The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	0	20698	5196105	tRNA	Bacillus_phage(100.0%)	22	NA	NA
WP_001307844.1|1451_2567_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001287001.1|2620_3586_-	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_000067822.1|3641_4766_-	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_047087360.1|4797_6408_-	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_032207823.1|6658_7744_-	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000457207.1|8896_9535_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000939317.1|9705_10065_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_032207825.1|10068_10251_+	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_032207828.1|10398_10647_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001386836.1|10705_10780_-	protein YoaJ	NA	NA	NA	NA	NA
WP_001219350.1|10782_10881_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032207831.1|10913_11939_-	diguanylate cyclase DgcP	NA	NA	NA	NA	NA
WP_032207833.1|12121_12376_+	DUF333 domain-containing lipoprotein YoaF	NA	NA	NA	NA	NA
WP_032207836.1|12397_12745_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_047087359.1|12799_13981_-	2-nitroimidazole transporter	NA	NA	NA	NA	NA
WP_000972265.1|14077_14899_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460707.1|14855_15302_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_158707836.1|15470_15575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087357.1|15575_16079_-|tRNA	mischarged aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_047087355.1|16121_17612_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616433.1|17792_19268_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|19414_20698_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 2
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	24016	24871	5196105		Indivirus(100.0%)	1	NA	NA
WP_001186345.1|24016_24871_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 3
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	33576	34218	5196105		Tupanvirus(100.0%)	1	NA	NA
WP_032207846.1|33576_34218_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.3	1.1e-18
>prophage 4
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	39144	41106	5196105		Streptococcus_phage(100.0%)	1	NA	NA
WP_032207849.1|39144_41106_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	9.2e-40
>prophage 5
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	46705	47359	5196105		Planktothrix_phage(100.0%)	1	NA	NA
WP_001299561.1|46705_47359_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.7	3.8e-14
>prophage 6
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	54114	55335	5196105		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|54114_55335_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 7
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	62811	63639	5196105		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|62811_63639_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 8
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	69978	72240	5196105		Tupanvirus(100.0%)	1	NA	NA
WP_032207871.1|69978_72240_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 9
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	80922	98758	5196105	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_001144202.1|80922_82851_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|82854_83397_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|83493_83691_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|83743_84100_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|84222_84267_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|84549_85533_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|85547_87935_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229263.1|87939_88239_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.4e-11
WP_000956529.1|88339_89320_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154187.1|89382_89934_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_032207881.1|89933_90683_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	3.5e-08
WP_001209785.1|90760_91225_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001300634.1|91471_92185_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_032207883.1|92247_93684_+	YdiU family protein	NA	NA	NA	NA	NA
WP_005136485.1|93687_93879_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082229.1|94010_95057_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|95213_96047_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|96379_98758_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
>prophage 10
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	118907	123991	5196105		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|118907_119276_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_047087350.1|119284_120772_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948855.1|120781_121528_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_000908002.1|121502_122774_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144589.1|122770_123991_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	1.7e-92
>prophage 11
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	133762	134575	5196105		Edwardsiella_phage(100.0%)	1	NA	NA
WP_000587555.1|133762_134575_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 12
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	140160	148951	5196105		Orpheovirus(20.0%)	9	NA	NA
WP_000493947.1|140160_140802_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098911.1|140841_141990_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182363.1|142280_143492_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_032207914.1|143604_144537_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|144533_145559_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|145856_145946_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_032207916.1|146111_147281_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|147426_148008_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|148135_148951_-	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 13
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	158119	160583	5196105	transposase	Shigella_phage(50.0%)	2	NA	NA
WP_085972493.1|158119_159393_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001296937.1|160061_160583_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 14
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	167493	168768	5196105	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|167493_168768_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 15
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	188647	190459	5196105		Vaccinia_virus(100.0%)	1	NA	NA
WP_032207931.1|188647_190459_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 16
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	200354	201656	5196105		Bacillus_phage(100.0%)	1	NA	NA
WP_032207934.1|200354_201656_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	2.1e-16
>prophage 17
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	211756	269854	5196105	transposase,integrase,protease	Escherichia_phage(38.89%)	49	205884:205898	227482:227496
205884:205898	attL	AAAATCAGAAGTGTC	NA	NA	NA	NA
WP_001260840.1|211756_212578_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|212677_212761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|212853_213189_-	acid shock protein	NA	NA	NA	NA	NA
WP_001400365.1|213585_214839_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019534.1|214945_215839_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|215973_217194_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|217318_218014_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|217966_219259_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|219417_220032_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_032207946.1|220074_220929_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_077744831.1|220930_221485_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	4.1e-62
WP_032207949.1|221522_222686_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.5	1.9e-226
WP_096913359.1|224113_224323_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	69.0	1.6e-06
WP_122083109.1|224329_224437_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013632.1|224481_224694_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	2.0e-25
WP_047088205.1|224861_225140_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_047618481.1|225141_226191_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	4.5e-110
WP_001217436.1|226203_226575_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_032206343.1|227089_227908_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
227482:227496	attR	AAAATCAGAAGTGTC	NA	NA	NA	NA
WP_000917764.1|228193_228391_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	6.8e-28
WP_106888075.1|228528_229242_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106888076.1|230008_231862_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_106888077.1|232490_233704_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106888078.1|238324_239481_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_000671731.1|239828_240221_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_000592822.1|240475_241366_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.8e-19
WP_000901367.1|241584_241680_-	protein MgtS	NA	NA	NA	NA	NA
WP_071887482.1|241806_241995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087214.1|242189_243089_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_000803659.1|243119_243338_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|243369_243753_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000843419.1|243772_244207_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000885033.1|244418_245084_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_032206991.1|245108_246299_-	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_047087609.1|246448_247564_-	putative protein YneK	NA	NA	NA	NA	NA
WP_032206989.1|247640_248522_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001364729.1|248622_250011_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077744806.1|250074_252123_+	glutaminase B	NA	NA	NA	NA	NA
WP_000637082.1|252329_253244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286590.1|253247_254006_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|254062_254353_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774169.1|254376_255252_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_032206988.1|255278_256301_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_047087610.1|256312_257305_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911184.1|257304_258333_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001194905.1|258326_259862_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
WP_000154339.1|260110_261064_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_106888079.1|264969_266242_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	2.2e-175
WP_106888080.1|266227_269854_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	35.0	1.1e-115
>prophage 18
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	276716	277944	5196105	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_106888082.1|276716_277944_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	4.2e-176
>prophage 19
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	286476	293412	5196105		Bacillus_phage(50.0%)	3	NA	NA
WP_032205826.1|286476_288162_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	1.7e-10
WP_032205827.1|288199_290572_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_074433596.1|290616_293412_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.4e-19
>prophage 20
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	298689	300072	5196105		Bacillus_virus(100.0%)	1	NA	NA
WP_000426277.1|298689_300072_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 21
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	306581	308487	5196105		Planktothrix_phage(100.0%)	2	NA	NA
WP_032205833.1|306581_307568_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	6.5e-18
WP_047087809.1|307560_308487_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	2.0e-13
>prophage 22
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	312917	313202	5196105		Escherichia_phage(100.0%)	1	NA	NA
WP_000781370.1|312917_313202_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 23
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	319214	319496	5196105		Enterobacteria_phage(100.0%)	1	NA	NA
WP_047087812.1|319214_319496_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	61.6	6.1e-22
>prophage 24
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	326309	327854	5196105		Escherichia_phage(100.0%)	1	NA	NA
WP_032205836.1|326309_327854_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 25
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	345514	347623	5196105		Ralstonia_phage(100.0%)	1	NA	NA
WP_047087864.1|345514_347623_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.4	1.1e-25
>prophage 26
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	352304	354407	5196105		Salmonella_phage(100.0%)	1	NA	NA
WP_032206943.1|352304_354407_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 27
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	358671	359481	5196105		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_032206939.1|358671_359481_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	5.9e-17
>prophage 28
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	362862	367407	5196105		Mycoplasma_phage(33.33%)	5	NA	NA
WP_032206935.1|362862_363876_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	4.6e-27
WP_000047429.1|363893_365039_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760626.1|365283_366690_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|366768_367185_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|367230_367407_-	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
>prophage 29
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	371827	373036	5196105	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000826403.1|371827_373036_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.5e-205
>prophage 30
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	385169	386118	5196105		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|385169_385343_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|385587_386118_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 31
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	390056	393959	5196105		Klosneuvirus(100.0%)	1	NA	NA
WP_032206698.1|390056_393959_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	7.6e-54
>prophage 32
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	425240	426230	5196105		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_032206713.1|425240_426230_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	6.6e-71
>prophage 33
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	432465	441839	5196105	tRNA	Morganella_phage(20.0%)	8	NA	NA
WP_032206719.1|432465_432900_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	3.0e-28
WP_047088049.1|433075_434011_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	1.2e-143
WP_000123758.1|434139_435513_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|435990_436974_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|437228_438461_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001046821.1|438481_439045_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_032206929.1|440169_440781_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206920.1|441323_441839_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 34
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	455601	660544	5196105	capsid,integrase,terminase,head,lysis,transposase,tail,portal,protease,holin	Escherichia_phage(45.97%)	210	625247:625269	642112:642134
WP_106888085.1|455601_456757_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
WP_001365271.1|457798_459340_-	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_032206830.1|459487_460549_-	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_032206832.1|460545_461943_-	YcjX family protein	NA	NA	NA	NA	NA
WP_000075378.1|462097_463096_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_032206834.1|463206_464112_-	monomeric porin OmpG	NA	NA	NA	NA	NA
WP_032206836.1|464156_465239_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
WP_000775790.1|465252_465912_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_001299974.1|468172_469228_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000690242.1|469237_470026_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_047087595.1|470043_471096_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_032206838.1|471126_471969_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_032206839.1|471955_472837_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000597447.1|472857_474150_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000810500.1|474163_475843_-	sugar phosphorylase	NA	NA	NA	NA	NA
WP_000473109.1|476054_476369_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_000907387.1|476673_477033_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_001274963.1|477032_477257_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_000511025.1|477310_477979_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_047087598.1|478145_479123_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_000069226.1|479240_480506_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	3.5e-24
WP_032206842.1|480543_481824_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_047087596.1|481825_483304_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_047087597.1|483453_484011_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_001300506.1|484037_484802_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_001298814.1|485013_486432_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_120795382.1|486580_486745_+	protein YmjE	NA	NA	NA	NA	NA
WP_024225995.1|486734_488120_+	putrescine/proton symporter PuuP	NA	NA	NA	NA	NA
WP_001015110.1|488253_488499_+	YmjA family protein	NA	NA	NA	NA	NA
WP_001250213.1|488811_490455_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_000583277.1|490451_491417_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_106888078.1|496894_498050_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_032208661.1|498061_498607_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_032208663.1|498650_500696_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|500832_501579_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_032208665.1|501667_502354_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047088181.1|502530_502734_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	1.0e-10
WP_047088180.1|502769_504230_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	1.1e-42
WP_041520817.1|504318_505602_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|505661_505976_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001121225.1|506570_507221_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491544.1|507445_508321_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.9	9.7e-159
WP_047087983.1|508460_508730_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	95.5	1.6e-43
WP_106888086.1|508731_510054_-|tail	phage tail protein	tail	Q687E6	Enterobacteria_phage	98.9	7.0e-76
WP_001230472.1|510118_510718_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	3.7e-109
WP_106888087.1|510784_514264_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.2	0.0e+00
WP_148936170.1|514504_515134_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	98.6	1.7e-109
WP_047087946.1|515079_515823_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.2	5.4e-150
WP_001365123.1|515833_516532_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.7	1.8e-131
WP_000847298.1|516531_516861_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|519451_519865_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|519891_520314_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235098.1|520327_521080_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_047088190.1|521087_521483_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	91.6	8.2e-65
WP_000975099.1|521479_522058_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_047088187.1|522069_522423_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000158897.1|522434_522830_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|522871_523897_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_047088185.1|523952_524285_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	97.3	9.3e-54
WP_033805059.1|524294_525614_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001415980.1|525594_527196_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000198153.1|527192_527399_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_047088184.1|527395_529321_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000867498.1|529295_529841_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001329960.1|530227_530413_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000347013.1|530545_530686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082561.1|531036_531504_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	77.4	2.8e-56
WP_001092861.1|531802_532336_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	5.3e-99
WP_024231374.1|532378_532936_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	84.6	7.8e-53
WP_000284516.1|532939_533155_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_106888088.1|533304_535158_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000301787.1|535963_536677_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_074433665.1|536811_537009_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	93.8	1.4e-25
WP_047087676.1|537790_538150_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.2	2.4e-39
WP_106888090.1|538162_539212_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_032147304.1|539213_539492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|539558_539810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|540026_540239_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_047087674.1|540739_541837_+	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.5	2.8e-211
WP_001204666.1|541796_542375_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_001002672.1|542680_542992_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_000004322.1|542984_543239_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_136757765.1|543699_544665_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.3	2.2e-58
WP_000705376.1|544645_545167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921592.1|545150_545378_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381213.1|545458_545866_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_000379563.1|546033_546186_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000394548.1|546197_546836_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|546836_547046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|547609_547798_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_077790962.1|548077_549544_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	60.3	2.1e-161
WP_047088226.1|552976_553771_-	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	95.5	3.5e-131
WP_000738505.1|554179_554473_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_106888092.1|554504_554969_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	83.8	3.4e-62
WP_000455406.1|554976_555126_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001056885.1|555125_555695_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_106888093.1|555969_556503_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	99.4	5.1e-102
WP_001072901.1|556507_556723_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|556800_557046_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|557086_557266_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106888094.1|557402_559340_-	SASA family carbohydrate esterase	NA	A0A0P0ZGE0	Escherichia_phage	99.1	0.0e+00
WP_000738068.1|559825_560095_-	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000649753.1|560106_561066_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_001356551.1|561448_561601_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000144764.1|562275_562470_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001187434.1|562466_563030_-	bacteriophage lambda NinG family protein	NA	A0A2R2Z332	Escherichia_phage	100.0	4.7e-106
WP_000402090.1|563037_563487_-	DUF1367 family protein	NA	A0A2R2Z328	Escherichia_phage	98.0	1.0e-79
WP_060552848.1|563515_564457_-	DNA primase	NA	A0A0H4IPK0	Shigella_phage	96.7	1.8e-179
WP_047087940.1|564446_565967_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	99.0	2.3e-304
WP_032207142.1|565960_566338_-	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	99.2	1.2e-60
WP_077744819.1|566504_566699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240876.1|566869_567073_-	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001056250.1|567168_567882_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_032207143.1|567976_569446_+	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	100.0	2.7e-286
WP_032207145.1|569442_570396_+	restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	99.7	3.5e-186
WP_071887479.1|570898_571795_+	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	72.0	5.2e-99
WP_000917252.1|571865_572078_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_000934197.1|572089_572371_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_047087942.1|572391_572673_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	98.9	5.5e-47
WP_000157000.1|574849_575053_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_000476217.1|575045_575285_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	100.0	2.1e-39
WP_001303141.1|575281_576229_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	100.0	1.6e-183
WP_001301469.1|576230_576737_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001301947.1|576696_576912_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001142590.1|576913_577132_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|577133_577421_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_000206752.1|577424_578048_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	3.1e-119
WP_001451754.1|578309_578879_+	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_001302866.1|578921_579227_-	HigA family addiction module antidote protein	NA	A0A0N7BS23	Escherichia_phage	100.0	4.4e-50
WP_001451755.1|579315_579513_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001260979.1|579641_579899_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	100.0	4.2e-38
WP_000211992.1|580223_580901_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_000809302.1|580956_581388_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_032206818.1|581384_582011_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	99.5	4.0e-122
WP_001291843.1|581970_582183_+	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000994793.1|582218_582599_+	DUF1627 domain-containing protein	NA	A0A0P0ZFT6	Escherichia_phage	100.0	1.2e-52
WP_000497812.1|582963_583215_+	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_001563185.1|583268_583511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206827.1|583474_584662_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	4.6e-119
