The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	12603	126368	5802748	portal,integrase,holin,protease,transposase,head,terminase,tail,lysis	Enterobacteria_phage(35.71%)	118	21594:21612	95817:95835
WP_000140570.1|12603_13506_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_001000358.1|13699_14890_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_001209920.1|14886_16146_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_000857257.1|16135_17764_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_000948732.1|18036_19395_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_000779084.1|19399_20476_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301050.1|20938_21589_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
21594:21612	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000135040.1|21642_21897_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|21896_23027_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|23115_25401_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001341569.1|26096_29831_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.5	2.0e-19
WP_000990754.1|29958_30681_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281242.1|30827_33455_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000012302.1|33603_35292_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001215756.1|35288_35894_+	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000533670.1|35908_36979_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001444001.1|36956_37175_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_001281192.1|37280_37625_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_000457736.1|37743_37986_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001345188.1|38060_38411_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_001289868.1|38407_39013_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_000763358.1|39009_39231_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001444000.1|39329_39611_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|39621_39813_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|39785_39968_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|39967_40645_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|40641_41427_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|41432_41729_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372926.1|41783_41948_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_001198860.1|41916_42081_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065385.1|42153_42522_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_000167595.1|42671_43142_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000930321.1|43275_43614_-	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000256573.1|43616_43922_-	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_001095982.1|44236_44887_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000276885.1|44967_45153_+	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_000035947.1|45262_45559_+	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000185462.1|45591_46530_+	replication protein	NA	C1JJ53	Enterobacteria_phage	99.4	1.1e-171
WP_000788878.1|46526_47228_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000145926.1|47224_47515_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000229807.1|47587_47794_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000810176.1|47801_48248_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000153270.1|48244_48772_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|48768_48951_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001429269.1|49454_51290_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|51789_52356_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223927.1|52330_52933_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001028854.1|52929_53595_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235460.1|53591_54215_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001302581.1|54467_55211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|55296_55455_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|55535_55934_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|56076_56292_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075153.1|56291_56789_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_001228695.1|57005_57188_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|57278_57572_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|57931_58126_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000235436.1|58520_59030_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_024262528.1|59001_60711_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.3	4.9e-239
WP_001238637.1|60723_60930_+|terminase	terminase	terminase	A0A2I6TC92	Escherichia_phage	59.4	1.1e-12
WP_000258991.1|60913_61120_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000827572.1|61116_62709_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	8.4e-185
WP_001254039.1|62698_64204_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256849.1|64240_64588_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_000522643.1|64645_65530_+	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000201528.1|65581_65956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|65948_66302_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|66316_66892_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|66888_67284_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|67291_68044_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|68057_68489_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533403.1|68515_68929_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082375.1|68909_71471_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000847413.1|71467_71797_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_001152619.1|71796_72495_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_012817801.1|72500_73244_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	5.2e-145
WP_000090884.1|73180_73813_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_106910072.1|73873_77173_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	95.2	0.0e+00
WP_000839165.1|77201_77606_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000612626.1|77602_77950_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|77998_79537_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001230644.1|79599_79815_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	95.8	2.9e-32
WP_106910073.1|79882_80482_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.4	1.0e-98
WP_106910074.1|80546_81860_+|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.0	3.7e-77
WP_001023380.1|81861_82131_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_001448330.1|82340_82988_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001025664.1|83681_85004_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001676637.1|85805_90200_+	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001104541.1|90200_91850_+	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001225855.1|91854_92631_+	YfaP family protein	NA	NA	NA	NA	NA
WP_000876007.1|92905_95755_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.0	1.7e-42
WP_001061917.1|95840_96491_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
95817:95835	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
WP_001249127.1|96507_99180_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_000865576.1|99918_101010_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_000406116.1|101121_102177_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000786386.1|102250_103315_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884922.1|103314_103965_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422231.1|104040_105684_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000758074.1|105901_107548_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000849214.1|107696_108185_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686723.1|108593_109088_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557378.1|109077_109341_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778069.1|109337_111824_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091291.1|111830_112526_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013509.1|112512_113376_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835177.1|113372_113822_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|113831_114434_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|114452_115070_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971723.1|115066_115729_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001295447.1|115770_116508_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|116504_116714_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|116710_117190_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982426.1|117186_119130_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|119126_119684_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211567.1|119680_120733_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113637.1|120767_121415_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000624042.1|124793_125717_-	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001229487.1|125879_126368_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
>prophage 2
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	205077	215005	5802748	transposase	Enterobacteria_phage(62.5%)	9	NA	NA
WP_001240401.1|205077_205809_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|206030_207716_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|207712_208432_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950404.1|208478_208949_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000998019.1|209380_210766_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|210815_211163_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|211159_211540_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001342301.1|211871_213872_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001292774.1|213868_215005_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 3
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	306446	312748	5802748		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001116073.1|306446_307841_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
WP_000183038.1|308015_308909_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_000699427.1|309280_310366_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_001023633.1|310365_311265_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	5.7e-29
WP_000857547.1|311322_312201_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.5e-106
WP_001100797.1|312205_312748_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	1.9e-51
>prophage 4
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	346384	355414	5802748	transposase	Stx2-converting_phage(42.86%)	12	NA	NA
WP_000692323.1|346384_346606_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186725.1|346674_347151_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849582.1|347166_347652_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.6e-12
WP_001234620.1|347706_348525_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_001119729.1|348624_348858_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000378676.1|348936_349368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839179.1|349366_349771_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|349767_350115_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099148.1|350163_351702_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.6	3.3e-295
WP_085948191.1|351617_351854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106910077.1|351929_354191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|354258_355414_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 5
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	472728	508890	5802748	plate,portal,capsid,integrase,holin,head,terminase,tail	Enterobacteria_phage(87.18%)	46	471666:471725	508997:509117
471666:471725	attL	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGA	NA	NA	NA	NA
WP_000078921.1|472728_472869_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
WP_000488107.1|473059_473320_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001317900.1|473606_474746_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000132847.1|475145_476246_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_000005439.1|476403_477588_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000290450.1|477587_478100_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|478154_478520_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|478555_478684_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000853455.1|478670_481478_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000979950.1|481490_481979_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000954196.1|482135_482708_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000144010.1|482751_483330_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000108514.1|483329_485462_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000071738.1|485464_485995_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111967.1|485987_486884_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000213447.1|486887_487238_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271909.1|487234_487816_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000356339.1|487812_488448_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001342220.1|488440_488908_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_000202151.1|488931_490809_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_000780555.1|490947_491355_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000072343.1|491351_491744_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_001342221.1|491740_492064_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864911.1|492066_492267_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_000063100.1|492266_492761_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632311.1|492862_493663_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_001055094.1|493708_494761_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_001262641.1|494784_495621_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_000613774.1|495775_497527_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000087812.1|497526_498573_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001289969.1|499062_499653_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000211289.1|499716_500028_-	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|500032_500992_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_001272083.1|501068_503909_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000564224.1|503905_504295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000985152.1|504618_504822_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000021647.1|504908_505022_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	2.4e-09
WP_000357025.1|505018_505261_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158976.1|505272_505551_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000742491.1|505561_505912_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000014504.1|505933_506137_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|506208_506346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|506435_506840_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_000290352.1|506855_507506_+	membrane protein	NA	NA	NA	NA	NA
WP_000865208.1|507535_507883_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001342226.1|507888_508890_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
508997:509117	attR	TTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	592924	678323	5802748	portal,capsid,integrase,holin,protease,transposase,head,tRNA,terminase,tail,lysis	Escherichia_phage(30.77%)	99	585195:585209	607215:607229
585195:585209	attL	TCCGGCGCTTCAGGT	NA	NA	NA	NA
WP_000916763.1|592924_593155_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|593293_593668_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|593671_594544_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|594556_594898_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189092.1|595250_596366_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.1	9.4e-98
WP_001443927.1|596331_596613_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|596719_596908_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|596900_597095_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_094185360.1|597602_598759_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
WP_000105101.1|599220_601872_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001307773.1|601970_602246_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_001427414.1|602319_602490_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_000560218.1|602489_602711_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427316.1|603131_603284_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_001448501.1|603570_603849_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|603850_604042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169687.1|604062_604434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|604531_604834_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|604830_605256_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001444941.1|605278_606241_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000450872.1|607014_607776_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
