_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214304.1|3876158_3877259_+	cytochrome c	NA	NA	NA	NA	NA
WP_001613264.1|3877283_3879713_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564730.1|3879877_3880849_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019590.1|3880845_3881589_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000252971.1|3881629_3882025_-	membrane protein	NA	NA	NA	NA	NA
WP_106888571.1|3882077_3882842_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.0e-72
WP_106888529.1|3882858_3884145_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	97.0	3.7e-247
WP_001193437.1|3884178_3884433_-	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_032295370.1|3884451_3884586_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	88.6	8.7e-19
WP_000459914.1|3884589_3884832_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	93.8	2.4e-35
WP_001367902.1|3884863_3885235_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.9	4.2e-63
WP_000720013.1|3885275_3886103_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.6	1.6e-131
WP_028985373.1|3886472_3887045_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	67.6	9.7e-75
WP_000553977.1|3887050_3887233_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_000147364.1|3887431_3887632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050457556.1|3887628_3888102_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	75.4	6.0e-22
WP_028985374.1|3888485_3889190_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	53.2	2.4e-67
WP_028985375.1|3889313_3889559_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	52.9	2.2e-12
WP_000867913.1|3889629_3889923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096096184.1|3890042_3890750_+	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	88.5	1.6e-114
WP_000794367.1|3890802_3891627_+	transporter	NA	Q8W644	Enterobacteria_phage	99.6	1.0e-157
WP_028985377.1|3891623_3892475_+	hypothetical protein	NA	Q8HA97	Salmonella_phage	68.7	4.8e-102
WP_000618002.1|3892471_3892696_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_096096181.1|3892692_3893604_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	90.6	3.9e-142
WP_028985379.1|3893623_3894514_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	62.9	1.3e-81
WP_028985380.1|3894510_3895911_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.3	1.2e-243
WP_001065352.1|3895907_3896165_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_050864163.1|3896216_3897206_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	99.4	9.5e-195
WP_024213837.1|3897224_3897659_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	98.6	5.3e-81
WP_000691354.1|3898165_3899113_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|3899122_3899392_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_099528339.1|3899895_3901833_+	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	94.3	0.0e+00
3901723:3901741	attR	GCATTTTCGGCGGATAAGT	NA	NA	NA	NA
WP_000142786.1|3901966_3902146_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	94.9	3.2e-24
WP_001290210.1|3902186_3902432_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	100.0	3.6e-18
WP_000284506.1|3902509_3902725_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_096096232.1|3902728_3903313_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.3	3.8e-50
WP_001063217.1|3903292_3903613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096096231.1|3903738_3904272_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	96.6	3.6e-100
WP_001056888.1|3904546_3905119_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	88.4	9.0e-97
WP_032295774.1|3905118_3905268_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	77.6	2.0e-11
WP_032295775.1|3905270_3905708_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.2	1.8e-68
WP_028985600.1|3905910_3906453_+	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	99.4	4.1e-99
WP_000867498.1|3907121_3907667_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_099528340.1|3907641_3909567_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198155.1|3909563_3909770_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	97.1	8.4e-29
WP_001365551.1|3909766_3911368_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.1e-308
WP_000123260.1|3911348_3912668_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001299443.1|3912677_3913010_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_106888530.1|3913064_3914090_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	1.2e-189
WP_028985614.1|3914131_3914530_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	93.2	5.7e-58
WP_028985615.1|3914541_3914895_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	86.3	1.1e-52
WP_028985616.1|3914910_3915486_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	1.9e-49
WP_000683074.1|3915482_3915878_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	80.9	2.2e-57
WP_000235126.1|3915885_3916635_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.4	1.6e-130
WP_001299690.1|3916650_3917082_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_071532372.1|3917108_3917522_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	2.3e-41
WP_099528342.1|3917502_3920082_+|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	86.1	0.0e+00
WP_000847280.1|3920078_3920408_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_001365876.1|3920407_3921106_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.4e-131
WP_106888531.1|3921116_3921860_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.8	7.3e-147
WP_123008253.1|3921805_3922438_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.0	8.7e-101
WP_106888532.1|3922678_3926374_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.0	0.0e+00
WP_001270059.1|3926442_3927066_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_106888533.1|3927217_3929068_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	5.6e-172
WP_022581964.1|3929335_3929665_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|3929830_3930694_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|3930677_3931814_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001612826.1|3932063_3933293_+	peptidase T	NA	NA	NA	NA	NA
WP_001612827.1|3933438_3934560_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735413.1|3934635_3936096_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|3936095_3936767_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|3936934_3938305_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|3938308_3938950_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|3938985_3940092_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	4050564	4118655	5001754	holin,integrase,portal,capsid,head,terminase,tail,protease	Escherichia_phage(26.53%)	75	4050386:4050413	4102816:4102843
4050386:4050413	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113693.1|4050564_4051695_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	4.0e-104
WP_000113183.1|4051672_4051921_-	excisionase	NA	NA	NA	NA	NA
WP_000034483.1|4051985_4054457_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	2.0e-55
WP_000092839.1|4054552_4054741_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|4054737_4054926_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001365839.1|4055701_4056070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380317.1|4056081_4056234_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001003380.1|4056423_4056831_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	5.5e-24