WP_047087716.1|584838_585729_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001128858.1|585728_586721_+	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_000573407.1|586722_587529_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_074433631.1|587596_587950_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|588317_589106_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_106888095.1|589250_590378_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484984.1|590445_592380_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000221855.1|592457_592562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087717.1|592615_594601_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001288368.1|594747_594921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087719.1|595010_595760_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_032206812.1|596028_596247_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001295580.1|596372_596699_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176278.1|596698_597436_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_032206811.1|597628_598798_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876286.1|598804_599113_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256538.1|599261_600026_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|600195_600786_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_047087720.1|600849_603525_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|603688_603784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297116.1|603897_604065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295577.1|604067_604196_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_032206809.1|604526_605501_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_032206808.1|605710_608308_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.0e-86
WP_001031530.1|608687_608939_+	YciN family protein	NA	NA	NA	NA	NA
WP_032206807.1|608974_610024_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	6.0e-22
WP_032206806.1|610243_611002_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	5.2e-07
WP_001278904.1|610998_611589_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|611628_612501_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001295575.1|612601_613222_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_032206803.1|613218_614100_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|614237_614282_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_032206802.1|614373_615936_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|615935_617531_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_032206824.1|617534_618893_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	5.0e-37
WP_000209521.1|618904_620098_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443055.1|620097_620904_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|621284_621464_+	general stress protein	NA	NA	NA	NA	NA
WP_047087721.1|622095_622602_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000692020.1|623639_624230_-	protein kinase	NA	NA	NA	NA	NA
625247:625269	attL	CCTGTTTAGGATTCTGTGTAAAT	NA	NA	NA	NA
WP_001023986.1|625363_625633_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_106888078.1|625837_626993_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_032208325.1|627087_627312_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	5.0e-19
WP_001302717.1|627393_627708_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_129014757.1|628232_628418_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	4.9e-20
WP_106888077.1|628678_629891_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106888096.1|629857_630073_+	excisionase	NA	A0A0N7BTS3	Escherichia_phage	80.6	3.6e-06
WP_047088277.1|630050_631181_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
WP_071532495.1|631668_631887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097746533.1|632387_633544_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_106888097.1|637252_637843_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_032207081.1|638026_638674_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|638810_638957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888098.1|639000_640274_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001303943.1|640703_640982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938103.1|642149_642719_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
642112:642134	attR	ATTTACACAGAATCCTAAACAGG	NA	NA	NA	NA
WP_000935464.1|642784_643423_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	76.9	5.4e-82
WP_106888099.1|643610_644772_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_047088109.1|645676_646999_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	84.1	1.2e-221
WP_001023396.1|648229_648499_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001007905.1|651041_651392_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|651401_651728_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_060552847.1|651724_652246_-|portal	portal protein	portal	A0A0P0ZCZ4	Stx2-converting_phage	96.4	1.5e-74
WP_097746533.1|652319_653475_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000737224.1|653872_654511_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028540.1|654867_655611_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|655640_656180_+	septation protein A	NA	NA	NA	NA	NA
WP_032206794.1|656284_656683_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_047088212.1|656722_657442_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_106888100.1|657896_659110_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.1e-167
WP_047087680.1|659992_660544_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.0	1.4e-25
>prophage 35
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	666232	668247	5196105		Planktothrix_phage(100.0%)	2	NA	NA
WP_000994905.1|666232_667237_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	35.6	8.0e-24
WP_032208507.1|667233_668247_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	9.0e-15
>prophage 36
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	676657	686548	5196105		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|676657_677275_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|677879_678293_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|678435_679344_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|679545_680559_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001295622.1|680650_681556_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_047087681.1|681668_682127_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|682176_683019_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_047087682.1|683625_684303_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|684302_685013_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|685009_686548_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 37
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	700599	835182	5196105	integrase,terminase,transposase,tail,tRNA,portal,holin,protease	Enterobacteria_phage(31.17%)	139	716256:716274	796359:796377
WP_000811065.1|700599_701454_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|701489_702299_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200378.1|702302_702695_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|702691_703525_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_024226915.1|703524_704607_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000173200.1|704648_705905_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|706118_706742_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_047087683.1|706741_707593_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|707743_708691_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|708815_710495_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|710549_710828_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_032208512.1|711105_711690_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_032208514.1|711806_712898_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_047087684.1|713665_716533_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
716256:716274	attL	GTGCCAGCATGATACTGGG	NA	NA	NA	NA
WP_047087685.1|716632_718552_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_047087686.1|718779_719850_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059411.1|719860_720493_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_047087687.1|720503_721922_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_047087688.1|722241_723939_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000615067.1|724017_724458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511313.1|724635_724890_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020161.1|725090_725825_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001295616.1|725826_726438_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051582.1|726537_727452_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|727546_729283_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197825.1|729669_730740_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|730749_732048_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000234823.1|733960_734680_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|734900_736442_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|736587_737118_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_032208520.1|737163_738432_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	3.3e-208
WP_000897378.1|738431_738851_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_106888101.1|739078_740065_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|740339_740801_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|740877_741537_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001297679.1|741608_741902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695223.1|742139_742541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056860.1|742648_743017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|743536_744232_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|744255_745068_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|745071_745338_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_097746533.1|745479_746636_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_032141808.1|750282_750393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001307134.1|750925_751249_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_074433656.1|751351_751504_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.0	2.4e-20
WP_047087952.1|751983_752421_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|752445_753030_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201825.1|753528_754482_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_047088067.1|754668_756153_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032207501.1|756336_756642_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_136800952.1|756698_757367_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|757864_758047_+	general stress protein	NA	NA	NA	NA	NA
WP_001546534.1|758125_758626_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_047088062.1|758662_759169_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_032206875.1|759187_760078_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_071887470.1|760197_760617_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.0	1.7e-68
WP_106888102.1|760697_761911_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	7.1e-168
WP_000067727.1|762034_762250_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_106888103.1|762324_763020_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	7.3e-133
WP_001207141.1|763070_763505_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	99.3	6.0e-77
WP_032207131.1|764257_764530_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	9.7e-41
WP_032207130.1|764814_765264_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.3e-69
WP_047088220.1|765459_765828_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_001198861.1|765900_766065_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|766033_766177_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995409.1|766252_766549_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001438244.1|766554_767340_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.4e-148
WP_032207488.1|767336_768017_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	7.9e-132
WP_000682319.1|768013_768175_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_047088208.1|768167_768725_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	61.7	3.9e-60
WP_001386642.1|768735_769017_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|769115_769334_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_032207484.1|769381_769582_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	98.5	4.2e-33
WP_085972493.1|769625_770898_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_000088653.1|771096_771333_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|771322_772465_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_032206978.1|772566_773817_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	2.5e-22
WP_032206979.1|773988_774642_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|774651_775113_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_032206981.1|775166_776273_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|776308_776950_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_047087388.1|776953_778324_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	9.4e-108
WP_001265481.1|778492_779164_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|779163_780624_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|780699_781821_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359446.1|781869_783096_-	peptidase T	NA	NA	NA	NA	NA
WP_032206984.1|783345_784482_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799400.1|784465_785329_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_047088273.1|787003_788365_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023445.1|788819_789089_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_106888104.1|789090_790404_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	97.7	3.4e-75
WP_106888078.1|791084_792240_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888105.1|792401_795881_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.2	0.0e+00
WP_122993104.1|796126_796759_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	3.4e-105
796359:796377	attR	CCCAGTATCATGCTGGCAC	NA	NA	NA	NA
WP_106888107.1|798187_798760_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	1.3e-103
WP_106888108.1|798765_799464_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	5.2e-131
WP_000847298.1|799463_799793_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_021351599.1|799789_802435_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.9	0.0e+00
WP_000532075.1|802478_802787_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_047087666.1|802813_803236_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	6.3e-71
WP_047087667.1|803251_804001_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	5.6e-131
WP_000682718.1|804008_804407_-	hypothetical protein	NA	Q9EYD7	Enterobacteria_phage	99.2	1.7e-70
WP_000974958.1|804419_805043_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	100.0	8.9e-106
WP_001281346.1|805045_805327_-	DNA breaking-rejoining protein	NA	S5MDP9	Escherichia_phage	97.8	7.9e-46
WP_001097065.1|805319_805646_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_158707841.1|805733_807731_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.6	0.0e+00
WP_106888109.1|807702_809205_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.2	2.5e-287
WP_139840281.1|809204_809417_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	3.3e-28
WP_001077625.1|809413_811537_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|811533_812010_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_032207063.1|812429_812654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|812739_812925_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_032207060.1|813442_813979_-	lysozyme	NA	G9L6J6	Escherichia_phage	94.9	4.5e-98
WP_074433498.1|814015_815005_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.1	7.5e-107
WP_000284518.1|815009_815225_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001290231.1|815301_815574_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|815614_815794_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_106888111.1|815930_817877_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	98.1	0.0e+00
WP_047087938.1|818759_819581_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	57.9	1.8e-77
WP_032207210.1|819577_819952_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	1.3e-35
WP_032206341.1|821014_821287_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	51.5	5.5e-12
WP_032206337.1|821408_821753_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	98.2	1.4e-55
WP_000887477.1|821872_822085_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|822273_822378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118161.1|823135_823531_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_032206335.1|823546_824272_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.2	2.0e-77
WP_032206334.1|824293_825040_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.2	1.1e-113
WP_106888112.1|825046_826129_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	3.3e-63
WP_000693928.1|826200_826626_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|826609_826933_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|827057_827534_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001113310.1|828509_828977_-	DUF2335 domain-containing protein	NA	A0A1B0YZW3	Pseudomonas_phage	35.0	4.4e-09
WP_000824186.1|828954_829158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000580316.1|829466_830261_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_032206332.1|830257_831304_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|831459_832281_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291257.1|832296_833208_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_024191477.1|833236_834481_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_032206331.1|834480_835182_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	2.4e-35
>prophage 38
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	842471	842729	5196105		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|842471_842729_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 39
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	855059	856702	5196105		Streptococcus_virus(50.0%)	2	NA	NA
WP_047087859.1|855059_856064_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|856060_856702_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 40
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	859974	861156	5196105		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|859974_860211_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|860421_861156_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 41
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	873514	874456	5196105		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|873514_874456_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 42
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	890302	890548	5196105		Salmonella_phage(100.0%)	1	NA	NA
WP_047087853.1|890302_890548_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	3.5e-13
>prophage 43
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	895209	898655	5196105	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000183364.1|895209_896130_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
WP_072057392.1|896301_896499_+	multidrug transporter	NA	NA	NA	NA	NA
WP_106888113.1|897441_898655_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.1e-167
>prophage 44
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	902477	904031	5196105		Yersinia_phage(50.0%)	2	NA	NA
WP_047618667.1|902477_903140_-	DNA methylase	NA	A0A2C9CWW2	Yersinia_phage	27.5	7.7e-07
WP_032206956.1|903482_904031_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	36.7	9.1e-22
>prophage 45
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	913537	914071	5196105		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|913537_914071_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 46
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	918204	919038	5196105		Pelagibacter_phage(100.0%)	1	NA	NA
WP_047088020.1|918204_919038_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	39.5	1.9e-39
>prophage 47
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	924088	925250	5196105	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_106888099.1|924088_925250_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 48
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	930141	931206	5196105		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|930141_931206_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 49
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	945792	949002	5196105		Enterobacteria_phage(75.0%)	4	NA	NA
WP_001028096.1|945792_946287_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
WP_032206537.1|946307_947414_+	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	81.9	5.5e-183
WP_001273658.1|947496_947670_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_021545607.1|948432_949002_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	37.1	2.8e-21
>prophage 50
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	953346	1090774	5196105	capsid,integrase,terminase,head,transposase,tail,portal,holin,protease	Escherichia_phage(36.79%)	158	994413:994472	1089849:1089913
WP_106888119.1|953346_954054_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071819441.1|954072_954282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888120.1|954394_956566_+	tape measure protein	NA	A0A2I6PGW5	Salmonella_phage	30.5	1.6e-56
WP_106888121.1|956722_957511_+	hypothetical protein	NA	A0A0A0RK63	Escherichia_phage	70.7	1.3e-66
WP_106888122.1|957507_959151_-	recombinase family protein	NA	A0A142LP20	Marinitoga_camini_virus	24.3	2.3e-07
WP_060552822.1|959202_959808_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|959828_960056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206540.1|960093_961335_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_047087704.1|961625_962885_-	YccE family protein	NA	NA	NA	NA	NA
WP_000420617.1|963145_964066_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_032206557.1|964065_964371_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209866.1|964463_965063_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_032206541.1|965059_967606_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.5	1.1e-72
WP_001230242.1|967605_968778_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_032206543.1|968907_969600_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.4	1.6e-18
WP_001264919.1|969572_970601_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_072057386.1|970683_973428_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001019197.1|974621_974795_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_021292990.1|974784_975015_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528578.1|974989_975178_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|975188_975401_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|975686_975899_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|976339_976645_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|976751_977396_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038079.1|977392_978139_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_032206547.1|978138_980235_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|980280_981420_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|981407_981854_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_047087706.1|981873_984054_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_032206559.1|984169_985468_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|985547_985640_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_032206550.1|985652_986789_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_047087707.1|986800_988357_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004899.1|988490_989348_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_032206552.1|989344_989743_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|989739_990327_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|990323_991031_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|991049_992843_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|992839_993958_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
994413:994472	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_012817749.1|995074_995827_+	type III effector	NA	NA	NA	NA	NA
WP_001023445.1|995951_996221_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_032212660.1|996222_997536_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.5	1.4e-79
WP_001216290.1|997600_998224_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_158707842.1|1002015_1002648_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	6.5e-104
WP_000194707.1|1002593_1003337_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|1003347_1004046_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|1004045_1004375_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081788.1|1004371_1006984_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.1	0.0e+00
WP_000533442.1|1006964_1007378_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_106888124.1|1007404_1007827_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	2.8e-71
WP_000235067.1|1007840_1008593_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|1008600_1008996_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975098.1|1008992_1009571_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000752994.1|1009582_1009936_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1009947_1010343_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1010384_1011410_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1011465_1011798_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|1011807_1013127_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001415980.1|1013107_1014709_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000198153.1|1014705_1014912_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_106888125.1|1014908_1016834_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453587.1|1016808_1017354_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001303940.1|1017739_1017964_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|1018045_1018360_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|1018886_1019072_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|1019294_1019441_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_045904330.1|1019440_1020010_-	antirepressor	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_001092860.1|1020280_1020814_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.9e-101
WP_000284516.1|1021376_1021592_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	7.7e-33