607215:607229	attR	ACCTGAAGCGCCGGA	NA	NA	NA	NA
WP_000603384.1|607808_608090_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|608086_608314_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|608306_608618_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|608745_608964_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|608965_609523_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|609756_609969_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|610088_610433_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|610554_610827_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|610828_611878_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217413.1|611890_612265_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|612261_613083_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143049.1|614253_616104_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|616551_616758_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|616757_617255_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|617251_617689_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|617838_618456_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|618643_618838_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|619226_619772_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|619746_621672_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|621668_621875_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|621871_623473_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123251.1|623453_624773_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|624782_625115_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|625170_626196_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|626237_626633_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|626644_626998_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975096.1|627009_627588_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683137.1|627584_627980_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235098.1|627987_628740_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	4.9e-135
WP_000479045.1|628753_629176_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533440.1|629202_629616_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081762.1|629596_632209_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	91.9	0.0e+00
WP_000847298.1|632205_632535_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001357740.1|632534_633233_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194723.1|633243_633987_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_050439450.1|633932_634565_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_106910081.1|634907_638303_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	83.4	0.0e+00
WP_000839165.1|638441_638846_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.5e-69
WP_000612626.1|638842_639190_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|639238_640777_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001230428.1|640832_641432_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_000268926.1|641496_642810_+|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001023379.1|642811_643081_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_000491545.1|643221_644097_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001121225.1|644321_644972_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000812724.1|645926_646583_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|646583_646775_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|646879_647116_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057024.1|647233_648673_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|648752_651386_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|651354_652638_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|652767_653265_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431370.1|653361_654060_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001431407.1|654079_656128_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.4e-86
WP_000984517.1|656319_657201_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127210.1|657246_658620_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|658796_659588_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|659730_659970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|660128_660272_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006866.1|660346_660634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295496.1|661302_661446_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|661458_661668_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010107.1|661833_662643_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|662639_663206_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156255.1|663634_664093_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|664147_664999_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|665011_665812_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150551.1|665874_666846_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000394983.1|667308_668865_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
WP_106910082.1|668868_670467_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|670597_671962_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|672145_672724_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|672727_674089_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|674162_674342_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|674461_674821_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|675183_675528_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|675659_677570_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001221003.1|677627_678323_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	844645	1104561	5802748	portal,capsid,integrase,holin,protease,transposase,head,tRNA,terminase,tail,lysis	Enterobacteria_phage(31.43%)	291	927745:927775	1103258:1103288
WP_001295400.1|844645_845920_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_000789751.1|845981_846842_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|846885_847491_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100931.1|847596_849099_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030346.1|849709_850345_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|850344_851040_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920784.1|851043_851664_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231922.1|851667_852726_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915761.1|852726_854949_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991805.1|854941_855520_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133188.1|855519_856101_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214176.1|856177_856618_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|856703_856919_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001300888.1|857191_857317_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|857559_858600_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567490.1|858634_859636_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459381.1|859739_860912_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125607.1|860921_862514_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179510.1|862688_863717_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|863828_864596_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_001342191.1|864816_865407_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032346125.1|865795_867607_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
WP_001075858.1|867603_868977_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001227023.1|869015_870281_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043314.1|870325_871834_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170683.1|871934_873110_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066628.1|873308_874955_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_001099107.1|875097_876501_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000135186.1|876497_877427_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732497.1|877502_878804_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
WP_001092519.1|878807_879527_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|879655_879991_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000513673.1|879987_880710_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|880746_882129_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|882314_883259_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295398.1|883782_885315_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|885325_886714_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085277.1|887820_889050_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
WP_000953271.1|889423_889612_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_001496008.1|889664_890591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|890523_890814_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001113154.1|890806_891127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261490.1|891133_891433_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000710169.1|891429_893247_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	48.3	7.5e-129
WP_000125509.1|893534_893780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126691.1|893776_894187_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233310.1|894197_894470_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|894595_894820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|895111_896269_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504055.1|896308_896881_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001398592.1|896918_898094_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_001020674.1|898090_898429_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000134113.1|898425_898722_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|898721_899162_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000113645.1|899451_899808_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127891.1|899791_901453_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000133423.1|901466_901748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303517.1|902784_902955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|903061_903427_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|903413_903743_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260840.1|903781_904603_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|904702_904786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|904878_905214_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|905610_906864_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019545.1|906970_907864_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|907998_909219_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|909343_910039_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|909991_911284_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|911442_912057_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|912099_912954_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|912955_913573_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342196.1|913583_916007_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_001307224.1|918691_918997_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|919104_919815_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138576.1|919817_920378_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|920412_920754_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|920888_921215_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|921420_922635_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|922646_923666_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001360138.1|923723_923834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877011.1|923853_925134_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	4.3e-155
WP_001339397.1|925388_926066_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|926065_926413_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|926432_928004_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
927745:927775	attL	ATGGCTGGGTGGAAATCGACAACAACATCGC	NA	NA	NA	NA
WP_000048369.1|928199_930671_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|930764_930956_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|930952_931141_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000347171.1|931627_932203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|932204_932360_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|932552_932960_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|933037_933265_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705349.1|933248_933770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054507.1|933750_934716_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	6.5e-55
WP_001151195.1|934756_935176_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.3e-55
WP_000589012.1|935209_936550_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001317460.1|936986_937319_-	protein flxA	NA	NA	NA	NA	NA
WP_001326990.1|937521_937827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|937851_938091_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|938090_938378_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|938449_938605_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|938821_939073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|939139_939418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|939419_940469_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047133.1|940482_941235_+	antitermination protein	NA	Q8SBE4	Shigella_phage	94.8	1.3e-130
WP_120795389.1|941512_941602_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|941656_941869_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066483.1|942169_942385_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	4.5e-25
WP_000839590.1|943138_943354_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189915.1|943358_943670_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|943666_944200_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_032346345.1|944196_944694_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	3.7e-06
WP_000066495.1|945056_945269_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|945279_945468_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|945470_945536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|945615_945771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|945942_946116_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000035577.1|946267_946678_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031435.1|946978_947185_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	3.9e-26
WP_000421825.1|947745_948285_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507036.1|948293_950393_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_001072975.1|950389_950602_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985929.1|950601_952110_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.6	4.5e-289
WP_001136588.1|952054_954082_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_001097041.1|954168_954492_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	98.1	5.5e-51
WP_001283148.1|954484_954760_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677128.1|954771_955350_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	98.4	3.0e-100
WP_001079398.1|955346_955748_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211132.1|955758_956502_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|956562_956949_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|956957_957287_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372024.1|957258_960324_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447251.1|960323_960653_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	3.0e-60
WP_001152371.1|960662_961361_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	1.9e-133
WP_000140707.1|961365_962109_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.9	1.8e-145
WP_000741589.1|962006_962654_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000515505.1|962714_966128_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001233114.1|966198_966798_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_106910116.1|966862_969823_+	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	54.0	4.4e-54
WP_000885616.1|969822_970398_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|970495_971086_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|971402_971636_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|971704_971818_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001206147.1|972466_973762_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.2	1.3e-154
WP_001368608.1|973781_974018_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_106910084.1|974105_976568_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	4.0e-125