WP_000476991.1|4056908_4057136_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705131.1|4057119_4057641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054521.1|4057621_4058599_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	3.8e-55
WP_047083545.1|4058605_4059346_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.3	1.2e-112
WP_097338867.1|4059375_4060137_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.3	3.4e-75
WP_000215512.1|4060196_4060382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|4060733_4061285_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882662.1|4061499_4061712_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|4061814_4062132_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_052327139.1|4062720_4062948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032347855.1|4063001_4063271_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.6e-11
WP_001365882.1|4063272_4064322_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	8.5e-109
WP_000904135.1|4064334_4064697_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	9.0e-34
WP_001064918.1|4064689_4065355_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|4065608_4066322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|4066495_4066693_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_136807759.1|4066861_4067902_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	97.7	4.2e-201
WP_099528373.1|4068381_4068810_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_106888537.1|4069505_4070231_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099528372.1|4072095_4074060_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	79.4	1.2e-297
WP_062855780.1|4074194_4074374_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	93.2	1.2e-23
WP_096096240.1|4074414_4074660_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	98.8	1.5e-16
WP_096096241.1|4074737_4074953_+|holin	holin	holin	G9L6J5	Escherichia_phage	98.6	5.9e-33
WP_106888538.1|4074957_4075491_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	8.1e-100
WP_000788411.1|4075683_4075830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071974579.1|4076198_4076405_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	63.2	4.6e-11
WP_000735655.1|4076469_4076694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828070.1|4077038_4077365_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|4077496_4077697_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|4077738_4078104_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958387.1|4078393_4078957_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_106879091.1|4078953_4080615_+|terminase	terminase large subunit	terminase	Q6H9U9	Enterobacteria_phage	99.5	0.0e+00
WP_000172990.1|4080678_4082616_+|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_001063099.1|4082660_4082882_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_040077695.1|4082827_4085413_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.4	0.0e+00
WP_000125970.1|4085409_4085736_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.0e-53
WP_001007905.1|4085745_4086096_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|4086092_4086539_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4086535_4086880_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275432.1|4086945_4087662_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	6.2e-127
WP_000710934.1|4087676_4088051_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	7.8e-65
WP_122993267.1|4088146_4088356_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_106888539.1|4088403_4091646_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	87.8	0.0e+00
WP_000343411.1|4091638_4091980_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.3	6.9e-52
WP_106879109.1|4091979_4092678_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.3	1.8e-131
WP_106888540.1|4092688_4093432_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	93.9	7.8e-141
WP_159026627.1|4093377_4094010_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	9.6e-100
WP_106888542.1|4094919_4098615_+	DUF1983 domain-containing protein	NA	Q6H9T2	Enterobacteria_phage	84.1	0.0e+00
WP_001270059.1|4098683_4099307_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	59.9	9.0e-66
WP_106888543.1|4099458_4100646_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	97.3	8.8e-54
WP_001049902.1|4100714_4101386_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	83.9	2.5e-106
WP_106888544.1|4102993_4103500_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
4102816:4102843	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|4103545_4104046_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|4104131_4104311_-	general stress protein	NA	NA	NA	NA	NA
WP_001612892.1|4104691_4105498_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|4105497_4106691_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001612893.1|4106702_4108061_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763511.1|4108064_4109660_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001612895.1|4109659_4111222_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001386774.1|4111313_4111358_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285663.1|4111494_4112376_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4112372_4112993_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001612898.1|4113020_4114916_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|4115128_4116001_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278893.1|4116040_4116631_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|4116627_4117386_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422045.1|4117605_4118655_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 10
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	4410288	4471216	5001754	portal,lysis,integrase,capsid,head,terminase,tail,transposase	Enterobacteria_phage(42.86%)	79	4420867:4420881	4470138:4470152
WP_001613099.1|4410288_4411749_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_001613100.1|4411838_4413122_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|4413726_4413840_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|4413908_4414142_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|4414458_4415049_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|4415146_4415722_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279080.1|4415721_4418796_-	hypothetical protein	NA	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001230375.1|4418860_4419460_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_000515714.1|4419529_4423027_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.3	0.0e+00
4420867:4420881	attL	CAATCCGCGACGGCG	NA	NA	NA	NA
WP_000090895.1|4423087_4423720_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|4423656_4424400_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152640.1|4424405_4425104_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.5e-133
WP_000847379.1|4425103_4425433_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840342.1|4425429_4427991_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.7	0.0e+00