WP_001290231.1|1021668_1021941_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143464.1|1021981_1022161_-	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_080029427.1|1022296_1024234_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.4	0.0e+00
WP_153244796.1|1024219_1024363_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_000466957.1|1024712_1025144_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301797.1|1025594_1026308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|1026443_1026641_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|1026865_1027420_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217447.1|1027428_1027788_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_001265229.1|1027800_1028850_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1028851_1029124_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1029245_1029590_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1029709_1029922_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1030155_1030713_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1030714_1030933_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000034815.1|1031060_1031372_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	91.3	1.6e-55
WP_000699809.1|1031364_1031592_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1031588_1031870_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_106888126.1|1031902_1032664_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	3.2e-73
WP_000139447.1|1032697_1033159_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001435286.1|1033151_1034189_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	69.1	5.8e-86
WP_000693921.1|1034257_1034683_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261756.1|1034679_1034907_-	cell division protein	NA	NA	NA	NA	NA
WP_000380316.1|1035923_1036076_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394543.1|1036087_1036726_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_001133037.1|1036726_1036936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|1037503_1037692_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1037688_1037880_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_106888127.1|1037973_1040424_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|1040491_1040734_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|1040711_1041731_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_074433510.1|1042534_1043146_+	type III effector	NA	NA	NA	NA	NA
WP_001023379.1|1043271_1043541_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_106888128.1|1043542_1044856_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	9.7e-78
WP_047087988.1|1045583_1048979_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.9	0.0e+00
WP_000090891.1|1049039_1049672_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_047087989.1|1049608_1050352_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152619.1|1050357_1051056_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847347.1|1051055_1051385_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_047087991.1|1051381_1053943_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.0	0.0e+00
WP_000459457.1|1053935_1054370_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|1054351_1054774_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|1054789_1055530_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_032207007.1|1055537_1055933_-	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	91.6	1.3e-65
WP_000975037.1|1055929_1056505_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|1056519_1056873_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|1056865_1057240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|1057291_1058320_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|1058377_1058725_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001254039.1|1058761_1060267_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|1060256_1061849_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|1061845_1062052_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_032207005.1|1062035_1063964_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.1e-262
WP_000235436.1|1063935_1064445_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|1064847_1065072_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_012816791.1|1065995_1066181_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1066402_1066516_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003111.1|1066736_1067270_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.9	1.4e-99
WP_000138558.1|1067429_1067702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411804.1|1067957_1068164_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_106888129.1|1068611_1070462_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_001344632.1|1070904_1071036_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_047088297.1|1071632_1072454_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|1072450_1072825_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_106888130.1|1072837_1073887_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	5.5e-108
WP_032207160.1|1073888_1074167_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_000284536.1|1074599_1075076_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	33.3	1.7e-16
WP_001219082.1|1075078_1075438_-	helix-turn-helix transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.9	7.1e-23
WP_000128514.1|1075682_1075895_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	9.6e-28
WP_001278459.1|1076082_1076187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032206192.1|1076296_1077130_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	65.7	5.5e-26
WP_032206194.1|1077165_1077378_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	88.6	1.7e-32
WP_032206196.1|1077423_1077783_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	8.0e-59
WP_047087727.1|1077836_1078262_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.9	5.7e-64
WP_106888131.1|1078302_1079373_-	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	8.5e-64
WP_000693918.1|1079444_1079870_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048459.1|1079866_1080130_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021568728.1|1080237_1080738_+	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.8e-16
WP_000108762.1|1080755_1080947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021568727.1|1080946_1081237_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000367377.1|1081511_1081664_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000373334.1|1081762_1082209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|1082921_1083110_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1083106_1083298_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_099357990.1|1085934_1086138_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106888078.1|1086199_1087355_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888078.1|1087959_1089116_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888132.1|1089131_1089707_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.8	5.1e-47
WP_000375138.1|1090114_1090774_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
1089849:1089913	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 51
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1095007	1097062	5196105		Bacillus_phage(100.0%)	1	NA	NA
WP_032206206.1|1095007_1097062_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
>prophage 52
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1103233	1250849	5196105	capsid,integrase,terminase,head,lysis,transposase,tail,plate,tRNA,portal,holin,protease	Escherichia_phage(31.94%)	135	1114488:1114506	1264086:1264104
WP_032206208.1|1103233_1104994_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|1105062_1105581_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|1105650_1105818_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759120.1|1106073_1106637_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_032206210.1|1106633_1108274_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333176.1|1108278_1109532_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_106888133.1|1111581_1113690_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_032206215.1|1113933_1115043_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
1114488:1114506	attL	AGATAGCTGGAAAGTGATT	NA	NA	NA	NA
WP_001295353.1|1115039_1115582_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|1115755_1116766_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_032205858.1|1116877_1117588_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000919497.1|1117580_1118096_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_077626202.1|1118103_1118631_-	fimbrial protein	NA	NA	NA	NA	NA
WP_047087204.1|1119718_1122319_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001362155.1|1122343_1123045_-	molecular chaperone	NA	NA	NA	NA	NA
WP_047087206.1|1123127_1123613_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032206219.1|1124024_1124600_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_047087207.1|1124592_1125552_+	sulfonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032206221.1|1125548_1126694_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235201.1|1126705_1127497_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_047087208.1|1127493_1128261_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.3e-29
WP_000193831.1|1128467_1131080_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001297200.1|1131345_1132548_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117881.1|1132716_1134117_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|1134718_1135807_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000462687.1|1135991_1137182_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032206222.1|1137403_1138051_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|1138077_1138626_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_032206223.1|1138806_1140654_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_047087209.1|1140914_1145375_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001295347.1|1145374_1146079_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288850.1|1146059_1147382_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001297198.1|1147378_1148164_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899591.1|1148299_1149079_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|1149055_1149949_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011603.1|1150102_1150849_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|1150845_1151028_-	protein YcaR	NA	NA	NA	NA	NA
WP_032206226.1|1151079_1152312_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032206228.1|1152348_1153335_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|1153331_1155080_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_024226769.1|1155116_1157381_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1157586_1157871_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|1158030_1159704_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|1159814_1160498_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001295345.1|1160670_1161435_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000445231.1|1161603_1162887_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057136.1|1162957_1164046_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000642849.1|1164244_1164937_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001295344.1|1165066_1166827_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|1167232_1168090_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292815.1|1168144_1170427_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000468308.1|1170745_1170964_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_047087210.1|1171045_1172209_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.0	4.5e-204
WP_047087211.1|1172208_1172688_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	2.1e-83
WP_047087212.1|1172702_1175150_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.8	0.0e+00
WP_000785970.1|1175142_1175262_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1175294_1175570_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1175626_1176145_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_047087213.1|1176157_1177348_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	6.2e-225
WP_000257039.1|1177606_1178950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032206234.1|1179231_1179759_-|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	96.0	5.2e-91
WP_032206237.1|1182081_1182612_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	98.9	1.9e-101
WP_032206238.1|1182604_1183513_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	7.5e-162
WP_032206239.1|1183517_1183865_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	98.3	5.5e-57
WP_001093707.1|1183861_1184497_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	4.1e-114
WP_047087216.1|1184580_1185366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032206240.1|1185437_1185890_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	3.8e-74
WP_047087217.1|1185882_1186350_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	6.7e-82
WP_001300730.1|1186312_1186486_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_047087218.1|1186457_1186883_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	95.0	5.2e-65
WP_106888134.1|1186870_1187305_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	86.8	2.1e-53
WP_001530534.1|1187319_1187817_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_000123123.1|1187816_1188098_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_032206246.1|1188101_1188305_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	4.4e-30
WP_000988633.1|1188304_1188814_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_047087220.1|1188913_1189657_-|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	100.0	2.1e-122
WP_047087221.1|1189660_1190734_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	2.8e-200
WP_032206252.1|1190792_1191647_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.1	2.4e-130
WP_047087222.1|1191820_1193593_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_047087223.1|1193592_1194627_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	3.5e-200
WP_106888135.1|1195109_1196413_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_106888136.1|1196431_1197331_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	79.7	5.5e-133
WP_047087442.1|1197404_1197611_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	88.1	7.1e-28
WP_047087441.1|1197610_1198054_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	93.2	6.8e-76
WP_032208021.1|1200336_1200612_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	97.8	2.5e-44
WP_001113264.1|1200608_1200833_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277958.1|1200832_1201135_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_032208023.1|1201134_1201359_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	8.8e-32
WP_032208026.1|1201422_1201923_-	hypothetical protein	NA	M1SV55	Escherichia_phage	98.8	3.8e-91
WP_032208029.1|1202189_1202396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032208031.1|1202398_1202995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024240191.1|1203004_1203361_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	81.9	5.1e-50
WP_024182500.1|1203464_1203764_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	79.8	3.8e-38
WP_047087439.1|1203857_1204853_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.1	2.3e-188
WP_000067977.1|1204884_1205682_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_001190367.1|1205763_1206354_-	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_032208033.1|1206453_1207362_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000109295.1|1209002_1210151_-	MFS transporter	NA	NA	NA	NA	NA
WP_032208034.1|1210464_1211091_+	hydrolase	NA	NA	NA	NA	NA
WP_047087438.1|1211125_1211989_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|1211990_1212608_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850303.1|1212618_1215063_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000886683.1|1215300_1216593_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067756.1|1216684_1218028_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	3.6e-80
WP_001295343.1|1218038_1218650_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_047087437.1|1218804_1222872_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|1223006_1223501_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|1224045_1225011_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_047087436.1|1225133_1226900_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	1.6e-22
WP_001202188.1|1226900_1228622_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_032208045.1|1228663_1229368_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1229652_1229871_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_047087435.1|1230614_1232891_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.4	7.4e-166
WP_000520781.1|1232921_1233242_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_047087434.1|1234136_1234418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113648.1|1236075_1236432_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145908.1|1236720_1237161_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.8	7.8e-56
WP_000134111.1|1237160_1237457_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_016241300.1|1237453_1237792_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	2.5e-30
WP_122993077.1|1237788_1238964_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.9	1.1e-184
WP_001475696.1|1239001_1239559_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_001475695.1|1239614_1240772_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.6e-137
WP_001475693.1|1241068_1241293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024166342.1|1241418_1241691_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_047087431.1|1241701_1242112_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001475690.1|1242108_1242354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888137.1|1242641_1244459_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.7	1.5e-129
WP_032208060.1|1244455_1244755_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032208062.1|1244761_1245082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106918783.1|1245074_1245401_-	host cell division inhibitor Icd-like protein	NA	A0A1C9IHV9	Salmonella_phage	55.7	1.7e-07
WP_032208063.1|1245806_1245986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206970.1|1246334_1246544_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_032208065.1|1246962_1248201_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	1.8e-126
WP_000410785.1|1248605_1248830_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_047087428.1|1248902_1250849_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
1264086:1264104	attR	AGATAGCTGGAAAGTGATT	NA	NA	NA	NA
>prophage 53
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1260146	1261865	5196105		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|1260146_1261865_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 54
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1265452	1268190	5196105		Roseobacter_phage(50.0%)	4	NA	NA
WP_001255167.1|1265452_1266283_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|1266279_1266603_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|1266728_1267244_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|1267461_1268190_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 55
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1271526	1280677	5196105		Streptococcus_phage(25.0%)	11	NA	NA
WP_001149681.1|1271526_1272654_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	7.9e-28
WP_000389260.1|1272694_1273183_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|1273242_1274088_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105417.1|1274084_1275038_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996004.1|1275047_1276181_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_047087423.1|1276276_1277389_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|1277739_1278216_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|1278303_1279206_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|1279266_1279989_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|1279972_1280260_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|1280419_1280677_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
>prophage 56
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1289243	1290446	5196105		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|1289243_1290446_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 57
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1306861	1315192	5196105		Synechococcus_phage(33.33%)	5	NA	NA
WP_001295294.1|1306861_1307524_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	3.3e-26
WP_032208084.1|1308548_1310981_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_000114244.1|1311126_1311942_+	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_032208085.1|1312093_1313359_+	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000961458.1|1313599_1315192_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 58
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1320189	1325414	5196105		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|1320189_1320705_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|1320757_1320823_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|1321057_1321945_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|1322243_1322747_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|1323150_1323897_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|1324035_1324695_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|1324691_1325414_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 59
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1328954	1343765	5196105		Erwinia_phage(14.29%)	12	NA	NA
WP_000710619.1|1328954_1329215_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_032208093.1|1331803_1332481_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	2.0e-18
WP_047087415.1|1332554_1332821_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849301.1|1333085_1333346_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443513.1|1333573_1334659_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_032208095.1|1334799_1335762_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218658.1|1335789_1337940_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_001145127.1|1338059_1338542_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_032208097.1|1338773_1340138_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	3.3e-52
WP_106888240.1|1340366_1341038_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_032208099.1|1341040_1342036_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|1342028_1343765_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 60
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1354363	1355272	5196105		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1354363_1355272_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 61
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1361753	1376835	5196105	integrase,transposase,tail,protease,holin	Enterobacteria_phage(50.0%)	15	1363669:1363683	1376909:1376923
WP_071887456.1|1361753_1363043_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	6.9e-20
WP_000767424.1|1363101_1363578_+	kinase inhibitor	NA	NA	NA	NA	NA
1363669:1363683	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_032208109.1|1364084_1364783_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|1365013_1365895_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|1366063_1366225_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_001592261.1|1366720_1367740_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_085972493.1|1367970_1369243_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_060552816.1|1370249_1370405_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	1.1e-17
WP_106888078.1|1370432_1371589_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888139.1|1371999_1372215_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	6.5e-32
WP_033816266.1|1372357_1372756_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|1372836_1372995_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1373080_1373824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|1374076_1374700_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_064717027.1|1375953_1376835_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	9.5e-162
1376909:1376923	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 62
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1386545	1393118	5196105		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|1386545_1387604_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_000604034.1|1387606_1388296_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000101999.1|1388295_1389069_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1389234_1389384_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1389512_1390301_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_032207521.1|1390368_1391841_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.6	2.1e-12
WP_001265443.1|1392101_1393118_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 63
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1397473	1400993	5196105		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109192.1|1397473_1398526_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.6e-81
WP_000784351.1|1398841_1399222_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|1399335_1400277_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|1400273_1400993_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 64
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1436684	1437476	5196105		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|1436684_1437476_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 65
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1440854	1443796	5196105		Acinetobacter_phage(50.0%)	2	NA	NA
WP_047087767.1|1440854_1442336_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	1.9e-45
WP_032207542.1|1442377_1443796_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	8.1e-62
>prophage 66
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1447601	1458214	5196105		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_106888141.1|1447601_1449758_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	3.0e-15
WP_000424925.1|1449998_1450205_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001365534.1|1450517_1450607_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_047087447.1|1450606_1452211_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_047087449.1|1452233_1454282_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_032205747.1|1454290_1454863_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_047087450.1|1454855_1457540_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	27.2	2.2e-12
WP_000186076.1|1457536_1458214_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
>prophage 67
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1469748	1473562	5196105	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1469748_1471413_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|1471615_1473562_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 68