WP_000199475.1|976660_976849_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|976845_977034_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|977598_977808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|977808_978447_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380321.1|978458_978611_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_000379972.1|978777_979185_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000920571.1|979268_979499_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000705368.1|979482_980004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|979984_980950_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790460.1|980956_981697_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000450895.1|981726_982488_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000215512.1|982547_982733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211993.1|983084_983636_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000882662.1|983850_984063_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|984165_984483_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|984475_984847_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|985070_985298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817785.1|985351_985621_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001375683.1|985622_986672_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_001047111.1|986685_987438_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_000735807.1|988282_988507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498121.1|988559_988769_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_001299632.1|988958_989390_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000023191.1|989868_991719_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411809.1|992166_992373_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_001041949.1|992376_993168_+	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000992045.1|993679_994213_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.6	8.1e-100
WP_001208680.1|994764_994950_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|995477_995792_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001431375.1|995873_996098_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	5.9e-20
WP_000867498.1|996484_997030_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|997004_998930_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|998926_999133_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000123254.1|1000707_1002027_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1002036_1002369_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000683137.1|1004840_1005236_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1005243_1005996_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479045.1|1006009_1006432_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000533442.1|1006458_1006872_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081792.1|1006852_1009465_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.0	0.0e+00
WP_000847298.1|1009461_1009791_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001448659.1|1009790_1010489_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	3.4e-130
WP_064551617.1|1010499_1011243_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	1.6e-149
WP_122993786.1|1011188_1011821_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	3.4e-105
WP_106910085.1|1012066_1015543_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	97.8	0.0e+00
WP_001216290.1|1015611_1016235_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000268933.1|1016299_1017613_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	4.8e-77
WP_001023445.1|1017614_1017884_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_012817749.1|1018008_1018761_-	type III effector	NA	NA	NA	NA	NA
WP_077630526.1|1019564_1020191_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.0	8.2e-59
WP_085947969.1|1020266_1021479_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_001232849.1|1021519_1021780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273151.1|1021874_1022117_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000048499.1|1022184_1024635_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|1024729_1024918_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1024914_1025103_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|1025503_1025668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|1025671_1025890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|1025982_1026183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|1026596_1026899_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|1026901_1027261_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|1027307_1027700_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|1027826_1028087_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|1028083_1028521_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|1028607_1029618_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|1029529_1030072_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|1030105_1030831_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|1030846_1031239_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|1031235_1031532_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|1031528_1031990_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|1031967_1032324_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|1032374_1032587_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|1032620_1032803_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|1032968_1033604_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|1033691_1033910_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229304.1|1033911_1034277_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.5e-68
WP_000206830.1|1034273_1034618_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_000220601.1|1034822_1035122_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|1035127_1035385_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|1035520_1035793_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_106910086.1|1035794_1036841_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.1e-108
WP_000904103.1|1036853_1037213_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|1037221_1037752_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|1037993_1038191_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|1038325_1039039_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|1039488_1039920_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000023293.1|1040397_1042335_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.9	0.0e+00
WP_000143463.1|1042470_1042650_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|1042690_1042936_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|1043013_1043229_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|1043233_1043767_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056882.1|1044041_1044611_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	98.9	3.4e-104
WP_000455402.1|1044610_1044760_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|1044987_1045173_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|1045698_1046013_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|1046094_1046319_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_106910087.1|1046360_1046726_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	2.0e-65
WP_000958402.1|1047017_1047581_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|1047577_1049239_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173033.1|1049302_1051240_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|1051284_1051506_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1054032_1054359_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1054369_1054720_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1054716_1055163_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1055159_1055504_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275459.1|1055569_1056286_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030060.1|1056291_1056666_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1056761_1056971_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_106910088.1|1057018_1060261_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.9	0.0e+00
WP_000807940.1|1060253_1060595_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_106910089.1|1060594_1061293_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	98.7	1.8e-131
WP_001302649.1|1061309_1061630_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1061737_1061911_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001432327.1|1061981_1062905_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	98.0	6.6e-174
WP_001375566.1|1062959_1063697_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.8	7.2e-147
WP_122993786.1|1063642_1064275_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	3.4e-105
WP_032363152.1|1064520_1067997_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.3	0.0e+00
WP_001230400.1|1068063_1068663_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	1.3e-109
WP_000268971.1|1068727_1070041_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	4.8e-77
WP_001023986.1|1070042_1070312_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	96.6	4.2e-44
WP_122988840.1|1070422_1070500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273658.1|1071867_1072041_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|1072123_1073452_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|1073472_1073967_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001171.1|1073977_1074568_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001341462.1|1074577_1075378_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126777.1|1075385_1075772_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307708.1|1075783_1076476_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001297176.1|1076475_1077567_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191700.1|1077854_1078493_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001341463.1|1078532_1082495_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979516.1|1082549_1082759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018496.1|1082917_1084426_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497942.1|1085091_1085922_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154411.1|1085979_1087107_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199164.1|1087112_1088384_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_071531009.1|1088867_1089791_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	7.8e-90
WP_001297190.1|1090602_1091058_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279869.1|1091682_1092885_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282206.1|1093071_1094889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|1096000_1096297_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|1096523_1096721_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335696.1|1096939_1098373_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|1099193_1099757_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|1099911_1102272_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_106910090.1|1103028_1104561_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	3.5e-297
1103258:1103288	attR	GCGATGTTGTTGTCGATTTCCACCCAGCCAT	NA	NA	NA	NA
>prophage 8
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	1274325	1441695	5802748	capsid,integrase,holin,protease,transposase,head,tRNA,terminase,tail	Escherichia_phage(28.67%)	203	1393225:1393241	1428434:1428450
WP_000074974.1|1274325_1275444_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|1275412_1275682_-	excisionase	NA	NA	NA	NA	NA
WP_085948186.1|1277587_1278744_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001090200.1|1279574_1279766_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1279762_1279951_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000367376.1|1280440_1280593_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444615.1|1280868_1281513_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1281610_1281838_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1281834_1282260_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262408.1|1282328_1283366_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000373320.1|1283397_1283820_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450612.1|1283854_1284553_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.1	4.7e-71
WP_000702797.1|1284574_1284799_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1284795_1285152_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001375713.1|1285184_1285337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273106.1|1285333_1285645_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137957.1|1285771_1286335_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	2.9e-47
WP_001278460.1|1286444_1286549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1286735_1286948_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001341382.1|1287115_1287394_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_106910091.1|1287395_1288451_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	5.7e-89
WP_000140011.1|1288451_1288817_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_000640023.1|1288825_1289368_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_000917767.1|1289680_1289878_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611213.1|1290028_1291078_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
WP_000466957.1|1291549_1291981_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143031.1|1292551_1294402_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411804.1|1294692_1294899_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	5.3e-31
WP_000138558.1|1295154_1295427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|1295586_1296120_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|1296766_1296973_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1297037_1297262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1297618_1297759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001341372.1|1297888_1298074_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000279796.1|1298115_1298481_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958380.1|1298769_1299333_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|1299329_1300991_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_106910092.1|1301054_1302992_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.4	0.0e+00
WP_001063025.1|1303036_1303258_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1305784_1306111_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1306121_1306472_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1306468_1306915_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1306911_1307256_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275459.1|1307321_1308038_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030060.1|1308043_1308418_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1308513_1308723_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000807940.1|1312004_1312346_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|1312345_1313044_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001429308.1|1313054_1313798_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122993493.1|1313743_1314376_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_159026389.1|1317911_1318202_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	99.0	2.3e-48
WP_001230532.1|1318268_1318868_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_000279108.1|1318932_1320246_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	96.3	1.2e-72
WP_001339397.1|1320301_1320979_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1320978_1321326_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381371.1|1321345_1322917_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.4e-168
WP_001023483.1|1322954_1323224_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000938122.1|1323678_1325040_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	39.8	4.4e-49