WP_000459465.1|4427983_4428418_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000479142.1|4428399_4428822_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_001349920.1|4428837_4429578_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|4429585_4429981_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|4429977_4430556_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000753007.1|4430567_4430921_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158905.1|4430932_4431331_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063277.1|4431372_4432398_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001295978.1|4432454_4432787_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123218.1|4432796_4434116_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001581760.1|4434096_4435698_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_000198149.1|4435694_4435901_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027259.1|4435897_4437823_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|4437797_4438343_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|4438731_4438965_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|4439022_4439433_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|4439584_4439758_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|4439929_4440085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|4440164_4440230_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|4440232_4440421_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4440431_4440644_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|4441006_4441504_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|4441500_4442034_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|4442030_4442342_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|4442346_4442562_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|4443315_4443531_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|4443831_4444044_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|4444098_4444188_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|4444465_4445218_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|4445231_4446281_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|4446282_4446561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|4446627_4446879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|4447095_4447251_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|4447322_4447610_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|4447609_4447849_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|4447873_4448179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|4448381_4448714_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|4449150_4450464_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|4450641_4450824_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000839179.1|4451741_4452146_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4452142_4452490_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|4452538_4454074_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_001310834.1|4454593_4454950_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|4454946_4455369_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|4455409_4456375_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|4456355_4456877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|4456860_4457091_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|4457174_4457582_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|4457748_4457904_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|4458063_4458282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329848.1|4458285_4458450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|4458849_4459038_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|4459034_4459226_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048342.1|4459318_4461790_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001296941.1|4461877_4462114_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876958.1|4462148_4463429_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001360138.1|4463448_4463559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001613128.1|4463616_4464636_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	2.2e-16
WP_001613129.1|4464647_4465862_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
WP_001613130.1|4466067_4466394_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	1.7e-23
WP_000705197.1|4466528_4466870_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|4466904_4467465_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|4467467_4468178_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|4468285_4468591_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_106888552.1|4468789_4471216_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	5.0e-213
4470138:4470152	attR	CAATCCGCGACGGCG	NA	NA	NA	NA
>prophage 11
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	4713337	4800745	5001754	holin,tRNA,portal,lysis,integrase,terminase,tail,protease	Escherichia_phage(45.0%)	99	4753903:4753920	4809263:4809280
WP_000984517.1|4713337_4714219_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055778.1|4714410_4716459_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000431368.1|4716478_4717177_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|4717273_4717771_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001613245.1|4717900_4719184_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001613246.1|4719152_4721786_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_024192321.1|4721865_4723305_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|4723422_4723659_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001338167.1|4723763_4723955_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812739.1|4723955_4724612_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	50.0	1.2e-55
WP_000976472.1|4725007_4725349_-	YebY family protein	NA	NA	NA	NA	NA
WP_032300815.1|4725361_4726234_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|4726237_4726612_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4726750_4726981_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011660.1|4727082_4727739_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4727762_4728425_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936951.1|4728421_4730482_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|4730690_4731350_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|4731676_4732033_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|4732099_4732390_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173493.1|4732523_4733702_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|4733757_4734399_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|4734435_4736247_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|4736481_4737957_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|4738294_4739164_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091148.1|4739291_4740734_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001613253.1|4740864_4741836_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001613254.1|4741955_4743278_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|4743293_4744226_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001613255.1|4744304_4745060_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	27.8	1.1e-17
WP_001613256.1|4745056_4745842_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4746184_4747195_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4747203_4747815_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072094247.1|4747953_4748019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001613261.1|4748089_4748692_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4748693_4749215_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|4749249_4749990_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|4750018_4750471_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|4750588_4752361_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891621.1|4752670_4753237_+	hydrolase	NA	NA	NA	NA	NA