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1478329	1479994	5196105		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337087.1|1478329_1479994_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	1.0e-84
>prophage 69
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1483977	1485057	5196105		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1483977_1485057_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 70
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1492952	1496485	5196105		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1492952_1493678_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|1493795_1494731_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_047087452.1|1494814_1496485_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	5.2e-76
>prophage 71
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1502668	1505251	5196105	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_024226883.1|1502668_1505251_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	8.9e-184
>prophage 72
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1512261	1514700	5196105		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|1512261_1513350_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1513488_1514700_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 73
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1519515	1520162	5196105		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_106888142.1|1519515_1519899_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1519952_1520162_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 74
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1535587	1537702	5196105		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|1535587_1536016_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_106888143.1|1536136_1537702_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 75
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1540812	1542033	5196105		Streptococcus_phage(100.0%)	1	NA	NA
WP_106888144.1|1540812_1542033_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.5	5.1e-57
>prophage 76
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1557260	1563302	5196105		Klosneuvirus(50.0%)	3	NA	NA
WP_047087461.1|1557260_1558076_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	9.5e-07
WP_101967132.1|1558092_1559205_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_032205794.1|1559420_1563302_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.7	2.6e-62
>prophage 77
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1574241	1577385	5196105		Leptospira_phage(100.0%)	1	NA	NA
WP_032205803.1|1574241_1577385_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.0	1.7e-59
>prophage 78
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1580530	1582652	5196105		Bacillus_phage(50.0%)	2	NA	NA
WP_000770953.1|1580530_1581214_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_047087467.1|1581203_1582652_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
>prophage 79
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1591330	1630372	5196105	tail,transposase,protease	Escherichia_phage(40.54%)	45	NA	NA
WP_060552810.1|1591330_1592467_+|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_047088070.1|1592908_1594975_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_047088069.1|1594961_1597934_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|1597934_1598825_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001599523.1|1599007_1599769_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001201825.1|1600280_1601234_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_047088067.1|1601420_1602905_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032207501.1|1603088_1603394_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_136800952.1|1603450_1604119_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077744828.1|1604198_1604537_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.9	3.7e-05
WP_106888077.1|1605284_1606497_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106888146.1|1606463_1606658_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	73.0	3.8e-07
WP_106888147.1|1606921_1608772_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_047087898.1|1609265_1609694_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.4	1.4e-62
WP_047087897.1|1610061_1610214_-	DNA methylase	NA	A0A0N7C2V5	Escherichia_phage	96.0	1.5e-19
WP_032207072.1|1610539_1611460_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	86.5	1.5e-64
WP_032207073.1|1611575_1612406_-	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	80.4	6.7e-117
WP_032207075.1|1612548_1612911_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	98.3	8.6e-61
WP_000002243.1|1612907_1613198_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_047087894.1|1613197_1613920_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	98.8	5.6e-128
WP_000290552.1|1613994_1614672_-	phage antirepressor Ant	NA	A0A0P0ZC44	Stx2-converting_phage	98.7	1.5e-127
WP_029784131.1|1614946_1615108_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	98.1	3.4e-25
WP_000153280.1|1615124_1615652_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_024219806.1|1615648_1616089_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	9.1e-81
WP_047087893.1|1616162_1616453_-	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	97.9	1.8e-45
WP_001510925.1|1616449_1617151_-	replication P family protein	NA	Q6H9X6	Enterobacteria_phage	99.6	1.7e-129
WP_047087890.1|1617147_1618047_-	replication protein	NA	M1FN81	Enterobacteria_phage	99.7	2.9e-174
WP_106888148.1|1618170_1619383_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_032208418.1|1619386_1619689_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	97.8	3.3e-42
WP_000067727.1|1619830_1620046_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|1620120_1620816_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000885926.1|1620825_1621167_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	99.1	2.5e-62
WP_032208417.1|1621234_1621696_+	hypothetical protein	NA	G9L674	Escherichia_phage	99.3	3.8e-77
WP_032207131.1|1623335_1623608_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	9.7e-41
WP_032207130.1|1623666_1624116_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.3e-69
WP_047088220.1|1624311_1624680_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	98.4	2.2e-64
WP_001198861.1|1624752_1624917_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|1624885_1625029_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995409.1|1625104_1625401_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|1625406_1626192_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186792.1|1626188_1626869_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_071887448.1|1626859_1626976_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	84.4	1.0e-07
WP_106888149.1|1626978_1628192_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	4.6e-167
WP_106888078.1|1628500_1629657_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_157911293.1|1630204_1630372_+	hypothetical protein	NA	A0A088CD23	Shigella_phage	81.8	5.8e-20
>prophage 80
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1637459	1640590	5196105	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|1637459_1638326_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|1638327_1638540_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|1638647_1639169_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_032208334.1|1639204_1640590_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 81
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1652109	1653255	5196105		Streptococcus_phage(100.0%)	1	NA	NA
WP_106888151.1|1652109_1653255_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	2.4e-48
>prophage 82
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1659406	1661188	5196105		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_032208406.1|1659406_1661188_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.9	6.0e-38
>prophage 83
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1666445	1674182	5196105		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_106888152.1|1666445_1670657_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
WP_032208352.1|1671084_1673499_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047087392.1|1673495_1674182_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	3.8e-33
>prophage 84
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1677318	1677996	5196105		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|1677318_1677996_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 85
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1682535	1685596	5196105		uncultured_virus(50.0%)	2	NA	NA
WP_047087393.1|1682535_1685040_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	6.5e-115
WP_001344274.1|1685254_1685596_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
>prophage 86
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1693840	1702298	5196105		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_032208358.1|1693840_1694800_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	8.5e-15
WP_001250105.1|1694796_1695759_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|1695890_1696535_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032208360.1|1696715_1698590_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.8	6.8e-117
WP_001195025.1|1698699_1699305_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|1699304_1699634_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122013.1|1699686_1701618_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|1701746_1702298_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 87
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1709306	1712456	5196105		Leptospira_phage(100.0%)	1	NA	NA
WP_032208365.1|1709306_1712456_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.8	6.2e-54
>prophage 88
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1721292	1724839	5196105		Bacillus_phage(100.0%)	2	NA	NA
WP_032208367.1|1721292_1723074_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	4.0e-42
WP_001235610.1|1723066_1724839_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 89
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1728162	1728858	5196105		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032208373.1|1728162_1728858_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	9.3e-88
>prophage 90
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1731986	1737033	5196105	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|1731986_1732259_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001514981.1|1732467_1734822_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|1735009_1736284_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_032208382.1|1736409_1737033_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.4	6.4e-64
>prophage 91
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1760739	1769719	5196105	tRNA	uncultured_Mediterranean_phage(60.0%)	9	NA	NA
WP_001021161.1|1760739_1761210_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_032208391.1|1761298_1762402_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	6.3e-54
WP_000543535.1|1762405_1762855_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295328.1|1763842_1764727_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_032208392.1|1764903_1765251_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|1765379_1766351_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|1766361_1768209_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|1768236_1768569_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_047087404.1|1768591_1769719_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	3.6e-89
>prophage 92
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1776671	1786643	5196105		Bacillus_phage(60.0%)	6	NA	NA
WP_032208397.1|1776671_1777967_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.2e-26
WP_000113933.1|1778024_1778714_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_047087407.1|1778903_1780106_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_032208398.1|1780102_1783246_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_032208410.1|1783371_1784556_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001298537.1|1785731_1786643_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 93
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1790932	1792048	5196105		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|1790932_1792048_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 94
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1799463	1800621	5196105		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032208403.1|1799463_1800621_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 95
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1804256	1805418	5196105	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_106888099.1|1804256_1805418_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
>prophage 96
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1808823	1809591	5196105		Planktothrix_phage(100.0%)	1	NA	NA
WP_047087905.1|1808823_1809591_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	1.5e-25
>prophage 97
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1814904	1816014	5196105		Synechococcus_phage(100.0%)	1	NA	NA
WP_106888153.1|1814904_1816014_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.5	2.6e-31
>prophage 98
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1819204	1821165	5196105		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_047087912.1|1819204_1820218_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|1820214_1821165_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 99
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1826575	1830855	5196105		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805910.1|1826575_1827658_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.4	1.1e-191
WP_047087915.1|1827780_1830855_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.0	0.0e+00
>prophage 100
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1835394	1836294	5196105		Lactobacillus_phage(100.0%)	1	NA	NA
WP_032206730.1|1835394_1836294_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 101
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1839383	1841270	5196105		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032206729.1|1839383_1841270_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	4.1e-53
>prophage 102
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1850973	1852023	5196105		Tupanvirus(100.0%)	1	NA	NA
WP_000692744.1|1850973_1852023_-	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 103
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1866969	1872889	5196105	holin	Vibrio_phage(50.0%)	4	NA	NA
WP_000131044.1|1866969_1869003_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_047088086.1|1869131_1869719_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089075.1|1869732_1871205_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1871218_1872889_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
>prophage 104
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1878463	1885357	5196105	transposase	Erysipelothrix_phage(33.33%)	6	NA	NA
WP_032206452.1|1878463_1879789_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.4e-113
WP_000474077.1|1879897_1880134_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|1880145_1880739_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_047088082.1|1880898_1881768_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	4.6e-52
WP_032206455.1|1882016_1882868_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106888077.1|1884143_1885357_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 105
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1891921	1893194	5196105	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085972493.1|1891921_1893194_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 106
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1896626	1900338	5196105		Streptococcus_phage(66.67%)	3	NA	NA
WP_032206468.1|1896626_1897880_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	1.3e-95
WP_001285288.1|1897891_1898995_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749879.1|1899282_1900338_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	4.5e-118
>prophage 107
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1912828	1916746	5196105		Clostridioides_phage(50.0%)	5	NA	NA
WP_000543899.1|1912828_1913602_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|1913787_1914048_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|1914050_1914329_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|1914484_1915225_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000284050.1|1916167_1916746_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 108
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1922770	1925911	5196105		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106888154.1|1922770_1925911_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.0	2.0e-12
>prophage 109
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1937840	1945471	5196105		Bradyrhizobium_phage(25.0%)	9	NA	NA
WP_074433528.1|1937840_1938572_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	9.9e-40
WP_000917883.1|1938636_1939104_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|1939100_1939823_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|1939856_1940612_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_032207024.1|1940683_1942042_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.3	9.9e-09
WP_047088195.1|1942088_1942712_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|1942715_1943516_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032207026.1|1943756_1944671_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032207027.1|1944667_1945471_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	1.2e-38
>prophage 110
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1951992	1953024	5196105		Planktothrix_phage(100.0%)	1	NA	NA
WP_106888155.1|1951992_1953024_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	38.6	3.6e-35
>prophage 111
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1965981	1970097	5196105		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_001294774.1|1965981_1969464_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569419.1|1969500_1970097_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
>prophage 112
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1978925	1979684	5196105		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|1978925_1979684_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 113
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1991568	1992993	5196105	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|1991568_1992993_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 114
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	1996922	1997267	5196105		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|1996922_1997267_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 115
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2003178	2003976	5196105		Planktothrix_phage(100.0%)	1	NA	NA
WP_032206567.1|2003178_2003976_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	1.0e-13
>prophage 116
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2009218	2016024	5196105	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_077790932.1|2009218_2011648_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.0e-40
WP_032206565.1|2011721_2012252_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|2012266_2012971_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|2013148_2013604_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_021565407.1|2013640_2014567_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174639.1|2014605_2016024_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 117
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2027462	2028359	5196105		Sodalis_phage(100.0%)	1	NA	NA
WP_032205910.1|2027462_2028359_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	48.8	4.8e-60
>prophage 118
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2031621	2038244	5196105		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_106888156.1|2031621_2032548_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_032205911.1|2032656_2033319_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|2033359_2033896_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_032205912.1|2034101_2036492_+	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_032205913.1|2036693_2038244_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 119
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2045891	2047316	5196105		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_106888242.1|2045891_2047316_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 120
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2055943	2056495	5196105		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923727.1|2055943_2056495_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 121
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2060740	2061784	5196105		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2060740_2061784_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 122
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2087763	2089488	5196105		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_016244264.1|2087763_2089488_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.1e-36
>prophage 123
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2102192	2102891	5196105		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916287.1|2102192_2102891_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 124
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2109210	2114632	5196105		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_032205930.1|2109210_2111562_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	26.5	1.5e-33
WP_032205931.1|2111725_2114632_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 125
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2122375	2123775	5196105		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|2122375_2123218_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|2123295_2123775_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 126
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2131669	2137330	5196105		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|2131669_2133184_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_047087176.1|2133214_2134357_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349926.1|2134485_2135703_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_032205938.1|2135776_2137330_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	21.7	6.6e-17
>prophage 127
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2142800	2143949	5196105		Halovirus(100.0%)	1	NA	NA
WP_032205941.1|2142800_2143949_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.4	6.3e-49
>prophage 128
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2148392	2151209	5196105	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_047087178.1|2148392_2151209_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.0	7.9e-77
>prophage 129
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2158249	2167309	5196105		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_032205947.1|2158249_2159416_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
WP_000935262.1|2159944_2160154_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|2160257_2161388_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|2161476_2163393_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843568.1|2163769_2164174_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_032205948.1|2164199_2164904_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|2165052_2165619_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001295414.1|2165653_2166241_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|2166355_2167309_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 130
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2175569	2260687	5196105	capsid,integrase,terminase,head,tail,tRNA,protease,holin	Stx2-converting_phage(43.59%)	98	2196702:2196717	2268044:2268059
WP_001223181.1|2175569_2176256_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_032244798.1|2176655_2176796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|2176891_2177608_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_032205950.1|2177667_2179020_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001219614.1|2179077_2180502_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_001188659.1|2180501_2181191_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_000875487.1|2181203_2181677_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|2181887_2182757_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_032205951.1|2182753_2183401_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_024177800.1|2183452_2183965_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|2184111_2184438_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409459.1|2184527_2186465_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|2186675_2188343_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|2188649_2189882_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029697.1|2189902_2191285_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132955.1|2191333_2192302_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|2192407_2193052_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000224877.1|2194556_2195276_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_032205953.1|2195355_2196579_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|2196630_2197953_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
2196702:2196717	attL	TCACCGCTTTCGCCGC	NA	NA	NA	NA
WP_001295412.1|2198079_2198859_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_047087182.1|2199116_2200667_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088405.1|2200638_2201502_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563058.1|2201614_2202397_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|2202393_2203467_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|2203588_2203750_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|2203876_2204482_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202564.1|2204874_2206461_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001217548.1|2206680_2206941_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.3	8.1e-37
WP_001121225.1|2207533_2208184_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491544.1|2208408_2209284_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.9	9.7e-159
WP_047087983.1|2209423_2209693_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	95.5	1.6e-43
WP_106888159.1|2209694_2211008_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	2.1e-80
WP_001230466.1|2211072_2211672_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.0e-110
WP_060552800.1|2211741_2215155_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	85.8	0.0e+00
WP_122994371.1|2215393_2216026_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	2.5e-103