WP_095585410.1|1325416_1325569_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_001058323.1|1326164_1327283_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107384.1|1327279_1329073_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186421.1|1329091_1329799_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|1329795_1330383_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063971.1|1330379_1330778_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|1330774_1331632_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_071527988.1|1331814_1333311_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000460810.1|1333322_1334459_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|1334471_1334564_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001300464.1|1334643_1335942_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000208650.1|1336056_1338237_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|1338256_1338703_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_001295357.1|1338690_1339830_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000742348.1|1339875_1341972_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038062.1|1341971_1342718_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|1342714_1343359_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|1343465_1343771_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|1344212_1344425_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1344710_1344923_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1344933_1345122_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1345096_1345327_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1345316_1345490_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818472.1|1345537_1346611_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001444338.1|1346682_1349427_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264955.1|1349509_1350538_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1350510_1351203_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1351332_1352505_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|1352504_1355051_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_106910093.1|1355047_1355647_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|1355739_1356045_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|1356044_1356965_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000097601.1|1357224_1358484_+	YccE family protein	NA	NA	NA	NA	NA
WP_001044313.1|1358775_1360017_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|1360054_1360282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000607021.1|1360302_1360881_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000013656.1|1360877_1362188_-|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	99.5	6.0e-253
WP_001208773.1|1362240_1362525_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497812.1|1362570_1362822_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|1362809_1363043_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000994788.1|1363186_1363558_-	DUF1627 domain-containing protein	NA	A0A0P0ZH73	Escherichia_phage	88.6	8.3e-51
WP_042357761.1|1363593_1363809_-	DUF1382 family protein	NA	G3CFH1	Escherichia_phage	100.0	6.7e-29
WP_000628762.1|1363741_1364653_-	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	94.4	3.6e-164
WP_085948186.1|1365134_1366290_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000224734.1|1366433_1366631_-	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	93.4	3.2e-25
WP_000206782.1|1366636_1367095_-	hypothetical protein	NA	V5UT79	Shigella_phage	54.5	7.1e-20
WP_001014298.1|1367097_1367289_-	hypothetical protein	NA	A0A0P0ZG45	Escherichia_phage	100.0	3.3e-27
WP_000034212.1|1367290_1367698_-	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	100.0	1.3e-70
WP_000812200.1|1367694_1368324_-	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	73.9	3.1e-58
WP_106910117.1|1368320_1368518_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	97.9	4.4e-19
WP_085948186.1|1368510_1369667_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001111290.1|1369762_1370059_-	DUF2856 family protein	NA	G9L665	Escherichia_phage	98.0	2.3e-48
WP_000073098.1|1370082_1370670_-	hypothetical protein	NA	G9L666	Escherichia_phage	99.5	4.9e-106
WP_000536228.1|1370666_1371347_-	AAA family ATPase	NA	G9L667	Escherichia_phage	100.0	3.4e-127
WP_000613346.1|1371355_1371544_-	hypothetical protein	NA	G9L668	Escherichia_phage	100.0	2.2e-28
WP_000361831.1|1371540_1371654_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	100.0	2.7e-13
WP_001198866.1|1371646_1371787_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_000167595.1|1371980_1372451_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|1372509_1372893_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000687675.1|1373400_1373805_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	100.0	1.6e-68
WP_001082382.1|1373801_1374458_-	transcriptional regulator	NA	A0A0P0ZCT8	Stx2-converting_phage	100.0	2.6e-116
WP_000866443.1|1374454_1374742_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	100.0	1.6e-49
WP_000428098.1|1374878_1375583_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_000064148.1|1375696_1375930_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000438542.1|1376068_1376365_+	hypothetical protein	NA	Q6H9X8	Enterobacteria_phage	100.0	5.2e-48
WP_000185454.1|1376397_1377336_+	replication protein	NA	A0A1I9LJP3	Stx_converting_phage	100.0	1.3e-172
WP_000788927.1|1377332_1378034_+	Replication protein P	NA	C1JJ58	Enterobacteria_phage	99.6	1.3e-129
WP_000145907.1|1378030_1378321_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	99.0	1.6e-46
WP_001000127.1|1378391_1378670_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1378802_1379018_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1379028_1379265_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1379221_1379668_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|1379664_1380192_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|1380188_1380371_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|1380645_1381380_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|1381454_1382177_+	DNA-binding protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107963.1|1382176_1382782_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144759.1|1382778_1382973_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1382965_1383400_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1383906_1384854_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1384863_1385133_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000142998.1|1385632_1387570_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	100.0	0.0e+00
WP_000143462.1|1387705_1387885_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_085948186.1|1387965_1389121_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001290217.1|1389192_1389465_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000284518.1|1389541_1389757_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731236.1|1389761_1390106_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_001092890.1|1390156_1390690_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	100.0	1.6e-103
WP_001056806.1|1390960_1391530_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1391529_1391676_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1391903_1392089_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1392513_1392741_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_106910094.1|1392782_1393148_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	2.6e-65
1393225:1393241	attL	AAAATTCCTGTTTCAGG	NA	NA	NA	NA
WP_000958402.1|1393440_1394004_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|1394000_1395662_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173033.1|1395725_1397663_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.5	0.0e+00
WP_001063025.1|1397707_1397929_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1400455_1400782_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|1400792_1401143_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|1401139_1401586_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1401582_1401927_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275459.1|1401992_1402709_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	9.5e-128
WP_001030060.1|1402714_1403089_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|1403184_1403394_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212983.1|1403441_1406684_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807940.1|1406676_1407018_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|1407017_1407716_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001429308.1|1407726_1408470_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122993493.1|1408415_1409048_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_106910095.1|1409293_1412770_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	96.0	0.0e+00
WP_001216290.1|1412838_1413462_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_000279008.1|1413527_1414850_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	97.5	1.2e-75
WP_001023435.1|1414851_1415121_+|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_001131642.1|1415234_1415810_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|1416100_1416682_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|1416749_1417385_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|1417512_1418571_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|1418645_1419296_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|1419478_1420069_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|1420342_1421206_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1421189_1422326_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|1422575_1423805_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1423950_1425072_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085258.1|1425320_1426550_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000953272.1|1426915_1427104_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_012816761.1|1427161_1428190_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336167.1|1428179_1428644_+	hypothetical protein	NA	NA	NA	NA	NA
1428434:1428450	attR	CCTGAAACAGGAATTTT	NA	NA	NA	NA
WP_001204981.1|1428636_1428870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|1428875_1429175_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833619.1|1429171_1430572_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	1.2e-115
WP_000192401.1|1430772_1431024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|1431020_1431431_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1431441_1431714_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1431840_1432065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|1432316_1432523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907455.1|1432522_1433578_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.7	3.5e-70
WP_000380886.1|1433590_1433926_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|1433938_1434352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001432354.1|1434557_1435100_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000133424.1|1435355_1435637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1436238_1437699_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1437698_1438370_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1438537_1439908_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|1439911_1440553_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1440588_1441695_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	1554367	1567770	5802748	holin,tail,transposase	Escherichia_phage(38.46%)	16	NA	NA
WP_157825328.1|1554367_1554910_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|1555673_1555838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1556536_1557295_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|1557573_1557786_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|1558006_1558264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1558333_1558612_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265290.1|1558613_1559669_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|1559669_1560035_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001059384.1|1560031_1560721_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000023141.1|1562244_1564098_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|1564247_1564463_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|1564467_1564812_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992088.1|1564862_1565396_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056807.1|1565666_1566185_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	1.0e-94
WP_085948186.1|1566241_1567397_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001023357.1|1567500_1567770_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
>prophage 10
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	1670720	1726907	5802748	portal,capsid,integrase,holin,head,tRNA,terminase,tail,lysis	Escherichia_phage(43.94%)	68	1670354:1670369	1685841:1685856
1670354:1670369	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000628065.1|1670720_1671953_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1672207_1673191_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1673668_1675042_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1675170_1676106_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040851.1|1676157_1677393_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_000079604.1|1677394_1677610_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1677709_1677898_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1677935_1678085_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1678140_1678950_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_106910098.1|1678942_1681543_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.1	4.4e-247
WP_000632297.1|1681644_1681920_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1681994_1682165_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1682164_1682386_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001427316.1|1682806_1682959_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000233320.1|1683257_1683677_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072343.1|1683756_1684011_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1684007_1684430_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_001432368.1|1684493_1684973_+	YdaU family protein	NA	A0A0U2RT81	Escherichia_phage	82.4	3.2e-63
WP_000788968.1|1686618_1687365_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
1685841:1685856	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_000450672.1|1687387_1688149_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	89.7	3.8e-119
WP_001151124.1|1688164_1688587_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.0e-64
WP_001266134.1|1688583_1688880_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	3.4e-47
WP_001209480.1|1688876_1689338_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403777.1|1689315_1689672_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.0e-58
WP_000935420.1|1689722_1689935_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|1690020_1690185_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|1690186_1690450_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207986.1|1690460_1691330_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	76.8	5.2e-120
WP_001278454.1|1691445_1691550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1691739_1691952_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341382.1|1692119_1692398_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265080.1|1692399_1693449_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.4e-110
WP_001217413.1|1693461_1693836_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_000762928.1|1693832_1694654_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000143049.1|1695824_1697675_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|1698122_1698329_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|1698328_1698826_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|1698822_1699260_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|1699409_1700027_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|1700214_1700409_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1700797_1701343_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027379.1|1701317_1703243_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|1703239_1703446_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001443752.1|1703442_1705044_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000123251.1|1705024_1706344_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001365129.1|1706353_1706686_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000063258.1|1706741_1707767_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_000158897.1|1707808_1708204_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000752994.1|1708215_1708569_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000975098.1|1708580_1709159_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000683137.1|1709155_1709551_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000235067.1|1709558_1710311_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479086.1|1710324_1710756_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|1710782_1711196_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|1711176_1713756_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|1713752_1714082_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001375577.1|1714081_1714780_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_106910099.1|1714785_1715529_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	7.3e-147
WP_122993493.1|1715474_1716107_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_106910100.1|1716352_1719829_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
WP_001233130.1|1719896_1720496_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	97.5	1.8e-108
WP_106910101.1|1720560_1721874_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001023379.1|1721875_1722145_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_001131657.1|1722257_1722833_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	1.8e-89