WP_001217534.1|4753554_4753803_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	87.8	8.0e-34
4753903:4753920	attL	AATCTGAAAAATCATCCA	NA	NA	NA	NA
WP_001373129.1|4754072_4754747_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	3.3e-114
WP_106888560.1|4754746_4754956_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_062893928.1|4754965_4756678_-|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	51.0	1.2e-67
WP_000078853.1|4756823_4756964_-	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_106888561.1|4757162_4760849_-	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	87.4	0.0e+00
WP_122996641.1|4761762_4762395_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	88.6	2.4e-98
WP_106888562.1|4762340_4763084_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.4	5.4e-150
WP_064579201.1|4763094_4763793_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	5.2e-131
WP_047642765.1|4763792_4764122_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	98.2	1.1e-57
WP_047642762.1|4764118_4766734_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	84.9	0.0e+00
WP_047090811.1|4766723_4767128_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	77.5	4.5e-42
WP_000479069.1|4767154_4767586_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	6.9e-41
WP_047090812.1|4767605_4768355_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.0	1.1e-129
WP_000682716.1|4768362_4768761_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_047082262.1|4768773_4769397_-|tail	tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	7.5e-105
WP_001281346.1|4769399_4769681_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_001097065.1|4769673_4770000_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_122993599.1|4770087_4772067_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.2	0.0e+00
WP_000974567.1|4772056_4773559_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102416.1|4773558_4773771_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	8.6e-29
WP_047090813.1|4773767_4775891_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000348556.1|4775887_4776364_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_000881332.1|4776814_4777429_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	68.6	1.1e-63
WP_024210595.1|4777540_4778008_-|lysis	lysis protein	lysis	A0A0H4IT10	Shigella_phage	87.7	3.6e-67
WP_062896309.1|4778156_4778339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092874.1|4778495_4779029_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	1.4e-99
WP_096098192.1|4779540_4780332_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	86.7	4.0e-34
WP_000284490.1|4780335_4780551_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	2.0e-33
WP_106888563.1|4780630_4780903_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	92.2	5.5e-20
WP_000143462.1|4780943_4781123_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_096098178.1|4781257_4783204_-	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	98.3	0.0e+00
WP_000738080.1|4783715_4783985_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001365055.1|4783996_4784956_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000762906.1|4785441_4786263_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	57.2	1.2e-86
WP_001258479.1|4786259_4786634_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.4	4.7e-38
WP_024200897.1|4786646_4787696_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.5e-108
WP_047090793.1|4787697_4787970_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.2e-12
WP_001260977.1|4788105_4788363_+	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_000220600.1|4788368_4788668_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
WP_000651124.1|4788872_4789268_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	61.2	2.5e-37
WP_000829416.1|4789257_4789476_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	70.3	1.2e-06
WP_000991478.1|4789605_4789917_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	79.6	6.5e-49
WP_001373171.1|4789913_4790069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029374881.1|4790097_4790397_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.9	4.8e-49
WP_024200898.1|4790393_4790675_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	66.7	5.7e-28
WP_106888564.1|4790679_4791114_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	60.1	9.7e-35
WP_000450642.1|4791129_4791855_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.4	2.0e-77
WP_074435815.1|4791888_4792431_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.8	9.5e-80
WP_001262404.1|4792342_4793374_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	70.0	5.8e-86
WP_000693921.1|4793442_4793868_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261756.1|4793864_4794092_-	cell division protein	NA	NA	NA	NA	NA
WP_000444611.1|4794190_4794835_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
WP_122993314.1|4795307_4795565_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	4.1e-09
WP_000449172.1|4796386_4796575_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199480.1|4796571_4796760_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106888565.1|4796855_4799327_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|4799388_4799658_+	excisionase	NA	NA	NA	NA	NA
WP_000074988.1|4799626_4800745_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.6	1.9e-82
4809263:4809280	attR	AATCTGAAAAATCATCCA	NA	NA	NA	NA
>prophage 12
NZ_CP027457	Escherichia coli strain 88-3493 chromosome, complete genome	5001754	4908137	4917869	5001754	transposase	Stx2-converting_phage(33.33%)	7	NA	NA
WP_000228012.1|4908137_4909445_+	restriction endonuclease	NA	A0A2H4PQP5	Staphylococcus_phage	29.2	1.4e-36
WP_024175232.1|4910103_4911171_+	Appr-1-p processing protein	NA	B0FIJ9	Escherichia_phage	37.1	2.9e-16
WP_000108736.1|4911189_4914285_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	3.0e-53
WP_001122107.1|4914284_4915001_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_050866906.1|4915452_4915878_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	3.6e-34
WP_000624722.1|4915874_4916225_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_106888566.1|4916255_4917869_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.0e-182
>prophage 1
NZ_CP027458	Escherichia coli strain 88-3493 plasmid unnamed, complete sequence	107796	25180	32983	107796	integrase	Cronobacter_phage(25.0%)	12	29348:29360	34945:34957
WP_106888577.1|25180_25864_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	9.6e-29
WP_032236829.1|25940_26246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077629773.1|26249_27152_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618108.1|27568_27817_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
WP_000109074.1|27813_28251_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	3.7e-26
WP_001365565.1|28250_29243_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	59.5	8.0e-101
WP_001365560.1|29272_29521_+	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	59.0	1.5e-19
29348:29360	attL	CCCCGTAAAAACA	NA	NA	NA	NA
WP_000340836.1|29525_29918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103695.1|29922_30894_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
WP_000633912.1|31122_31767_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	1.9e-39
WP_000239527.1|31760_32036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016958.1|32173_32983_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
34945:34957	attR	CCCCGTAAAAACA	NA	NA	NA	NA