WP_000194767.1|2215971_2216715_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	3.8e-148
WP_001357740.1|2216725_2217424_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807944.1|2217423_2217765_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_032207138.1|2217757_2221000_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.7	0.0e+00
WP_122993099.1|2221048_2221258_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_001030063.1|2221353_2221728_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275510.1|2221733_2222450_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_000133391.1|2222508_2222853_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2222849_2223296_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2223292_2223643_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2223652_2223979_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063096.1|2226667_2226889_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_060552799.1|2226933_2228871_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.6	0.0e+00
WP_001365116.1|2228934_2230596_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.8	0.0e+00
WP_000958390.1|2230592_2231156_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	1.5e-88
WP_001303046.1|2231444_2231810_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2231851_2232079_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012816791.1|2232503_2232689_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539794.1|2232916_2233063_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_001056806.1|2233062_2233632_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992166.1|2233902_2234436_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_000731236.1|2234486_2234831_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000411802.1|2234835_2235042_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032362364.1|2235489_2237340_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.5	0.0e+00
WP_000752026.1|2237839_2238109_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2238118_2239066_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|2239572_2240007_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|2239999_2240194_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107998.1|2240190_2240796_-	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_001004018.1|2240795_2241518_-	DNA-binding protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_000211422.1|2241592_2242327_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254256.1|2242601_2242784_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153280.1|2242780_2243308_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000814576.1|2243304_2243751_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_001281772.1|2243707_2243944_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|2243954_2244170_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|2244302_2244581_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145907.1|2244651_2244942_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_032208536.1|2244938_2245640_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	6.4e-129
WP_032208537.1|2245636_2246575_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	4.1e-171
WP_000438541.1|2246607_2246904_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_000064148.1|2247042_2247276_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000428098.1|2247389_2248094_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000866443.1|2248230_2248518_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_001082382.1|2248514_2249171_+	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000687675.1|2249167_2249572_+	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_032208543.1|2250079_2250463_+	hypothetical protein	NA	Q08J47	Stx2-converting_phage	99.2	2.0e-63
WP_000095081.1|2250524_2251148_+	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	96.6	2.8e-107
WP_000065373.1|2251328_2251697_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198858.1|2251769_2251910_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000361826.1|2251902_2252046_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_000995407.1|2252121_2252418_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000100847.1|2252423_2253209_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186781.1|2253205_2253886_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.1	6.0e-132
WP_000682304.1|2253882_2254065_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_000548528.1|2254037_2254229_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001447688.1|2254239_2254521_+	hypothetical protein	NA	Q08J56	Stx2-converting_phage	100.0	6.5e-48
WP_000763383.1|2254619_2254841_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289923.1|2254837_2255608_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	97.7	4.0e-140
WP_155701557.1|2255792_2256125_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	98.2	4.9e-63
WP_001400035.1|2256121_2256940_+	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	96.5	1.7e-120
WP_001218294.1|2259463_2260687_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.0	1.3e-233
2268044:2268059	attR	TCACCGCTTTCGCCGC	NA	NA	NA	NA
>prophage 131
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2268874	2270154	5196105		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|2268874_2269414_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|2269416_2270154_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 132
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2273380	2278778	5196105		Tupanvirus(50.0%)	4	NA	NA
WP_032208488.1|2273380_2274403_-	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	9.4e-12
WP_000091572.1|2274541_2275456_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047087184.1|2275670_2277032_+	MFS transporter	NA	NA	NA	NA	NA
WP_106888160.1|2277080_2278778_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.3	3.7e-13
>prophage 133
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2298854	2299811	5196105	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_032208465.1|2298854_2299811_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	8.7e-60
>prophage 134
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2307318	2307873	5196105		Clostridioides_phage(100.0%)	1	NA	NA
WP_001445961.1|2307318_2307873_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	4.6e-37
>prophage 135
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2314395	2315856	5196105		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|2314395_2315856_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 136
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2326122	2327799	5196105		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|2326122_2326719_-	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_032208450.1|2327196_2327799_-	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	9.0e-55
>prophage 137
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2331160	2332141	5196105		Escherichia_phage(100.0%)	1	NA	NA
WP_032208436.1|2331160_2332141_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	54.7	2.1e-101
>prophage 138
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2337014	2338307	5196105		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001616563.1|2337014_2337455_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	7.9e-16
WP_032208434.1|2337485_2338307_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.3	6.8e-45
>prophage 139
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2348410	2349448	5196105		Serratia_phage(100.0%)	1	NA	NA
WP_047087888.1|2348410_2349448_+	site-specific DNA-methyltransferase	NA	A0A1S6UAA7	Serratia_phage	27.2	3.1e-18
>prophage 140
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2352951	2355712	5196105	integrase	Stenotrophomonas_phage(50.0%)	2	2348424:2348437	2361176:2361189
2348424:2348437	attL	CCCCAGATCCGAAA	NA	NA	NA	NA
WP_047087884.1|2352951_2354214_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.5	8.1e-82
WP_032208422.1|2354692_2355712_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	2.4e-44
2361176:2361189	attR	TTTCGGATCTGGGG	NA	NA	NA	NA
>prophage 141
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2364909	2369966	5196105	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
WP_000397144.1|2364909_2366421_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|2366667_2367111_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_032208262.1|2367110_2369966_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	2.3e-140
>prophage 142
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2378267	2384364	5196105		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|2378267_2379203_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|2379215_2379677_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|2379749_2380136_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_047087576.1|2380341_2383038_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	4.1e-46
WP_001387276.1|2383178_2383232_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_032208268.1|2383416_2384364_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	1.0e-12
>prophage 143
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2388002	2390763	5196105		Vibrio_phage(50.0%)	2	NA	NA
WP_000187778.1|2388002_2390141_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106228.1|2390298_2390763_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	56.4	2.5e-52
>prophage 144
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2395000	2401488	5196105		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|2395000_2395999_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595985.1|2396031_2397027_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_047087578.1|2397013_2398036_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205800.1|2398049_2399552_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	3.1e-11
WP_000265933.1|2399691_2400648_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|2400957_2401488_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 145
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2442727	2518453	5196105	transposase,protease,tRNA	Vibrio_phage(13.33%)	58	NA	NA
WP_000811566.1|2442727_2443003_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|2443119_2444745_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943982.1|2444828_2445992_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|2445994_2446633_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|2446642_2447041_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000511955.1|2447768_2448467_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|2448485_2448887_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_032208299.1|2449011_2449743_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_047087583.1|2449923_2452365_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	8.4e-67
WP_001177639.1|2452403_2452829_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|2453033_2454332_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089294.1|2454435_2454633_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|2454714_2455719_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|2455721_2456981_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|2457066_2458347_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|2458423_2458732_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032208303.1|2458817_2459768_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122503.1|2459760_2461608_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990262.1|2461617_2462952_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|2462970_2463432_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_072097076.1|2463403_2464951_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|2464949_2466089_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|2466071_2466125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|2466987_2467533_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|2467627_2468680_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934912.1|2468776_2469745_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_032208306.1|2469766_2473090_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_032208307.1|2473240_2474743_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|2474961_2475939_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192973.1|2476263_2478072_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|2478064_2478799_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|2478809_2479205_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|2479215_2479575_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001339477.1|2479637_2480771_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238369.1|2480859_2481393_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|2481389_2481707_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|2481881_2482028_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|2482138_2482264_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|2482315_2482882_-	elongation factor P	NA	NA	NA	NA	NA
WP_032208308.1|2482923_2483952_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_032208310.1|2484341_2485211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|2485413_2485767_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|2485904_2487551_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|2487594_2487888_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_032208312.1|2488164_2489421_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|2489436_2489913_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|2490249_2491686_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|2491803_2493105_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883400.1|2493220_2493559_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_032208314.1|2493534_2495232_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_032208316.1|2495268_2495844_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_085947598.1|2496949_2498112_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_106888166.1|2498358_2499631_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	3.7e-175
WP_001121622.1|2500482_2502132_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_000953023.1|2502739_2503729_+	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
WP_047087560.1|2503777_2504452_+	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_047087561.1|2506326_2515998_+	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_106888167.1|2517240_2518453_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.7e-167
>prophage 146
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2537898	2539401	5196105		Burkholderia_virus(100.0%)	1	NA	NA
WP_032206021.1|2537898_2539401_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 147
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2544224	2545013	5196105		Planktothrix_phage(100.0%)	1	NA	NA
WP_047087762.1|2544224_2545013_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	4.7e-27
>prophage 148
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2551550	2552231	5196105		Planktothrix_phage(100.0%)	1	NA	NA
WP_000611429.1|2551550_2552231_+	phosphonate C-P lyase system protein PhnL	NA	G9BWD6	Planktothrix_phage	33.6	1.3e-17
>prophage 149
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2556216	2558202	5196105		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032206030.1|2556216_2558202_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	2.1e-148
>prophage 150
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2563446	2565594	5196105		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2563446_2565594_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 151
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2574990	2576949	5196105		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047087757.1|2574990_2576949_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 152
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2582532	2583882	5196105		Moraxella_phage(100.0%)	1	NA	NA
WP_047087756.1|2582532_2583882_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	70.2	2.3e-159
>prophage 153
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2587699	2591312	5196105		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|2587699_2588236_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_047087754.1|2588489_2591312_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 154
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2595501	2636394	5196105	capsid,integrase,terminase,head,lysis,transposase,tail,tRNA,holin	Stx2-converting_phage(37.5%)	43	2592031:2592045	2605610:2605624
2592031:2592045	attL	CGGCATATCAGCCAG	NA	NA	NA	NA
WP_032206040.1|2595501_2596581_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	6.8e-29
WP_000918363.1|2596633_2598049_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|2598131_2599115_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|2599280_2599523_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_072176623.1|2599656_2600694_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332258.1|2600782_2601880_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	8.1e-211
WP_047087753.1|2601928_2602177_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	97.6	1.7e-36
WP_001143783.1|2602337_2602979_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	1.3e-107
WP_072140863.1|2603060_2603690_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118085.1|2603757_2604339_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_001023445.1|2604449_2604719_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_106888168.1|2604720_2606025_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	86.9	5.7e-70
2605610:2605624	attR	CTGGCTGATATGCCG	NA	NA	NA	NA
WP_106888169.1|2606754_2610234_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.1	0.0e+00
WP_122993104.1|2610479_2611112_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	3.4e-105
WP_047088113.1|2611057_2611801_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	95.5	6.8e-145
WP_047088114.1|2611811_2612510_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	1.4e-131
WP_000807944.1|2612509_2612851_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_060552897.1|2612843_2616086_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	92.6	0.0e+00
WP_122993099.1|2616133_2616343_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	98.6	3.3e-33
WP_001030063.1|2616438_2616813_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275477.1|2616818_2617535_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	1.9e-128
WP_000133391.1|2617601_2617946_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573374.1|2617942_2618389_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2618385_2618736_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2618745_2619072_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_032274028.1|2621112_2621334_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	9.9e-36
WP_047087555.1|2621378_2623319_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	96.6	0.0e+00
WP_047087554.1|2623382_2625044_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_024224188.1|2625891_2626257_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	97.5	5.4e-63
WP_000095741.1|2626298_2626499_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_001283921.1|2626791_2627049_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2627045_2627543_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092313.1|2627745_2628183_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_001135289.1|2628179_2628677_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000411802.1|2628676_2628883_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_060552899.1|2629175_2631026_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_001490213.1|2631596_2632028_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	99.3	7.8e-69
WP_047619196.1|2632217_2632427_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.7e-19
WP_106888170.1|2632530_2633743_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	1.6e-167
WP_001014286.1|2634644_2634833_+	hypothetical protein	NA	G9L660	Escherichia_phage	92.1	2.2e-23
WP_047087994.1|2634835_2635504_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.6	5.5e-61
WP_001061348.1|2635503_2636076_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	1.2e-109
WP_001093921.1|2636112_2636394_+	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	95.7	4.1e-42
>prophage 155
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2641945	2642554	5196105		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2641945_2642554_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 156
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2651676	2652792	5196105		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2651676_2652792_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 157
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2678143	2681827	5196105		Dickeya_phage(100.0%)	1	NA	NA
WP_000095999.1|2678143_2681827_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 158
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2697908	2699498	5196105		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_047087690.1|2697908_2699498_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 159
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2704866	2706630	5196105		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|2704866_2705139_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|2705325_2705916_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362392.1|2705958_2706630_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 160
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2715994	2724323	5196105		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|2715994_2720218_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|2720294_2724323_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 161
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2728441	2731494	5196105		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|2728441_2729626_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|2730543_2731494_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 162
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2740088	2741933	5196105		Acinetobacter_phage(100.0%)	1	NA	NA
WP_047087723.1|2740088_2741933_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 163
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2763096	2766271	5196105		Hokovirus(50.0%)	3	NA	NA
WP_077790966.1|2763096_2765142_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	8.4e-12
WP_106888173.1|2765087_2765597_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000424845.1|2765608_2766271_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 164
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2779137	2781279	5196105		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_106888175.1|2779137_2781279_-	DUF4329 domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	32.7	1.1e-14
>prophage 165
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2786916	2791441	5196105		Erwinia_phage(50.0%)	5	NA	NA
WP_032206093.1|2786916_2788248_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.5	1.3e-45
WP_000139496.1|2788314_2789241_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|2789354_2789840_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|2789924_2790170_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|2790595_2791441_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 166
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2803017	2807878	5196105		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|2803017_2803716_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|2803712_2805086_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270260.1|2805191_2805866_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|2806014_2806998_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|2807257_2807878_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 167
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2822645	2825696	5196105		Escherichia_phage(100.0%)	1	NA	NA
WP_077790937.1|2822645_2825696_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	2.2e-08
>prophage 168
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2833016	2835796	5196105		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|2833016_2833802_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_032206114.1|2833835_2834732_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_032206115.1|2834899_2835796_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	89.9	8.1e-60
>prophage 169
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2852020	2854491	5196105		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|2852020_2853070_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188777.1|2853081_2854491_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 170
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2858569	2861356	5196105		Bacillus_phage(100.0%)	1	NA	NA
WP_032206120.1|2858569_2861356_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	34.0	1.6e-74
>prophage 171
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2874951	2875566	5196105		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2874951_2875566_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 172
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2884356	2887643	5196105		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|2884356_2885133_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|2885135_2885651_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|2885654_2885924_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_032206423.1|2886002_2887643_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	6.3e-42
>prophage 173
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2900055	2901885	5196105		Catovirus(100.0%)	1	NA	NA
WP_047087848.1|2900055_2901885_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	2.5e-84
>prophage 174
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2909361	2913220	5196105		Bacillus_phage(100.0%)	3	NA	NA
WP_000383411.1|2909361_2911524_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
WP_001213584.1|2911607_2912324_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_032206417.1|2912326_2913220_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 175
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2931662	2937806	5196105		Enterobacteria_phage(40.0%)	6	NA	NA
WP_047087841.1|2931662_2932793_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
WP_001145172.1|2932797_2933472_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|2933449_2934331_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_032206409.1|2934349_2935417_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	8.6e-101
WP_047087839.1|2935416_2936679_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	4.5e-24
WP_000866672.1|2936675_2937806_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 176
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2941848	2947260	5196105		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|2941848_2942178_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|2942308_2943574_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_032206408.1|2943707_2945192_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_047087837.1|2945238_2947260_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	1.1e-112