WP_001443810.1|1722905_1723535_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1723616_1724258_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1725198_1725633_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837943.1|1725773_1726907_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	4.1e-117
>prophage 11
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	1929828	1977079	5802748	portal,capsid,integrase,holin,protease,head,terminase,tail	Enterobacteria_phage(36.17%)	60	1961481:1961496	1982797:1982812
WP_001023433.1|1929828_1930098_-|tail	phage tail protein	tail	Q9EYE9	Enterobacteria_phage	98.9	6.4e-45
WP_000279009.1|1930099_1931413_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001456919.1|1931477_1932101_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	5.1e-69
WP_106910104.1|1932169_1935649_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	93.5	0.0e+00
WP_133253573.1|1935894_1936527_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	95.2	3.1e-106
WP_000194802.1|1936472_1937216_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
WP_001357740.1|1937226_1937925_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|1937924_1938254_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081787.1|1938250_1940863_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.4	0.0e+00
WP_000533440.1|1940843_1941257_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479045.1|1941283_1941706_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	1.7e-71
WP_000235099.1|1941719_1942472_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	3.8e-135
WP_000683063.1|1942479_1942875_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|1942871_1943405_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000752969.1|1943419_1943773_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	2.5e-57
WP_000158901.1|1943784_1944180_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	90.2	7.2e-53
WP_000063258.1|1944221_1945247_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001295978.1|1945302_1945635_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|1945644_1946964_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|1946944_1948546_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|1948542_1948749_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027379.1|1948745_1950671_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453587.1|1950645_1951191_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001300236.1|1951587_1951812_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|1951893_1952208_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1952734_1952920_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1953141_1953255_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1953475_1954009_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1954168_1954441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411814.1|1954696_1954903_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.5	5.3e-31
WP_000874350.1|1955350_1957201_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000261909.1|1957968_1958682_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|1958819_1959017_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000265267.1|1959303_1960122_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090265.1|1960273_1960645_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_001217436.1|1960634_1961006_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265141.1|1961018_1962068_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.5e-110
1961481:1961496	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_001341388.1|1962069_1962348_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001013636.1|1962515_1962728_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000955173.1|1962772_1962910_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|1963275_1964049_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|1964400_1964814_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000451007.1|1964829_1965600_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788742.1|1965621_1966368_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.6	5.6e-115
WP_001205821.1|1966374_1967490_-	hypothetical protein	NA	V5URT9	Shigella_phage	68.4	3.4e-132
WP_000273724.1|1967568_1968024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|1968230_1968656_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|1968639_1968912_-	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|1969020_1969422_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|1969449_1969641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|1969640_1969928_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000380316.1|1970204_1970357_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394543.1|1970368_1971007_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_001133037.1|1971007_1971217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|1971784_1971973_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|1971969_1972161_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048583.1|1972254_1974705_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|1974772_1975015_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|1974992_1976012_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375138.1|1976419_1977079_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
1982797:1982812	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
>prophage 12
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	2173106	2256967	5802748	portal,integrase,holin,protease,transposase,head,terminase,tail,lysis	Enterobacteria_phage(48.57%)	101	2174232:2174266	2258401:2258435
WP_000399685.1|2173106_2174087_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
2174232:2174266	attL	GTAGGCCGGATAAGGCGTTTACGCCGCATCCGGCA	NA	NA	NA	NA
WP_001145128.1|2174346_2174829_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001218655.1|2174948_2177099_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_000386551.1|2177126_2178089_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443534.1|2178229_2179315_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000007094.1|2179545_2180910_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|2181138_2181810_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_001296990.1|2181812_2182808_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996091.1|2182800_2184537_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_000070131.1|2184529_2185663_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|2185673_2186780_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|2186741_2187152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113363.1|2187284_2188046_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|2188042_2189284_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045454.1|2189283_2190240_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446932.1|2190275_2190989_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|2191193_2191898_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|2192034_2192487_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|2192488_2192734_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|2192726_2193212_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084632.1|2193214_2193727_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001295301.1|2193748_2194738_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|2195134_2196043_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|2196234_2198256_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044868.1|2198834_2199512_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|2199504_2200260_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118840.1|2200246_2201401_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|2201397_2202438_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001307065.1|2202524_2203814_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|2203872_2204349_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001121571.1|2204852_2205506_+	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000354291.1|2205518_2205740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002868.1|2205823_2206204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448642.1|2206404_2206980_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001339397.1|2207040_2207718_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2207717_2208065_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2208084_2209656_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_021351651.1|2210130_2210502_+	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000652081.1|2210625_2211453_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.2	3.1e-154
WP_000950982.1|2211676_2212558_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001023459.1|2212663_2212933_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000268998.1|2212934_2214149_-	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001230449.1|2214213_2214813_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000515142.1|2214880_2218357_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_122993493.1|2218602_2219235_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_001429308.1|2219180_2219924_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_001375577.1|2219929_2220628_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	4.7e-132
WP_000847304.1|2220627_2220957_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082320.1|2220953_2223533_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000533431.1|2223513_2223927_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|2223953_2224385_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143027.1|2224398_2225151_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	2.0e-128
WP_032284507.1|2225158_2225527_-	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_000099160.1|2225523_2227062_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612622.1|2227110_2227458_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	9.7e-62
WP_000839179.1|2227454_2227859_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001254029.1|2227936_2228113_-	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_001432013.1|2228102_2229695_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	3.2e-184
WP_000259002.1|2229691_2229898_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_009442816.1|2229881_2231810_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235451.1|2231781_2232291_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_085947969.1|2232380_2233594_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_001307652.1|2233999_2234194_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|2234381_2234999_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|2235148_2235586_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|2235582_2236080_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|2236079_2236286_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000499454.1|2238896_2239055_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2239140_2239884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|2240068_2240758_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|2240772_2240895_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|2241234_2242194_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|2242405_2242594_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008193.1|2242590_2242953_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000002261.1|2242949_2243240_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001003989.1|2243239_2243962_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_001341811.1|2243954_2244164_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_032346219.1|2244123_2244528_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	99.3	3.5e-71
WP_001254255.1|2244530_2244707_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000814611.1|2244703_2245114_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_000344573.1|2245085_2245442_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000145926.1|2245738_2246029_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_106910106.1|2246025_2246727_-	Replication protein P	NA	K7P6G2	Enterobacteria_phage	98.7	1.4e-128
WP_000638163.1|2247627_2247954_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	98.9	8.6e-44
WP_085947969.1|2247937_2249151_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_001341800.1|2249787_2250648_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.3	2.4e-37
WP_000638547.1|2250672_2250804_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243354.1|2250788_2250941_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000031370.1|2251197_2251803_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000951334.1|2251802_2252186_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_001111278.1|2252209_2252503_+	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_001214436.1|2252513_2252678_+	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_000812206.1|2252674_2253232_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_000034231.1|2253228_2253786_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000104414.1|2253787_2254405_+	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
WP_012817743.1|2254401_2254704_+	restriction alleviation protein, Lar family	NA	Q716F5	Shigella_phage	97.0	9.4e-53
WP_000002107.1|2254696_2254981_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_000545733.1|2255053_2255221_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001281774.1|2255249_2255594_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_001303849.1|2255700_2255919_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|2255896_2256967_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
2258401:2258435	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 13
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	2476483	2541813	5802748	portal,capsid,integrase,protease,transposase,head,tRNA,terminase,tail	Enterobacteria_phage(56.6%)	73	2484964:2485010	2531607:2531653
WP_000420938.1|2476483_2477620_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383941.1|2477888_2480126_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001224569.1|2483085_2483976_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177453.1|2484158_2484920_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2484964:2485010	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|2485432_2486386_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226384.1|2486572_2488057_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000937502.1|2488240_2488546_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_000239881.1|2488602_2489271_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885569.1|2489325_2489910_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000268807.1|2489909_2492870_-	membrane protein	NA	A0A2D1UII2	Escherichia_phage	97.4	6.6e-58
WP_001230523.1|2492934_2493534_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000515439.1|2493604_2497018_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090884.1|2497078_2497711_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_001152557.1|2498396_2499095_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000847347.1|2499094_2499424_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_000840236.1|2499420_2501982_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_000459457.1|2501974_2502409_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479169.1|2502390_2502813_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_001342267.1|2502828_2503569_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000683110.1|2503576_2503972_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_000985132.1|2503968_2504547_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752961.1|2504537_2504912_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000158868.1|2504923_2505319_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063244.1|2505360_2506386_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_001345004.1|2506441_2506774_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000088640.1|2506783_2507662_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001339397.1|2507702_2508380_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2508379_2508727_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2508746_2510318_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001375452.1|2510790_2512392_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.0e-310
WP_000198149.1|2512388_2512595_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|2512591_2514517_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453558.1|2514491_2515037_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_106910107.1|2515005_2515602_+	porin	NA	Q1MVN1	Enterobacteria_phage	71.5	3.6e-72
WP_001204791.1|2515790_2516174_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|2516259_2516400_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|2516396_2516759_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774477.1|2516755_2517046_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_000224914.1|2517038_2517209_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053023.1|2517208_2517664_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_072097617.1|2517660_2517762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000520500.1|2517885_2518287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038620.1|2518265_2518682_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_001415151.1|2518981_2519590_-	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_000152742.1|2520342_2520690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000788789.1|2520894_2521596_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_159026390.1|2521592_2522522_-	Replication protein O	NA	M1FN81	Enterobacteria_phage	67.0	5.7e-109
WP_001182773.1|2522608_2523148_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001067458.1|2523217_2523448_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|2523552_2524242_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000066829.1|2524323_2524587_+	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001444023.1|2524722_2525043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206913.1|2525509_2525800_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_000995439.1|2525875_2526172_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2526177_2526963_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000611716.1|2526959_2527640_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|2527636_2527819_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|2527791_2527983_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_001443983.1|2527993_2528275_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000763390.1|2528373_2528592_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_085947969.1|2528802_2530016_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_000446905.1|2530202_2530574_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000051902.1|2530429_2531593_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|2531927_2532560_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2531607:2531653	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001255226.1|2532562_2533078_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_001350487.1|2533088_2534129_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000701359.1|2534107_2536717_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988363.1|2536747_2537440_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|2537659_2538202_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|2538682_2539549_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|2539550_2539763_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143540.1|2539870_2540392_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912342.1|2540427_2541813_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
>prophage 14
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	3205073	3263272	5802748	plate,integrase,protease,transposase,head,tail	Shigella_phage(52.38%)	73	3201332:3201348	3262221:3262237
3201332:3201348	attL	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
WP_000077537.1|3205073_3205604_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|3205794_3206043_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|3206044_3208135_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129791.1|3208205_3209138_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.7	2.4e-70
WP_000268103.1|3209140_3209362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|3209374_3209629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|3209630_3209912_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|3209908_3210181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|3210185_3210479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|3210490_3211021_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|3211118_3211661_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|3211664_3212198_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465559.1|3212197_3212713_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977060.1|3212716_3213268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|3213264_3213450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|3213488_3213821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|3213813_3214011_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|3214000_3214297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|3214293_3214803_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|3214872_3215298_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|3215369_3215870_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|3215904_3216333_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|3216316_3216535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|3216544_3216772_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|3216752_3217061_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|3217057_3217348_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|3217350_3217932_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|3217931_3219596_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|3219595_3221185_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|3221168_3222494_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|3222612_3223086_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|3223262_3224387_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|3224386_3225334_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002059.1|3225377_3225752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|3225748_3226168_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|3226164_3226725_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|3226725_3226971_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|3226967_3228470_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|3228478_3228844_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|3228858_3229335_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|3229461_3231537_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|3231523_3232873_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|3232856_3233981_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|3233970_3234585_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|3234577_3235015_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|3235014_3236097_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|3236087_3236648_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|3236647_3237559_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|3237593_3238115_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|3238194_3238398_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|3238620_3239181_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|3239280_3241320_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|3241466_3241649_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|3241684_3241930_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|3241968_3242433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|3242547_3242748_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|3242701_3243439_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_077778456.1|3243580_3244183_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000801473.1|3244433_3245996_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_001175459.1|3246013_3246526_+	4-hydroxyphenylacetate 3-monooxygenase reductase subunit	NA	NA	NA	NA	NA
WP_001298933.1|3246918_3249069_+	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_000467859.1|3249199_3249403_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001297640.1|3249413_3250370_+	GTPase	NA	NA	NA	NA	NA
WP_000063145.1|3250456_3250648_-	antitoxin	NA	NA	NA	NA	NA
WP_000432643.1|3250687_3251656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819015.1|3251796_3254229_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_001341289.1|3254295_3255765_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_000110079.1|3255764_3257534_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000132621.1|3257754_3258096_+	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000648228.1|3258142_3260236_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000394276.1|3260332_3260497_-	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_000199352.1|3260673_3262086_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000181189.1|3262327_3263272_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	5.0e-60
3262221:3262237	attR	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
>prophage 15
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	3303611	3366462	5802748	tRNA,transposase,integrase	Stx2-converting_phage(40.91%)	53	3312090:3312105	3344231:3344246
WP_085948184.1|3303611_3304768_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
WP_000177060.1|3306290_3306548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|3307105_3307873_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|3307873_3308830_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125190.1|3308826_3309825_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|3309821_3310724_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188267.1|3310768_3313093_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
3312090:3312105	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_001068910.1|3313179_3314133_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|3314129_3314651_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|3316401_3316659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|3317391_3318750_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|3318988_3320374_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000612591.1|3320423_3320771_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171523.1|3320767_3321148_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001221615.1|3321502_3321937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271003.1|3321924_3322326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221529.1|3322491_3323061_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000381395.1|3323800_3325372_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3325391_3325739_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3325738_3326416_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000091133.1|3326705_3328292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356577.1|3328430_3329270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772685.1|3329513_3330776_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000061768.1|3331219_3332239_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_001332879.1|3332368_3333871_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_001295681.1|3333989_3335072_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584109.1|3335071_3336172_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397144.1|3336438_3337950_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786398.1|3338304_3338748_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416407.1|3338747_3341603_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_001059398.1|3343045_3343549_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|3343594_3344011_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012897.1|3344172_3345186_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
3344231:3344246	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
WP_001074121.1|3345362_3346874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000583470.1|3346996_3347449_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000256681.1|3347593_3348187_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500687.1|3348257_3348971_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230273.1|3349101_3349497_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|3349777_3349912_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013046.1|3349915_3350851_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|3350863_3351325_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|3351397_3351784_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000399685.1|3352060_3353041_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000471889.1|3353268_3355965_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|3356105_3356159_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181312.1|3356343_3357291_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001297258.1|3357409_3358831_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001341327.1|3358880_3360536_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187778.1|3360929_3363068_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|3363226_3363691_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000839179.1|3364126_3364531_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|3364527_3364875_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|3364923_3366462_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
>prophage 16
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	3412356	3470651	5802748	integrase,protease,transposase,tRNA	Vibrio_phage(15.38%)	57	3437859:3437873	3469920:3469934
WP_000811566.1|3412356_3412632_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299838.1|3412748_3414374_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943991.1|3414457_3415621_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
WP_000101670.1|3415623_3416262_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|3416271_3416670_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|3416687_3417347_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|3417397_3418096_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|3418114_3418516_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|3418642_3419374_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|3419553_3421995_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|3422033_3422459_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|3422663_3423962_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|3424065_3424263_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|3424344_3425349_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3425351_3426611_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460361.1|3426696_3427977_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3428053_3428362_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|3428447_3429398_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122519.1|3429390_3431238_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|3431247_3432585_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|3432603_3433065_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001307537.1|3433036_3434584_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294203.1|3434582_3435722_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_100699686.1|3435704_3435758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|3436621_3437167_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|3437261_3438314_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
3437859:3437873	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934920.1|3438410_3439379_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|3439400_3442724_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|3442752_3443067_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|3443063_3443378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346081.1|3443429_3444932_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|3445150_3446128_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|3446452_3448261_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|3448253_3448988_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000208757.1|3448998_3449394_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|3449404_3449764_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|3449826_3450960_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|3451048_3451582_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3451578_3451896_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3452077_3452224_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|3452334_3452460_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3452511_3453078_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|3453119_3454148_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008073.1|3454537_3455407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000399685.1|3455655_3456636_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|3456888_3457242_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3457379_3459026_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3459069_3459363_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|3459638_3460895_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|3460910_3461387_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|3461723_3463160_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3463277_3464579_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000883338.1|3464694_3465033_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068905.1|3465008_3466706_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|3466742_3467318_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|3467697_3468963_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000704132.1|3469079_3470651_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.6	5.8e-295
3469920:3469934	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
>prophage 17
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	3905858	3919191	5802748	transposase,integrase	Enterobacteria_phage(66.67%)	15	3905676:3905698	3919676:3919698