>prophage 177
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2955733	2957380	5196105		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012621.1|2955733_2957380_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.4e-67
>prophage 178
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2960920	2962133	5196105	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_106888179.1|2960920_2962133_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	9.3e-168
>prophage 179
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2972083	2977935	5196105		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|2972083_2972974_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|2972998_2973964_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_032207986.1|2973967_2975473_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.6e-15
WP_032208010.1|2975480_2975900_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_032207989.1|2976066_2977935_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.7e-64
>prophage 180
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2981102	2982095	5196105		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_032207992.1|2981102_2982095_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 181
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	2994046	2997408	5196105		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_024226301.1|2994046_2995417_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	1.8e-34
WP_047087268.1|2995578_2997408_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	1.6e-131
>prophage 182
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3002938	3006779	5196105		Cyanophage(50.0%)	4	NA	NA
WP_032208002.1|3002938_3003979_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	39.3	2.1e-51
WP_032208004.1|3004065_3005025_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|3005024_3005915_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|3006005_3006779_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	31.6	1.3e-18
>prophage 183
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3014773	3016111	5196105		Moraxella_phage(100.0%)	1	NA	NA
WP_000019346.1|3014773_3016111_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	3.4e-62
>prophage 184
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3026017	3033386	5196105		Staphylococcus_phage(33.33%)	8	NA	NA
WP_032207464.1|3026017_3026275_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|3026238_3026598_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|3026614_3026755_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|3026984_3027065_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|3027361_3028765_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_032207461.1|3028769_3029870_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	5.3e-53
WP_000060112.1|3029869_3030943_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_032207460.1|3030971_3033386_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	1.3e-115
>prophage 185
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3038091	3039240	5196105		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3038091_3039240_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 186
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3043667	3044621	5196105		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|3043667_3044081_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|3044192_3044621_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 187
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3050972	3060132	5196105		Aeromonas_phage(25.0%)	11	NA	NA
WP_106888181.1|3050972_3052688_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	2.8e-40
WP_148936161.1|3052711_3053239_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_072057383.1|3053238_3054177_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	28.0	4.4e-16
WP_032207445.1|3054223_3054673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000703959.1|3054781_3055129_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|3055118_3055481_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148053.1|3055477_3055975_+	radical SAM protein	NA	NA	NA	NA	NA
WP_001362492.1|3055982_3057167_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|3057585_3057675_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|3058239_3058338_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_032207442.1|3058443_3060132_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	7.1e-57
>prophage 188
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3067437	3068772	5196105		Moraxella_phage(100.0%)	1	NA	NA
WP_077790961.1|3067437_3068772_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.9	5.6e-65
>prophage 189
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3075405	3081077	5196105		Enterobacteria_phage(100.0%)	7	NA	NA
WP_047087656.1|3075405_3077739_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_032207431.1|3077753_3078074_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_047087655.1|3078209_3078665_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	1.4e-63
WP_060552904.1|3078657_3078945_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	94.7	2.1e-46
WP_047087654.1|3078937_3079528_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	88.8	3.5e-59
WP_001149160.1|3079524_3079791_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032207427.1|3080342_3081077_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	5.2e-129
>prophage 190
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3084160	3085330	5196105	integrase	Enterobacteria_phage(100.0%)	1	3075463:3075476	3090102:3090115
3075463:3075476	attL	CAGCGTCAGGTTGG	NA	NA	NA	NA
WP_032207422.1|3084160_3085330_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.0	1.8e-200
WP_032207422.1|3084160_3085330_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.0	1.8e-200
3090102:3090115	attR	CAGCGTCAGGTTGG	NA	NA	NA	NA
>prophage 191
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3091472	3092864	5196105		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3091472_3092864_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 192
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3097985	3104736	5196105		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|3097985_3100094_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|3100112_3100388_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|3100442_3101066_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_047087652.1|3101323_3103006_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	2.8e-21
WP_000924289.1|3103002_3103620_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032207412.1|3103911_3104736_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.6	2.9e-96
>prophage 193
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3108109	3112671	5196105		Xanthomonas_phage(33.33%)	6	NA	NA
WP_001298007.1|3108109_3108565_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
WP_047087651.1|3109936_3110605_+	RadC family protein	NA	NA	NA	NA	NA
WP_000091955.1|3110821_3111058_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|3111078_3111246_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114533.1|3111343_3112153_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001171866.1|3112191_3112671_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 194
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3124601	3135330	5196105		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|3124601_3125534_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_001307464.1|3125822_3126695_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|3126969_3128166_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646002.1|3128175_3129201_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.8e-18
WP_047087648.1|3129439_3130384_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.3e-09
WP_047087647.1|3130460_3131420_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|3131423_3132707_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000116565.1|3132716_3134261_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001156181.1|3134505_3134937_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_032207396.1|3135078_3135330_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.6e-16
>prophage 195
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3163763	3165608	5196105		Tupanvirus(100.0%)	1	NA	NA
WP_000582456.1|3163763_3165608_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 196
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3189793	3191335	5196105		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146509.1|3189793_3191335_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 197
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3196649	3197645	5196105		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|3196649_3197645_-	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 198
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3201869	3202082	5196105		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3201869_3202082_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 199
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3205736	3208070	5196105		Escherichia_phage(100.0%)	1	NA	NA
WP_071887535.1|3205736_3208070_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	1.4e-71
>prophage 200
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3218284	3220269	5196105		Planktothrix_phage(100.0%)	2	NA	NA
WP_032207329.1|3218284_3219268_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
WP_000107031.1|3219264_3220269_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G9BWD6	Planktothrix_phage	33.7	1.1e-20
>prophage 201
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3267180	3267828	5196105		Bacillus_virus(100.0%)	1	NA	NA
WP_032207372.1|3267180_3267828_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 202
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3272710	3274845	5196105		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065769.1|3272710_3273136_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
WP_047087327.1|3273148_3274438_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	2.3e-172
WP_000008957.1|3274491_3274845_-	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 203
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3278190	3280233	5196105		Indivirus(100.0%)	1	NA	NA
WP_047087325.1|3278190_3280233_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	1.4e-46
>prophage 204
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3293645	3299542	5196105		Staphylococcus_phage(33.33%)	6	NA	NA
WP_032207297.1|3293645_3296381_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	7.1e-22
WP_001216257.1|3296380_3297505_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001259385.1|3297577_3297853_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	50.0	3.7e-16
WP_000593555.1|3297849_3298209_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|3298328_3298730_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|3298735_3299542_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 205
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3307434	3311566	5196105		Dickeya_phage(50.0%)	4	NA	NA
WP_001100469.1|3307434_3308100_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
WP_000130621.1|3308320_3308566_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106535.1|3308667_3310866_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	6.5e-119
WP_032207287.1|3310939_3311566_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 206
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3314568	3317387	5196105		Planktothrix_phage(50.0%)	3	NA	NA
WP_032207283.1|3314568_3315237_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.0	1.0e-27
WP_001042003.1|3315229_3316288_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|3316532_3317387_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 207
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3323120	3324603	5196105		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_032207279.1|3323120_3323915_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	5.1e-13
WP_000947905.1|3323901_3324603_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	6.9e-14
>prophage 208
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3328144	3329955	5196105		Planktothrix_phage(50.0%)	2	NA	NA
WP_047087317.1|3328144_3329215_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073597.1|3329211_3329955_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	3.7e-10
>prophage 209
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3349981	3352429	5196105		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3349981_3352429_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 210
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3361651	3362878	5196105		Ralstonia_phage(100.0%)	1	NA	NA
WP_032207257.1|3361651_3362878_+	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.5	2.9e-132
>prophage 211
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3367257	3369651	5196105		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3367257_3369651_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 212
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3375620	3376499	5196105		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|3375620_3376499_-	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 213
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3383061	3386828	5196105		Bacillus_phage(66.67%)	3	NA	NA
WP_001157751.1|3383061_3383781_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_047087304.1|3383777_3385130_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001265681.1|3385205_3386828_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 214
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3403740	3404577	5196105		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3403740_3404577_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 215
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3428794	3438334	5196105		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601849.1|3428794_3429358_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.2	3.5e-61
WP_001618902.1|3429443_3430664_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_047087296.1|3430729_3432820_-	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|3432870_3433503_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|3433804_3434209_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|3434263_3435133_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|3435186_3435405_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057379.1|3435398_3436421_-	hydrolase	NA	NA	NA	NA	NA
WP_047087294.1|3436420_3438334_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 216
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3443904	3449478	5196105		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|3443904_3444291_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820720.1|3444290_3444650_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|3444657_3444945_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|3445070_3445445_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|3445541_3446012_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|3446108_3448223_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|3448293_3449478_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 217
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3469355	3470827	5196105	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004476.1|3469355_3470303_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
WP_000114986.1|3470317_3470827_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
>prophage 218
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3481161	3486628	5196105	transposase	Planktothrix_phage(33.33%)	5	NA	NA
WP_000078316.1|3481161_3481920_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.3e-29
WP_001364972.1|3481927_3483031_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_106888148.1|3483083_3484297_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	4.2e-168
WP_032208197.1|3484353_3485535_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738579.1|3485602_3486628_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
>prophage 219
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3493131	3494016	5196105		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_047087537.1|3493131_3494016_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	8.4e-25
>prophage 220
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3499353	3503866	5196105		Escherichia_phage(50.0%)	4	NA	NA
WP_000843960.1|3499353_3500184_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
WP_000275535.1|3500525_3501380_+	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_032208192.1|3501415_3502306_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000132908.1|3502366_3503866_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
>prophage 221
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3513907	3514951	5196105		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3513907_3514951_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 222
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3531441	3533966	5196105	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|3531441_3532509_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|3532598_3533966_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 223
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3537932	3538430	5196105	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3537932_3538430_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 224
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3542135	3543626	5196105		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108473.1|3542135_3543626_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 225
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3553321	3568116	5196105		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001299745.1|3553321_3554251_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|3554346_3556683_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|3556912_3557566_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_032208175.1|3557562_3558291_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620405.1|3558287_3558920_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|3559133_3559406_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|3559402_3560257_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_032208173.1|3560302_3560794_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|3560911_3561199_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|3561221_3562655_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|3562702_3563428_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|3563434_3563992_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|3563960_3564536_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_053272854.1|3564532_3565099_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.0	1.9e-54
WP_001295557.1|3565119_3566106_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922872.1|3566119_3567097_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_032208171.1|3567306_3568116_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 226
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3572184	3573661	5196105		Vibrio_phage(50.0%)	2	NA	NA
WP_047087530.1|3572184_3572463_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	72.1	7.6e-17
WP_001047336.1|3572689_3573661_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 227
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3580289	3583162	5196105	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|3580289_3582224_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|3582313_3583162_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 228
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3586364	3593003	5196105		Dickeya_phage(50.0%)	4	NA	NA
WP_000207684.1|3586364_3587708_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|3588338_3588791_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|3588818_3590306_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|3590330_3593003_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 229
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3598484	3600374	5196105		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3598484_3600374_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 230
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3606201	3616211	5196105	transposase	Diadromus_pulchellus_ascovirus(20.0%)	11	NA	NA
WP_032208156.1|3606201_3606504_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.1e-13
WP_000449031.1|3606554_3606998_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037607.1|3606977_3607496_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
WP_001343556.1|3607623_3608259_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_106888183.1|3608331_3609372_+	permease	NA	NA	NA	NA	NA
WP_000646043.1|3609485_3610061_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158034.1|3610070_3610661_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_032208153.1|3610680_3611076_-	YraN family protein	NA	NA	NA	NA	NA
WP_032208151.1|3611033_3613070_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000809256.1|3613133_3613994_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	1.2e-49
WP_085972493.1|3614937_3616211_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 231
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3638339	3639485	5196105		Streptococcus_phage(100.0%)	1	NA	NA
WP_001364980.1|3638339_3639485_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.7e-50
>prophage 232
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3647462	3649757	5196105		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3647462_3649757_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 233
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3668683	3669957	5196105	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_106888184.1|3668683_3669957_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.1e-174
>prophage 234
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3677313	3678279	5196105		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3677313_3678279_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 235
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3690925	3707109	5196105	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_106888185.1|3690925_3694018_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.3e-157
WP_000212443.1|3694201_3695185_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|3695403_3695736_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_122993085.1|3695777_3697268_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	6.3e-33
WP_032205997.1|3697574_3699095_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	5.3e-35
WP_000018003.1|3699248_3699872_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047087824.1|3700148_3700913_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_047087825.1|3701166_3701673_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|3701750_3703592_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_032205995.1|3703786_3705532_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.4e-76
WP_001144069.1|3705642_3705858_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_047087826.1|3706095_3707109_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	5.3e-108
>prophage 236
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3713491	3714730	5196105	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|3713491_3714730_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 237
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3719867	3721301	5196105		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032205991.1|3719867_3721301_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	5.7e-39
>prophage 238
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3730815	3741776	5196105		Staphylococcus_phage(20.0%)	11	NA	NA
WP_047087832.1|3730815_3731469_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.8	1.1e-45
WP_000469266.1|3731729_3731900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314167.1|3731957_3732731_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_074433646.1|3732846_3733662_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|3733699_3734860_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|3734865_3735537_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_032205984.1|3735684_3737166_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917130.1|3737370_3738000_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	33.0	4.6e-17
WP_000833393.1|3738000_3738423_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|3738447_3739275_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000195296.1|3739883_3741776_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 239
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3746733	3826710	5196105	transposase,protease	Acinetobacter_phage(18.18%)	61	NA	NA
WP_000712658.1|3746733_3747126_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|3747178_3747661_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281881.1|3748206_3750465_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000965712.1|3750697_3751435_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_032205979.1|3751509_3752922_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_032205978.1|3753032_3755252_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|3755294_3755552_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_106888186.1|3756356_3757513_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_047087345.1|3757574_3757796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013149.1|3757995_3758823_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_001058807.1|3758927_3760091_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000817717.1|3760284_3761184_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032205977.1|3762023_3763211_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_000527844.1|3763462_3764197_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_001240712.1|3764203_3764629_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_032205976.1|3764900_3765785_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.8	1.1e-64
WP_000439331.1|3765975_3766470_+	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_047087342.1|3766509_3767550_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_047087340.1|3767706_3768594_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_001059136.1|3768712_3769000_+	DUF2623 domain-containing protein	NA	NA	NA	NA	NA
WP_000145410.1|3769188_3770307_+	hydrogenase 2 small subunit	NA	NA	NA	NA	NA
WP_001081870.1|3770309_3771296_+	hydrogenase 2 operon protein HybA	NA	NA	NA	NA	NA
WP_000017703.1|3771285_3772464_+	Ni/Fe-hydrogenase cytochrome b subunit	NA	NA	NA	NA	NA
WP_047087338.1|3772460_3774164_+	hydrogenase 2 large subunit	NA	NA	NA	NA	NA
WP_032205973.1|3774163_3774658_+	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_000134014.1|3774650_3775139_+	hydrogenase-2 assembly chaperone	NA	NA	NA	NA	NA
WP_032205972.1|3775131_3775473_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_000334896.1|3775485_3775734_+	hydrogenase maturation factor HybG	NA	NA	NA	NA	NA
WP_032205971.1|3775856_3776723_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_001297309.1|3776927_3778787_+	bifunctional glutathionylspermidine amidase/synthase	NA	NA	NA	NA	NA
WP_077790941.1|3780625_3781147_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001076231.1|3781408_3782122_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_000339512.1|3782153_3782912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000896880.1|3782957_3784307_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_024243873.1|3784306_3785131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298770.1|3785142_3785703_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000779665.1|3785733_3786804_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_032205969.1|3786800_3787880_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000248097.1|3789085_3789334_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_032205968.1|3789365_3790280_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_072033243.1|3790276_3792007_-	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_032205967.1|3792368_3793511_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001297764.1|3793517_3794282_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
WP_000026117.1|3794531_3796031_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_000943059.1|3796030_3797083_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_001194666.1|3797093_3798317_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_032205965.1|3798321_3798726_+	protein GlcG	NA	NA	NA	NA	NA
WP_032205964.1|3798747_3800919_+	malate synthase G	NA	NA	NA	NA	NA
WP_032205963.1|3803441_3808007_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_032205962.1|3808154_3808964_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_001324279.1|3809029_3809440_+	GspS/AspS pilotin family protein	NA	NA	NA	NA	NA
WP_032205961.1|3809457_3810417_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_047087336.1|3812506_3813994_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_047087335.1|3813993_3815217_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|3815233_3815689_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_106888113.1|3815916_3817130_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	2.1e-167
WP_000854916.1|3817441_3817819_-	toxin	NA	NA	NA	NA	NA
WP_097746533.1|3817977_3819134_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_032207120.1|3819680_3823772_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.6	6.8e-311
WP_106888188.1|3824813_3826087_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	4.9e-175
WP_106888189.1|3826083_3826710_-	T3SS effector protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	72.9	1.1e-79
>prophage 240
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3837484	3839023	5196105		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|3837484_3839023_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 241
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3862457	3865676	5196105	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001145628.1|3862457_3863096_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	42.7	9.0e-45
WP_085972493.1|3864402_3865676_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 242
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3892761	3893916	5196105		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3892761_3893916_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 243
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3906554	3907232	5196105		Bacillus_virus(100.0%)	1	NA	NA
WP_000956893.1|3906554_3907232_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.9e-09
>prophage 244
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3925237	3926470	5196105		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3925237_3926470_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 245
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3934997	3937871	5196105		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000195050.1|3934997_3937871_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 246
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3944293	3959683	5196105	tRNA	Brevibacillus_phage(16.67%)	12	NA	NA
WP_000806638.1|3944293_3945190_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715227.1|3945213_3945924_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_001701073.1|3947752_3948850_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|3948860_3950378_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192804.1|3950420_3950969_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|3951023_3951095_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|3951091_3951217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|3951218_3952667_-	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001350545.1|3953102_3955022_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_032207674.1|3955021_3955510_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012163.1|3955545_3956913_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_047087633.1|3958282_3959683_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 247
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3983961	3987763	5196105	transposase	Clostridium_phage(50.0%)	4	NA	NA
WP_001272558.1|3983961_3984717_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_001570270.1|3985365_3985572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232281.1|3985605_3985926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085972493.1|3986489_3987763_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 248
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	3995211	3997706	5196105		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_047087574.1|3995211_3995973_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	1.6e-19
WP_047087573.1|3996287_3997706_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 249
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4007337	4014110	5196105		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|4007337_4008051_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|4008119_4008809_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|4009493_4010024_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957914.1|4010036_4012283_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|4012433_4013309_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|4013315_4014110_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 250
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4019587	4034864	5196105	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_032207645.1|4019587_4022476_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	26.0	2.1e-69
WP_047087572.1|4022468_4026011_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.2e-08
WP_000775975.1|4026010_4027837_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	1.6e-25
WP_047087571.1|4027898_4029230_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|4029461_4030715_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|4031184_4032282_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117728.1|4032358_4033165_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000184246.1|4033215_4033659_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_032207641.1|4033658_4034864_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	3.9e-73
>prophage 251
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4046391	4047147	5196105		Bacillus_phage(100.0%)	1	NA	NA
WP_032207634.1|4046391_4047147_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 252
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4052005	4052854	5196105		Vibrio_phage(100.0%)	1	NA	NA
WP_000100420.1|4052005_4052854_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 253
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4060388	4064503	5196105		Hokovirus(50.0%)	2	NA	NA
WP_047087567.1|4060388_4063145_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	8.3e-55
WP_000046800.1|4063201_4064503_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
>prophage 254
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4068535	4073454	5196105		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_000210878.1|4068535_4070173_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|4070260_4071559_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_032207621.1|4072782_4073454_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	1.7e-14
>prophage 255
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4092287	4093500	5196105	transposase	Enterobacteria_phage(100.0%)	1	NA	NA
WP_106888077.1|4092287_4093500_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
>prophage 256
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4102663	4104696	5196105		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|4102663_4104091_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|4104090_4104696_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 257
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4107808	4110469	5196105		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_001295182.1|4107808_4108570_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|4108563_4109190_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_032207602.1|4109329_4110469_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
>prophage 258
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4116708	4123847	5196105		Escherichia_phage(75.0%)	4	NA	NA
WP_001278994.1|4116708_4117347_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001297141.1|4119705_4120473_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_032207596.1|4120523_4121180_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	1.9e-50
WP_001272898.1|4121285_4123847_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 259
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4142032	4143046	5196105		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300105.1|4142032_4143046_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 260
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4150521	4151487	5196105		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|4150521_4151487_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 261
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4156953	4162513	5196105	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|4156953_4157451_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|4157530_4158592_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|4158834_4159335_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047202.1|4159462_4162093_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|4162327_4162513_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 262
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4175423	4180719	5196105		Bacillus_virus(20.0%)	5	NA	NA
WP_047087233.1|4175423_4176626_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|4176980_4177940_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246502.1|4177949_4180094_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.3	6.4e-196
WP_000080944.1|4180066_4180477_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_032207560.1|4180473_4180719_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.1e-06
>prophage 263
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4184654	4188778	5196105		Clostridium_phage(50.0%)	4	NA	NA
WP_047087232.1|4184654_4185104_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156817.1|4185104_4185767_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|4185787_4187188_-	GABA permease	NA	NA	NA	NA	NA
WP_001364906.1|4187497_4188778_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	7.1e-33
>prophage 264
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4203924	4204407	5196105		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|4203924_4204407_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 265
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4218041	4219112	5196105		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_032207549.1|4218041_4219112_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
>prophage 266
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4225019	4227593	5196105		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|4225019_4227593_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 267
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4233371	4234670	5196105		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|4233371_4234670_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 268
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4239963	4246216	5196105	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|4239963_4240383_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|4240589_4241627_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_032206386.1|4241674_4242364_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	5.5e-56
WP_000627807.1|4242668_4243052_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|4243107_4243695_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001445929.1|4243797_4244679_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219195.1|4244887_4246216_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 269
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4251987	4255729	5196105		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|4251987_4253787_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|4253802_4254777_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|4255048_4255729_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 270
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4259188	4259449	5196105		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032206375.1|4259188_4259449_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 271
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4263568	4274876	5196105		Bacillus_phage(50.0%)	7	NA	NA
WP_032206373.1|4263568_4267456_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	5.9e-131
WP_001297612.1|4268031_4269459_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_047087551.1|4269623_4270337_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001295369.1|4270326_4271661_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|4271721_4272060_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|4272104_4273295_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_047087550.1|4273622_4274876_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.0e-100
>prophage 272
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4297443	4303900	5196105		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|4297443_4298658_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|4298685_4299072_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|4299088_4299412_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384413.1|4299507_4300023_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_032206361.1|4300039_4301890_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_001124469.1|4301891_4302227_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|4302238_4302439_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|4302616_4303900_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 273
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4313784	4371276	5196105	integrase,terminase,transposase,tRNA,holin,protease	Escherichia_phage(44.64%)	66	4319143:4319158	4346742:4346757
WP_000963837.1|4313784_4314216_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
WP_000003317.1|4314365_4315520_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_001090844.1|4315804_4316818_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000551818.1|4316844_4317963_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001107171.1|4318073_4319348_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
4319143:4319158	attL	GCGTGAAATTGATGAC	NA	NA	NA	NA
WP_032206354.1|4319365_4319986_+	YfgM family protein	NA	NA	NA	NA	NA
WP_001177043.1|4319996_4321175_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_000249410.1|4321292_4322765_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001297332.1|4322833_4323049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087547.1|4323045_4324416_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
WP_032206389.1|4324577_4326044_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	6.8e-88
WP_000138282.1|4326112_4327690_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000954572.1|4327882_4329133_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.5	3.6e-239
WP_023909811.1|4329136_4329331_-	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	5.7e-27
WP_106888197.1|4329327_4329978_-	adenine methylase	NA	G9L699	Escherichia_phage	97.2	1.4e-125
WP_001341620.1|4329970_4330222_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_000675390.1|4330379_4330628_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_106888198.1|4330677_4331559_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.0	8.3e-158
WP_097499607.1|4331555_4332377_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.4	1.4e-159
WP_088375643.1|4332373_4332580_-	MarR family transcriptional regulator	NA	A0A173GC36	Salmonella_phage	84.0	3.3e-17
WP_001102257.1|4332576_4332876_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	100.0	3.4e-47
WP_023278010.1|4333184_4333769_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_001282459.1|4333923_4334154_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402895.1|4334304_4334505_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	100.0	2.1e-32
WP_106888199.1|4334520_4335312_+	primosomal protein	NA	Q286X4	Escherichia_phage	90.9	3.4e-118
WP_059278296.1|4335308_4336094_+	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	6.1e-152
WP_106888200.1|4336211_4336556_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	95.6	3.4e-59
WP_106888201.1|4336617_4337181_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	91.1	1.6e-50
WP_106888202.1|4337177_4337483_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	89.9	2.3e-43
WP_106888203.1|4337469_4338192_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	69.7	6.7e-81
WP_000403779.1|4338169_4338526_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	4.3e-57
WP_000063625.1|4338574_4338787_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_106888204.1|4338822_4339320_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	54.7	5.9e-36
WP_106888205.1|4339279_4339495_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	98.6	3.9e-37
WP_001142590.1|4339496_4339715_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000212746.1|4339716_4340004_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001124396.1|4341253_4341466_+	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_001090120.1|4341462_4342137_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_106888207.1|4342133_4343609_+|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.4	1.7e-296
WP_074554701.1|4343699_4344077_-	hypothetical protein	NA	Q716B1	Shigella_phage	78.9	1.1e-45
WP_000335899.1|4344779_4344986_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_016236151.1|4345000_4346680_+	hypothetical protein	NA	G9L6C2	Escherichia_phage	99.3	1.4e-302
WP_000133160.1|4346676_4346973_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
4346742:4346757	attR	GCGTGAAATTGATGAC	NA	NA	NA	NA
WP_001460331.1|4346975_4347671_+|protease	protease	protease	G9L6C4	Escherichia_phage	99.6	1.8e-94
WP_106888208.1|4347685_4348672_+	hypothetical protein	NA	A0A0F6TJQ9	Escherichia_coli_O157_typing_phage	99.7	7.3e-187
WP_088375652.1|4348723_4349161_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.9	5.0e-71
WP_033813652.1|4349171_4349507_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	1.7e-55
WP_021538095.1|4349881_4350487_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	4.7e-112
WP_106888209.1|4351913_4352039_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	96.0	6.0e-06
WP_106888210.1|4352004_4353218_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106888211.1|4354258_4354723_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.1	9.3e-84
WP_106888212.1|4354722_4355268_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	76.8	2.1e-66
WP_106888213.1|4355267_4357781_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	97.7	0.0e+00
WP_088375657.1|4357777_4359580_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.7	0.0e+00
WP_088375658.1|4359585_4362060_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	98.8	0.0e+00
WP_088375659.1|4362255_4362552_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	98.0	3.1e-48
WP_088375660.1|4362583_4362841_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	95.3	1.2e-40
WP_106888214.1|4365177_4366191_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_001275998.1|4366375_4366780_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_016046623.1|4366766_4367075_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	100.0	2.6e-50
WP_088375662.1|4367064_4367694_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	91.4	5.1e-109
WP_106888215.1|4367690_4368188_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	59.0	2.0e-39
WP_047087546.1|4368385_4368925_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	92.2	1.7e-41
WP_047087545.1|4368940_4369453_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	98.2	1.2e-60
WP_106888098.1|4369586_4370860_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_001344399.1|4371102_4371276_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 274
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4377710	4381711	5196105		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028614.1|4377710_4378349_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001295474.1|4378348_4379386_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|4379709_4380336_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198328.1|4380421_4381711_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
>prophage 275
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4402951	4403665	5196105		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|4402951_4403665_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 276
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4421694	4422645	5196105		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|4421694_4422645_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 277
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4441398	4444974	5196105		Deep-sea_thermophilic_phage(50.0%)	5	NA	NA
WP_000102891.1|4441398_4442268_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
WP_000406000.1|4442481_4442907_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_001399260.1|4442893_4443343_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838944.1|4443403_4443979_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_032206156.1|4444074_4444974_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	3.5e-26
>prophage 278
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4453478	4465172	5196105		Streptococcus_phage(40.0%)	11	NA	NA
WP_047087505.1|4453478_4454576_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	5.5e-26
WP_001295461.1|4454709_4455621_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000719925.1|4455623_4455992_-	YfeK family protein	NA	NA	NA	NA	NA
WP_023063126.1|4456096_4456948_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522247.1|4456989_4457499_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|4457539_4459267_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|4459311_4459569_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|4459952_4460924_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254837.1|4461108_4461870_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_047087512.1|4462099_4463086_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|4463156_4465172_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 279
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4486697	4493485	5196105	transposase	Clostridioides_phage(25.0%)	7	NA	NA
WP_001295458.1|4486697_4487432_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_032206128.1|4487446_4489144_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_106888077.1|4489482_4490695_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106377255.1|4490661_4490916_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.5e-06
WP_032205894.1|4490834_4492073_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|4492137_4492209_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484406.1|4492564_4493485_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	55.2	1.3e-76
>prophage 280
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4497181	4498876	5196105		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001283490.1|4497181_4498876_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 281
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4511398	4512832	5196105		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|4511398_4512832_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 282
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4516223	4517156	5196105		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001455129.1|4516223_4517156_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	4.6e-167
>prophage 283
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4535241	4536327	5196105		Pandoravirus(100.0%)	1	NA	NA
WP_047087735.1|4535241_4536327_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.1	1.6e-89
>prophage 284
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4544894	4546031	5196105		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|4544894_4546031_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 285
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4552507	4554025	5196105		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|4552507_4554025_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 286
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4558236	4560097	5196105		Planktothrix_phage(50.0%)	2	NA	NA
WP_032205878.1|4558236_4559010_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	37.2	6.8e-23
WP_032205876.1|4559206_4560097_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.6	9.8e-66
>prophage 287
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4570656	4573884	5196105		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|4570656_4571307_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_032205873.1|4571393_4573226_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813862.1|4573284_4573884_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
>prophage 288
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4608304	4613306	5196105		Tupanvirus(50.0%)	4	NA	NA
WP_047087743.1|4608304_4610287_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
WP_000461657.1|4610286_4611255_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_032205898.1|4611258_4612398_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.5	3.2e-29
WP_001297077.1|4612703_4613306_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 289
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4616909	4621225	5196105	transposase	Oenococcus_phage(50.0%)	4	NA	NA
WP_047087749.1|4616909_4618115_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
WP_001295288.1|4618171_4619461_+	MFS transporter	NA	NA	NA	NA	NA
WP_000992988.1|4619478_4620282_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_000140587.1|4620322_4621225_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.2	1.1e-69