3905676:3905698	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|3905858_3907028_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|3907047_3908907_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|3908903_3909329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|3909656_3910229_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|3910302_3910803_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283024.1|3910799_3911534_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_001149160.1|3912085_3912352_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980227.1|3912348_3912948_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	6.0e-51
WP_001244665.1|3912940_3913228_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459320.1|3913220_3913676_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000381395.1|3913751_3915323_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|3915342_3915690_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|3915689_3916367_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000856729.1|3916522_3916843_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783645.1|3916857_3919191_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
3919676:3919698	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 18
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	4969013	4976962	5802748	transposase,integrase	Stx2-converting_phage(42.86%)	7	4969905:4969921	4978980:4978996
WP_001272558.1|4969013_4969769_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
4969905:4969921	attL	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_000935135.1|4970055_4971663_+|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_000852869.1|4971655_4972315_+	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000082600.1|4973223_4973952_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_001339397.1|4974346_4975024_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4975023_4975371_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4975390_4976962_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
4978980:4978996	attR	TCCCTTCGCCCGCTCCA	NA	NA	NA	NA
>prophage 19
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	5128947	5136087	5802748		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|5128947_5129586_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|5129582_5130845_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|5130841_5131750_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|5131945_5132713_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141347.1|5132763_5133420_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001272924.1|5133525_5136087_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 20
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	5208878	5308249	5802748	capsid,integrase,holin,transposase,head,tRNA,terminase,tail	Stx2-converting_phage(28.57%)	95	5200798:5200813	5231072:5231087
5200798:5200813	attL	AACAAAATCTTAAAAA	NA	NA	NA	NA
WP_000577251.1|5208878_5210597_+	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
WP_000214985.1|5210598_5212347_+	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000448925.1|5212418_5212835_-	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_001448712.1|5212873_5214109_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.5	6.5e-233
WP_001431537.1|5214407_5215316_-	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_000516611.1|5215798_5216974_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_000557643.1|5217146_5217293_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000457722.1|5217296_5217539_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000206753.1|5217623_5218487_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000034210.1|5218488_5218818_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000476199.1|5218814_5219054_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000158004.1|5219046_5219250_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_000335005.1|5219246_5220125_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.9	1.9e-170
WP_000008174.1|5220115_5220652_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_000081319.1|5220780_5221605_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000135680.1|5221670_5222033_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|5222699_5223374_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|5223464_5223665_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|5223708_5224260_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001087342.1|5224256_5225408_+	peptidase	NA	K7PLX4	Enterobacteria_phage	96.3	6.9e-205
WP_000620696.1|5225404_5225629_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_000061518.1|5225625_5226444_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.1e-122
WP_001447903.1|5226440_5226935_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.3	1.3e-83
WP_001341555.1|5226934_5227588_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_000210170.1|5227584_5227911_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767136.1|5227907_5228297_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
WP_001061413.1|5228316_5229114_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_001428967.1|5229121_5230111_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.2e-192
WP_001047129.1|5230124_5230877_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	7.6e-136
WP_001339373.1|5231186_5231339_+	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
5231072:5231087	attR	AACAAAATCTTAAAAA	NA	NA	NA	NA
WP_085948186.1|5233875_5235031_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000411802.1|5235721_5235928_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|5235927_5236425_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_001208681.1|5236641_5236827_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_001303878.1|5237354_5237669_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032321890.1|5237750_5237975_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	7.8e-20
WP_001375434.1|5238016_5238382_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.3e-66
WP_000958402.1|5238674_5239238_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	98.4	4.0e-89
WP_001341975.1|5239234_5240896_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000173032.1|5240959_5242897_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.5	0.0e+00
WP_001063025.1|5242941_5243163_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|5245689_5246016_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|5246026_5246377_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5246373_5246820_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|5246816_5247161_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|5247226_5247943_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030067.1|5247948_5248323_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|5248418_5248628_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212961.1|5248675_5251918_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.9	0.0e+00
WP_000807927.1|5251910_5252252_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_001341641.1|5252251_5252950_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000194787.1|5252960_5253704_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.1e-146
WP_122996338.1|5253649_5254282_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_000514836.1|5254520_5257994_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.4	0.0e+00
WP_001427270.1|5258061_5258661_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.7e-109
WP_000268987.1|5258725_5260039_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001023420.1|5260040_5260310_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_115801847.1|5260416_5260506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|5260525_5262874_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001370486.1|5263466_5266868_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.3e-219
WP_000938110.1|5267244_5268606_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_000162574.1|5270360_5270843_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|5270974_5271451_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|5271440_5271731_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|5271792_5272134_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_032346269.1|5272282_5273944_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|5274029_5274908_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|5275030_5275624_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|5275678_5276965_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|5276985_5277777_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460032.1|5277943_5279305_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|5279553_5279802_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|5279820_5280369_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|5280399_5281167_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|5281208_5281556_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|5281632_5282115_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969036.1|5282130_5283357_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|5283346_5283865_-	YfiR family protein	NA	NA	NA	NA	NA
WP_000976004.1|5284014_5284380_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168054.1|5284589_5285660_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000225221.1|5285670_5286792_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200116.1|5286834_5287995_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|5288093_5288141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|5288244_5288586_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|5288856_5289594_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079094.1|5289728_5290709_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040115.1|5290705_5291437_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|5291566_5294140_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000841103.1|5299993_5301292_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001300818.1|5301288_5301612_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|5301657_5303013_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000083007.1|5303126_5305787_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001341635.1|5305818_5306517_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|5306585_5307005_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|5307211_5308249_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	5380990	5436587	5802748	integrase,holin,tRNA,terminase,tail	Escherichia_phage(45.28%)	64	5394301:5394317	5434921:5434937
WP_000003317.1|5380990_5382145_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_001090850.1|5382429_5383443_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000551807.1|5383469_5384588_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001107167.1|5384698_5385973_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000409205.1|5385990_5386611_+	YfgM family protein	NA	NA	NA	NA	NA
WP_001177037.1|5386621_5387800_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_000249410.1|5387917_5389390_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001341622.1|5389458_5389674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937895.1|5389670_5391041_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
WP_001299507.1|5391202_5392669_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|5392737_5394315_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
5394301:5394317	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000954573.1|5394508_5395759_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.8	1.6e-239
WP_000203840.1|5395790_5396447_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	82.5	1.2e-55
WP_000809680.1|5396771_5397020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000163457.1|5397016_5397667_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	98.6	2.5e-127
WP_001341620.1|5397659_5397911_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	5.2e-41
WP_000675390.1|5398068_5398317_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063818.1|5398366_5399248_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.6	2.6e-159
WP_001068008.1|5399244_5400066_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	97.1	6.3e-160
WP_001102252.1|5400062_5400362_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	2.2e-46
WP_000836290.1|5400670_5401255_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|5401409_5401640_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000402893.1|5401790_5401991_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_032346207.1|5402006_5402840_+	primosomal protein	NA	Q286X4	Escherichia_phage	94.6	2.2e-115
WP_001432051.1|5402836_5403622_+	replication P family protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	98.5	6.7e-151
WP_001231254.1|5403739_5404084_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
WP_032346209.1|5404145_5404778_+	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	66.7	1.0e-61
WP_032346211.1|5404774_5405185_+	hypothetical protein	NA	A0A076G6X8	Escherichia_phage	75.7	7.3e-32
WP_032346213.1|5405193_5405979_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	97.5	7.4e-41
WP_000034210.1|5405975_5406305_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_032346466.1|5406306_5407101_+	DUF551 domain-containing protein	NA	Q6H9Z7	Enterobacteria_phage	65.5	2.0e-46
WP_000002095.1|5407093_5407375_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	92.5	1.0e-45
WP_001129693.1|5407367_5407706_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
WP_032346464.1|5407746_5408421_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	2.6e-119
WP_000132533.1|5408417_5409893_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.8	1.2e-297
WP_000999681.1|5409983_5410355_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	89.4	4.5e-57
WP_000335899.1|5411057_5411264_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000852429.1|5411278_5412958_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	99.3	2.3e-302
WP_000133160.1|5412954_5413251_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_001048076.1|5413253_5413949_+	peptidase	NA	G9L6C4	Escherichia_phage	99.6	1.3e-94
WP_000268715.1|5413963_5414950_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
WP_000627084.1|5415001_5415439_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	96.6	7.7e-72
WP_000012377.1|5415449_5415785_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000424489.1|5415835_5416159_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	99.1	9.1e-54
WP_000179256.1|5416158_5416764_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	98.5	4.0e-111
WP_001018556.1|5416763_5419235_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.8	0.0e+00
WP_000567631.1|5419234_5419699_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.9e-84
WP_000332878.1|5419698_5420244_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_001145658.1|5420243_5422757_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.8	0.0e+00
WP_000119864.1|5422753_5424556_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.5	0.0e+00
WP_001248457.1|5424561_5427036_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.0	0.0e+00
WP_000708858.1|5427228_5427390_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001260052.1|5427488_5428121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032346281.1|5428266_5428977_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	80.7	3.0e-102
WP_024220803.1|5429292_5429550_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	4.9e-42
WP_000218925.1|5429745_5432367_+|tail	tail fiber protein	tail	A0A193GYU1	Enterobacter_phage	70.4	2.3e-126
WP_000902802.1|5432503_5432866_-	GtrA family protein	NA	I1TED9	Salmonella_phage	80.8	2.2e-48
WP_001275997.1|5433014_5433407_+	membrane protein	NA	T1SA79	Salmonella_phage	96.9	2.5e-61
WP_000207023.1|5433403_5433712_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	97.0	1.1e-48
WP_000403808.1|5433701_5434331_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	4.0e-114
WP_001341613.1|5434327_5434810_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	88.1	3.6e-70
WP_000755172.1|5435029_5435569_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
5434921:5434937	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000669403.1|5435584_5436100_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_001344399.1|5436413_5436587_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 22
NZ_CP027390	Escherichia coli strain 2015C-4944 chromosome, complete genome	5802748	5597909	5714360	5802748	portal,capsid,integrase,holin,transposase,head,bacteriocin,terminase,tail,lysis	Escherichia_phage(42.54%)	141	5649855:5649878	5713329:5713352
WP_000381395.1|5597909_5599481_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5599500_5599848_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5599847_5600525_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000100143.1|5600997_5602014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839828.1|5602657_5605018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160236.1|5606330_5606486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163428.1|5609205_5609406_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000545713.1|5609463_5609631_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	1.2e-25