>prophage 290
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4627118	4633097	5196105		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000779091.1|4627118_4628195_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_032205856.1|4628657_4629308_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|4629361_4629616_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|4629615_4630746_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|4630811_4633097_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
>prophage 291
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4638512	4641140	5196105		Bacillus_virus(100.0%)	1	NA	NA
WP_106888216.1|4638512_4641140_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	2.1e-92
>prophage 292
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4650839	4653689	5196105		Hokovirus(100.0%)	1	NA	NA
WP_032205852.1|4650839_4653689_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 293
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4657852	4663630	5196105		Enterobacteria_phage(33.33%)	5	NA	NA
WP_000865577.1|4657852_4658956_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	1.4e-117
WP_032205848.1|4659067_4660123_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_032205847.1|4660196_4661261_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	51.5	1.4e-18
WP_000884916.1|4661260_4661911_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_000422188.1|4661986_4663630_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
>prophage 294
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4672397	4673015	5196105		Bacillus_virus(100.0%)	1	NA	NA
WP_032205896.1|4672397_4673015_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 295
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4681371	4682644	5196105	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085972493.1|4681371_4682644_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 296
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4686048	4693696	5196105		Vibrio_phage(50.0%)	7	NA	NA
WP_000050789.1|4686048_4687056_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_000494183.1|4687194_4687479_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|4687603_4689364_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234850.1|4689512_4690208_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213361.1|4690235_4691426_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_000202798.1|4691758_4692103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047088167.1|4692106_4693696_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
>prophage 297
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4699450	4703751	5196105		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|4699450_4700017_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_000594599.1|4700428_4701142_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_047088160.1|4701180_4702167_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_032206295.1|4702284_4703751_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.2	1.7e-43
>prophage 298
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4718180	4719038	5196105		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|4718180_4719038_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 299
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4723111	4725103	5196105		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000489244.1|4723111_4725103_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 300
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4730453	4731122	5196105		Cellulophaga_phage(100.0%)	1	NA	NA
WP_001139613.1|4730453_4731122_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 301
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4734816	4736337	5196105		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|4734816_4736337_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 302
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4742344	4781492	5196105	lysis,transposase,tail,tRNA	Enterobacteria_phage(50.0%)	40	NA	NA
WP_000968208.1|4742344_4743040_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_032206274.1|4743036_4743435_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_032206306.1|4743673_4744624_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000691708.1|4745011_4745095_-	protein YohP	NA	NA	NA	NA	NA
WP_032206273.1|4745318_4746755_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079520.1|4746807_4747569_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001307896.1|4747698_4748277_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|4748446_4749034_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_047088140.1|4749207_4750140_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_047088138.1|4750178_4751894_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_032206270.1|4752089_4754387_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001130307.1|4754597_4755515_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_032206269.1|4755521_4756679_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_032206267.1|4756671_4757598_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G9BWD6	Planktothrix_phage	34.6	9.7e-24
WP_032206266.1|4757602_4758334_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4758314_4758422_-	protein YohO	NA	NA	NA	NA	NA
WP_029208472.1|4758481_4759183_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.9e-102
WP_085972493.1|4759741_4761014_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
WP_106888219.1|4761051_4762265_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	9.3e-168
WP_064756364.1|4762302_4762800_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	5.4e-90
WP_001254257.1|4762796_4762979_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_032208534.1|4762975_4763146_+	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	1.6e-25
WP_001028854.1|4763746_4764412_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|4764623_4765583_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|4765918_4766041_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|4766055_4766745_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_122998106.1|4766928_4767672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4767757_4767916_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_153244796.1|4768108_4768252_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	97.4	3.7e-15
WP_106888220.1|4768349_4769505_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.3e-67
WP_032207041.1|4770218_4770680_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	9.2e-76
WP_032207043.1|4770719_4771190_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	1.1e-81
WP_000598641.1|4771236_4771956_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_106888221.1|4771952_4773638_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_032207044.1|4774152_4774401_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	82.9	3.4e-32
WP_001121225.1|4774995_4775646_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491544.1|4775870_4776746_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	97.9	9.7e-159
WP_047087983.1|4776885_4777155_-|tail	phage tail protein	tail	Q6H9S8	Enterobacteria_phage	95.5	1.6e-43
WP_106888222.1|4777679_4778836_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
WP_001292764.1|4780355_4781492_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 303
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4793125	4795159	5196105	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|4793125_4795159_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 304
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4805783	4809340	5196105		Paenibacillus_phage(50.0%)	4	NA	NA
WP_001300994.1|4805783_4806602_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.9e-24
WP_000434038.1|4806653_4807400_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011997.1|4807373_4808339_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846222.1|4808335_4809340_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
>prophage 305
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4818561	4825429	5196105	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000807356.1|4818561_4819461_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_001318299.1|4819866_4820184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476011.1|4820513_4821875_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_032358811.1|4821977_4822274_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000124651.1|4822275_4822527_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|4822783_4823116_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137861.1|4823306_4824029_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_047087776.1|4824025_4825429_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.6e-33
>prophage 306
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4839274	4840627	5196105		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469709.1|4839274_4840627_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	4.1e-07
>prophage 307
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4845352	4855743	5196105		Catovirus(20.0%)	8	NA	NA
WP_001295424.1|4845352_4845994_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|4846085_4846667_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252331.1|4846688_4848542_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454701.1|4848815_4850399_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|4851057_4852197_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482901.1|4852202_4852646_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_047087782.1|4852648_4854811_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|4854903_4855743_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
>prophage 308
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4859986	4866780	5196105		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|4859986_4861108_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_047087785.1|4861110_4862076_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	5.8e-88
WP_001342585.1|4862078_4862558_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699772.1|4862554_4863778_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079246.1|4863780_4865217_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001325602.1|4865409_4866780_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
>prophage 309
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4872493	4874956	5196105		Klebsiella_phage(50.0%)	2	NA	NA
WP_047087787.1|4872493_4873888_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_047087788.1|4874062_4874956_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
>prophage 310
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4880721	4888525	5196105		Catovirus(25.0%)	7	NA	NA
WP_040091431.1|4880721_4881756_+	UDP-N-acetylglucosamine 4,6-dehydratase/5-epimerase	NA	A0A1V0SAI8	Catovirus	34.1	5.3e-39
WP_040091433.1|4881757_4882864_+	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_040091434.1|4882860_4883991_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	49.6	1.1e-101
WP_040091436.1|4883990_4885199_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_040091437.1|4885189_4885597_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_047087793.1|4885706_4887113_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	8.0e-38
WP_047087794.1|4887358_4888525_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.7	1.7e-110
>prophage 311
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4895878	4896778	5196105		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131756.1|4895878_4896778_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	7.0e-11
>prophage 312
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4904410	4905577	5196105		Stx2-converting_phage(100.0%)	1	NA	NA
WP_032206763.1|4904410_4905577_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	2.5e-226
>prophage 313
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4923052	4923862	5196105		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_047087799.1|4923052_4923862_+	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	27.9	3.1e-10
>prophage 314
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	4948033	5006130	5196105	capsid,integrase,terminase,head,lysis,transposase,tail,holin	Enterobacteria_phage(31.58%)	46	4938675:4938734	4950550:4951858
4938675:4938734	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_000533619.1|4948033_4949059_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_000096346.1|4949058_4949262_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047088169.1|4952104_4952365_+	hypothetical protein	NA	NA	NA	NA	NA
4950550:4951858	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTTCCAGCAATCGTCGATTGTTATACCAGTCCCCCCACGTGAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCCGCCATCGCGTTGTCATACGAGTCGCCTGTACTTCCTGTTGATGCCAGTAATCCGGCTTCCTTAAGCCGCTGTGTGTAGGCCAGCGATACATACTGAGAACCTTTATCACTGTGATGGACCGTGCCGGACGGTCGACGGGCCCATAACGCCTGCTCCAGTGCATCCAGCACGAATGTCGTCTCCATGGACGGTGAGACCCGCCACCCCACAATGTATCCGGCAAACACATCAATGATGAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCATAACCGCCATGAGACGTGCCACAGTGCATCTGGCCACTCTGATACCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTATACCTTGTGATTTTCATCGTATACGCGCTGTATCTCTTTCTTCAGCCAGTCATCGCGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAGTGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATAGCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGCTCCAGCTCTTTCAGACGCTGACGTTCAGCGGTGGTGAGCCCTCCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGAGCAATGGAACAAATTGCCGCCCATTGTGAGTCATATTCGCCCTGACTTTCCAGAACCATACGAACTGCCCGTTGACGGACTTCAGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCA	NA	NA	NA	NA
WP_047088170.1|4952431_4952710_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	1.1e-10
WP_047088173.1|4952711_4953728_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.9	5.2e-87
WP_047088175.1|4953769_4954135_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.6	4.3e-36
WP_047088177.1|4954143_4954557_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	50.3	2.4e-38
WP_000917749.1|4954780_4954978_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_001344632.1|4957056_4957188_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	85.7	5.2e-08
WP_000411811.1|4959925_4960132_+|holin	holin	holin	O48430	Enterobacteria_phage	100.0	1.8e-31
WP_000731236.1|4960136_4960481_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_047087679.1|4960531_4961065_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	1.6e-100
WP_106888225.1|4961362_4961857_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	99.4	3.8e-83
WP_000736096.1|4961853_4962078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888079.1|4962605_4963878_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	2.2e-175
WP_032207766.1|4964051_4964417_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.3e-64
WP_106888226.1|4964704_4965268_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	78.7	4.0e-57
WP_047087924.1|4966989_4968927_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.4	0.0e+00
WP_001063096.1|4968971_4969193_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|4971718_4972045_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|4972054_4972405_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|4972401_4972848_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_106888227.1|4972844_4973150_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.0	1.1e-48
WP_097746533.1|4973190_4974347_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_106888228.1|4974522_4975239_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_001030063.1|4975244_4975619_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|4975714_4975924_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000807944.1|4979230_4979572_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	98.2	1.2e-61
WP_032208657.1|4979571_4980270_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	1.8e-131
WP_047088117.1|4980275_4981019_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	1.2e-144
WP_122993101.1|4980964_4981597_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	7.6e-105
WP_000649829.1|4981787_4982315_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_106888230.1|4982448_4985928_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	94.5	0.0e+00
WP_001230496.1|4985994_4986594_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_158707840.1|4986658_4988233_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.5	1.4e-62
WP_115801847.1|4988339_4988429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047088098.1|4988448_4990797_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_000938111.1|4995165_4996527_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_106888077.1|4997173_4998387_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.4e-168
WP_106918805.1|4998915_4999116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001230532.1|4999183_4999783_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_001023455.1|5001151_5001421_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_071887496.1|5001546_5002278_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_106888232.1|5002602_5003256_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_072057402.1|5004391_5004850_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	99.1	4.0e-55
WP_085972493.1|5004856_5006130_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
>prophage 315
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5009802	5022272	5196105		Bacillus_phage(28.57%)	12	NA	NA
WP_001339045.1|5009802_5010474_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_047088123.1|5010473_5011832_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.1	3.9e-05
WP_000218207.1|5011939_5012791_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_047088125.1|5013382_5014546_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	7.2e-109
WP_074433652.1|5015110_5015476_+	permease	NA	NA	NA	NA	NA
WP_000365561.1|5015515_5016211_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001157239.1|5016277_5017696_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786005.1|5017676_5018147_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_106888233.1|5018135_5019056_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|5019228_5020146_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|5020224_5020407_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_077790987.1|5020577_5022272_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
>prophage 316
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5036125	5036794	5196105		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334601.1|5036125_5036794_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	7.3e-82
>prophage 317
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5048456	5049209	5196105		Planktothrix_phage(100.0%)	1	NA	NA
WP_001272994.1|5048456_5049209_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G9BWD6	Planktothrix_phage	41.4	6.0e-32
>prophage 318
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5055461	5092309	5196105	capsid,terminase,head,transposase,tail,plate,portal,holin	Enterobacteria_phage(85.71%)	46	NA	NA
WP_000078920.1|5055461_5055602_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_106888220.1|5055907_5057063_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	2.3e-67
WP_050439343.1|5057060_5057321_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_086218746.1|5057363_5058092_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.1	9.0e-126
WP_106888234.1|5058098_5058473_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.4	1.5e-63
WP_032206883.1|5058630_5059815_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.7	1.1e-221
WP_000290443.1|5059814_5060327_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	98.8	2.7e-92
WP_000665305.1|5060381_5060747_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	96.7	1.4e-55
WP_001391627.1|5060782_5060911_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	95.2	1.5e-15
WP_106888219.1|5062342_5063556_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	9.3e-168
WP_000979946.1|5065030_5065519_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	8.8e-85
WP_000954200.1|5065675_5066248_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_032206512.1|5066291_5066870_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.5	7.7e-96
WP_106888235.1|5066869_5068873_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.6	9.2e-96
WP_047087591.1|5069470_5070367_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	1.3e-153
WP_000127182.1|5070370_5070721_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	98.3	7.8e-59
WP_047087590.1|5070717_5071299_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	1.8e-100
WP_000356339.1|5071295_5071931_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001342220.1|5071923_5072391_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000780555.1|5074431_5074839_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_047087588.1|5074835_5075228_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	97.7	1.9e-69
WP_001342221.1|5075224_5075548_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|5075550_5075751_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|5075750_5076245_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632313.1|5076346_5077147_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.5	6.9e-127
WP_001262679.1|5078269_5079106_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	5.1e-149
WP_106888236.1|5079260_5079809_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.0	3.2e-91
WP_106888078.1|5079805_5080962_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	4.7e-68
WP_106888237.1|5080977_5082279_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	7.0e-230
WP_032206507.1|5082278_5083325_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	1.9e-201
WP_000236495.1|5083339_5083864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224220.1|5084450_5084714_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_032206504.1|5084715_5085135_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	42.6	4.2e-19
WP_000211293.1|5085154_5085469_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	51.9	3.5e-18
WP_000686557.1|5085473_5086433_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	8.4e-180
WP_047087694.1|5086509_5089332_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.9	0.0e+00
WP_106888238.1|5089338_5089704_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	94.2	1.5e-57
WP_000153684.1|5089845_5090091_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000985145.1|5090087_5090291_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.3e-26
WP_000021668.1|5090377_5090491_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000514281.1|5090487_5090730_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	4.4e-37
WP_047087695.1|5090741_5091020_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	82.6	1.3e-35
WP_000739029.1|5091030_5091381_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|5091402_5091606_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|5091677_5091815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|5091904_5092309_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
>prophage 319
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5101264	5102779	5196105		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187810.1|5101264_5102779_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 320
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5112867	5118511	5196105		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_047087697.1|5112867_5114529_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_047087698.1|5114574_5116176_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	9.9e-16
WP_000204335.1|5116194_5117055_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|5117057_5118107_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|5118121_5118511_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 321
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5123763	5125497	5196105	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025342.1|5123763_5125497_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 322
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5132113	5134164	5196105		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019588.1|5132113_5132857_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|5132897_5133293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060503959.1|5133345_5134164_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	3.2e-71
>prophage 323
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5138182	5145249	5196105		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|5138182_5138704_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024929.1|5138705_5139308_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072095795.1|5139379_5139445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047087366.1|5139583_5140195_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|5140203_5141214_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_032207795.1|5141362_5142148_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|5142144_5142900_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_032207954.1|5142978_5143911_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|5143926_5145249_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 324
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5149248	5150724	5196105		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|5149248_5150724_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 325
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5158780	5163249	5196105		Klebsiella_phage(33.33%)	6	NA	NA
WP_000944256.1|5158780_5159443_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011652.1|5159466_5160123_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|5160224_5160455_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168747.1|5160593_5160968_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000976472.1|5161855_5162197_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|5162592_5163249_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 326
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5170743	5172792	5196105		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|5170743_5172792_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 327
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5178103	5178313	5196105		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|5178103_5178313_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 328
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5183953	5185510	5196105		Moraxella_phage(100.0%)	1	NA	NA
WP_000394986.1|5183953_5185510_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 329
NZ_CP027445	Escherichia coli strain 2013C-3492 chromosome, complete genome	5196105	5189370	5194211	5196105		Pandoravirus(50.0%)	4	NA	NA
WP_032207815.1|5189370_5190732_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.5e-41
WP_000457334.1|5190805_5190985_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001295493.1|5191824_5192169_-	RidA family protein	NA	NA	NA	NA	NA
WP_047087362.1|5192300_5194211_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	5.9e-92