WP_001368678.1|5609666_5609966_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_000376716.1|5610123_5610402_-	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	5.4e-47
WP_000156090.1|5610401_5610989_-	DUF551 domain-containing protein	NA	Q9G077	Enterobacteria_phage	100.0	7.5e-115
WP_001375782.1|5610985_5611603_-	hypothetical protein	NA	Q9G078	Enterobacteria_phage	100.0	3.7e-112
WP_000060377.1|5611606_5611795_-	hypothetical protein	NA	Q9G079	Enterobacteria_phage	100.0	1.7e-28
WP_000052365.1|5611796_5612465_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	9.3e-69
WP_000812180.1|5612461_5613049_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	97.5	5.0e-58
WP_106910113.1|5613220_5613505_-	DUF2856 family protein	NA	K7P875	Enterobacteria_phage	97.8	1.5e-44
WP_001243355.1|5613491_5613644_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|5613628_5613763_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000776959.1|5613838_5614150_-	superinfection exclusion protein	NA	O48416	Enterobacteria_phage	99.0	9.3e-56
WP_000167585.1|5614293_5614764_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_000382838.1|5614964_5615459_+	hypothetical protein	NA	K7PK22	Enterobacteria_phage	99.4	1.6e-89
WP_001430488.1|5615489_5615852_-	hypothetical protein	NA	K7P6R2	Enterobacteria_phage	100.0	6.2e-59
WP_012817806.1|5615854_5616127_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_000394868.1|5616560_5616857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092874.1|5616897_5617572_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	83.9	1.2e-103
WP_001054987.1|5617716_5617941_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_001375758.1|5618050_5618329_+	transcriptional regulator	NA	K7P7A2	Enterobacteria_phage	96.7	1.5e-41
WP_000539347.1|5618512_5619334_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	1.7e-152
WP_001248395.1|5619330_5620707_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.1	5.3e-252
WP_000103674.1|5620793_5621009_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	98.6	2.2e-32
WP_000344573.1|5621474_5621831_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_000814611.1|5621802_5622213_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	2.1e-71
WP_001254255.1|5622209_5622386_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|5622388_5622790_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_072189684.1|5622749_5622959_+	protein ninF	NA	G9L691	Escherichia_phage	95.6	2.2e-29
WP_001107956.1|5622951_5623557_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	5.6e-97
WP_000144614.1|5623553_5623760_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_001271146.1|5623737_5624403_+	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	97.7	1.6e-129
WP_001235461.1|5624399_5625023_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000783734.1|5626095_5626419_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|5626402_5626879_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000092296.1|5626875_5627313_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	1.1e-70
WP_001016387.1|5627518_5628037_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	1.2e-92
WP_000999682.1|5628320_5628692_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	88.6	3.2e-55
WP_000807788.1|5628795_5629038_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000179910.1|5629117_5629543_+	hypothetical protein	NA	Q716H4	Shigella_phage	87.9	1.8e-65
WP_000200776.1|5629539_5630952_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	2.2e-277
WP_000852339.1|5630954_5633081_+|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.3	0.0e+00
WP_000426731.1|5633094_5633979_+	hypothetical protein	NA	Q716H1	Shigella_phage	98.6	3.4e-143
WP_001133481.1|5633990_5635262_+|head	head protein	head	Q716H0	Shigella_phage	99.8	6.6e-241
WP_000375639.1|5635304_5635490_+	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_000246750.1|5635464_5635947_+	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	100.0	3.8e-88
WP_001122374.1|5635955_5637374_+	Packaged DNA stabilization protein gp10	NA	Q716G7	Shigella_phage	99.2	2.3e-274
WP_000785546.1|5637373_5638222_+	Packaged DNA stabilization protein gp26	NA	Q716G6	Shigella_phage	97.9	1.5e-100
WP_000614047.1|5638221_5638677_+	DUF2824 family protein	NA	Q716G5	Shigella_phage	98.0	3.3e-86
WP_000964882.1|5638679_5639372_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	100.0	9.2e-112
WP_000246938.1|5639381_5640788_+	DNA transfer protein	NA	I6RSG0	Salmonella_phage	55.8	1.1e-127
WP_085947969.1|5641081_5642294_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.3	1.7e-169
WP_000749284.1|5643959_5644445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287055.1|5644515_5644782_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	90.5	9.5e-33
WP_001280420.1|5644903_5647027_+	hypothetical protein	NA	A0A2D1GLP5	Escherichia_phage	36.7	2.5e-59
WP_000440209.1|5647097_5648240_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	28.9	9.2e-24
WP_000958687.1|5648484_5649642_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	1.1e-221
5649855:5649878	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_032274263.1|5650073_5651243_+|integrase	integrase family protein	integrase	G3CFG6	Escherichia_phage	100.0	7.5e-231
WP_024174014.1|5651226_5651409_-	helix-turn-helix domain-containing protein	NA	G3CFG7	Escherichia_phage	100.0	4.1e-27
WP_000497812.1|5651469_5651721_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_021351637.1|5651708_5651942_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_000994797.1|5652085_5652484_-	DUF1627 domain-containing protein	NA	G3CFH0	Escherichia_phage	99.2	4.7e-52
WP_001291843.1|5652519_5652732_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|5652691_5653318_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_044164933.1|5653314_5653746_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	99.3	2.1e-74
WP_000203834.1|5653801_5654440_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.5	5.5e-119
WP_032344420.1|5654763_5655492_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	100.0	7.9e-130
WP_032344418.1|5655587_5656211_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	96.6	3.6e-115
WP_000212746.1|5656214_5656502_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_106888384.1|5656503_5656773_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	89.4	2.5e-25
WP_001447495.1|5656810_5656999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032344417.1|5657003_5657705_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	99.6	3.9e-134
WP_032344415.1|5657701_5657941_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	98.7	8.0e-39
WP_001345192.1|5658134_5659013_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	99.7	3.8e-179
WP_032344414.1|5659120_5659564_-	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	97.3	2.3e-76
WP_000080417.1|5659640_5660462_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|5660525_5660873_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344636.1|5660947_5661535_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	99.5	2.0e-107
WP_000187063.1|5661534_5662224_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_106910114.1|5662220_5663171_-	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	98.1	9.5e-176
WP_000995345.1|5663187_5663469_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934197.1|5663489_5663771_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	100.0	3.0e-45
WP_001369605.1|5664065_5664740_-	ORF6N domain-containing protein	NA	A0A0P0ZGP9	Escherichia_phage	100.0	1.3e-123
WP_016051777.1|5664995_5665781_-	regulatory protein	NA	A0A0P0ZG86	Escherichia_phage	100.0	9.4e-145
WP_001064714.1|5666397_5667351_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|5667347_5668817_-	SAM-dependent methyltransferase	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|5668911_5669625_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|5669720_5669924_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001369601.1|5670094_5670289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|5670455_5670833_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913116.1|5670826_5672347_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	100.0	1.4e-306
WP_001260358.1|5672336_5673308_+	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	100.0	6.5e-196
WP_000402092.1|5673307_5673757_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|5673764_5674328_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|5674324_5674519_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|5674511_5674946_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001304085.1|5675194_5675347_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_000649753.1|5675729_5676689_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|5676700_5676970_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874485.1|5677467_5679405_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	99.7	0.0e+00
WP_000143458.1|5679541_5679721_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|5679761_5680007_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|5680084_5680300_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|5680304_5680838_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|5681108_5681678_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5681677_5681824_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816804.1|5682051_5682237_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_001108577.1|5682475_5683027_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	8.4e-100
WP_001086067.1|5683319_5684114_+	hypothetical protein	NA	A0A0P0ZG40	Escherichia_phage	96.3	4.1e-132
WP_024231339.1|5684094_5685801_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	99.8	0.0e+00
WP_000787035.1|5685800_5687945_+|portal	portal protein	portal	A0A0P0ZG74	Escherichia_phage	99.9	0.0e+00
WP_000345011.1|5688102_5689110_+	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.7	3.0e-180
WP_000214474.1|5689133_5690348_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_100013453.1|5690402_5690792_+	hypothetical protein	NA	V5UT93	Shigella_phage	99.2	2.9e-62
WP_001371266.1|5690841_5691303_+	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_000829202.1|5691286_5691850_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_106910115.1|5691849_5692197_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	1.6e-59
WP_085948186.1|5692248_5693404_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_074434343.1|5693509_5693767_+	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	98.8	1.2e-40
WP_012816803.1|5693763_5695701_+|tail	tail fiber protein	tail	A0A1I9LJS9	Stx_converting_phage	99.3	3.1e-64
WP_001023407.1|5695702_5695972_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001303606.1|5696110_5696299_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146321.1|5696593_5698219_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	99.4	0.0e+00
WP_000197188.1|5698215_5699484_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.4e-219
WP_000455633.1|5699498_5699777_+	outer membrane protein	NA	A0A2L1IV69	Escherichia_phage	100.0	2.6e-49
WP_001459282.1|5699782_5700400_+	hypothetical protein	NA	A0A2L1IV83	Escherichia_phage	98.0	3.7e-120
WP_000836187.1|5700479_5701217_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2L1IV31	Escherichia_phage	81.2	1.1e-110
WP_000078907.1|5701449_5701590_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035555.1|5701646_5702048_+	hypothetical protein	NA	Q08J75	Stx2-converting_phage	100.0	7.0e-72
WP_000509019.1|5702141_5702795_+	hypothetical protein	NA	Q08J74	Stx2-converting_phage	100.0	9.3e-114
WP_000455645.1|5702797_5703244_+	hypothetical protein	NA	Q08J73	Stx2-converting_phage	100.0	1.1e-76
WP_000540391.1|5703254_5703506_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012437.1|5703516_5704782_+	hypothetical protein	NA	Q08J71	Stx2-converting_phage	100.0	1.7e-204
WP_000331701.1|5704851_5713206_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	96.9	0.0e+00
WP_000368131.1|5713427_5714360_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
5713329:5713352	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 1
NZ_CP027391	Escherichia coli strain 2015C-4944 plasmid unnamed, complete sequence	98724	12939	70673	98724	integrase,transposase	Stx2-converting_phage(33.33%)	46	16051:16110	39809:41073
WP_001164205.1|12939_13722_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000465041.1|13723_14137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261287.1|14696_14927_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|14923_15340_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001165114.1|15501_16047_-	hypothetical protein	NA	NA	NA	NA	NA
16051:16110	attL	TGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCT	NA	NA	NA	NA
WP_085948186.1|16114_17270_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000704534.1|18075_18936_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	1.3e-09
WP_001066949.1|19063_19450_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001341423.1|19503_20178_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|20174_20522_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|20525_22094_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000154135.1|22753_23419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335839.1|23559_24201_-	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000907857.1|24909_25941_+	replication initiation protein	NA	NA	NA	NA	NA
WP_000581688.1|26900_36401_-	toxin B	NA	NA	NA	NA	NA
WP_001443774.1|36515_36746_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085948186.1|39872_41028_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000747011.1|41069_41159_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	100.0	2.3e-07
39809:41073	attR	TGAGGTAGCCTGAGTTTAACGGACACTCCTTCCTGAAATAGAATGGCATCAGAAGGAGCTAATAATGAGCAGAAAAACCCAACGTTACTCTAAAGAGTTCAAAGCCGAAGCTGTCAGAACGGTTCTTGAAAATCAACTTTCGATCAGTGAAGGCGCTTCCCGATTATCTCTTCCTGAAGGCACTTTAGGACAATGGGTTACCGCCGCCAGAAAAGGGCTCGGTACTCCTGGTTCCCGCACGGTGGCTGAACTGGAATCTGAAATTCTGCAACTGCGTAAGGCGTTAAATGAAGCTCGCCTTGAGCGAGATATATTAAAAAAAGCAACAGCGTATTTTGCACAGGAGTCGCTGAAAAATACGCGTTAATCGAACAATGGCGACAACAATTTCCCATTGAAGCGATGTGTCAGGTATTTGGTGTATCCAGGAGCGGTTATTACAACTGGGTACAGCATGAACCCTCAGACAGAAAACAAAGTGATGAGCGGCTAAAACTGGAGATTAAGGTGGCACATATCCGCACTCGCGAAACATATGGAACCCGGCGGCTCCAGACGGAGCTGGCAGAGAATGGCATCATCGTTGGTCGTGACCGACTGGCACGTCTTCGTAAGGAGCTAAGGCTACGCTGTAAGCAGAAACGCAAGTTCAGAGCGACTACGAACTCGAACCACAATCTGCCAGTTGCGCCAAATCTGCTGAACCAGACGTTCGCTCCTACAGCACCAAATCAGGTCTGGGTGGCGGACCTGACGTATGTTGCCACACAGGAGGGATGGTTGTACCTCGCTGGCATCAAAGATGTTTATACGTGCGAAATTGTCGGCTACGCCATGGGAGAGCGCATGACAAAAGAGCTGACAGGTAAAGCTCTGTTTATGGCGCTCAGGAGCCAGCGCCCACCTGCCGGGCTAATCCACCACTCTGATCGAGGTTCACAGTACTGCGCATACGATTACCGGGTCATACAGGAGCAGTTTGGTCTGAAAACATCAATGTCGCGTAAAGGTAACTGTTACGACAACGCTCCGATGGAAAGCTTCTGGGGAACGCTGAAAAATGAGAGCCTGAGCCACTATCGTTTTAATAACCGGGATGAAGCCATCTCAGTAATACGGGAATACATTGAGATTTTCTACAATCGTCAGCGTCGTCACTCTCGTCTGGGGAATATCTCCCCGGCAGCCTTCAGGGAAAAATATCATCAGATGGCTGCTTAAAAAAAGAACAAATGGTAGTGTCCGCTATTGCCAGTACACCTCAG	NA	NA	NA	NA
WP_000422675.1|41139_41616_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_000937603.1|45595_46783_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|46782_47148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012917687.1|47971_49540_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000631725.1|49543_49891_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|49887_50562_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|50615_50843_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|51005_51983_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_085953785.1|52788_54001_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_000937603.1|54626_55814_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001341410.1|55813_55999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158000286.1|56013_56169_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	90.0	6.8e-07
WP_096071227.1|56134_57348_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	2.5e-168
WP_000592771.1|57532_59743_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|59786_60176_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000445934.1|61136_61532_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|61531_62491_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_001431782.1|63229_63667_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086167.1|64050_64734_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.3e-28
WP_001443814.1|64733_64952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|64963_65398_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|65442_65925_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|65921_66641_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|66917_67235_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000117628.1|67696_68197_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_000218854.1|68924_69359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|69451_69718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|69782_70673_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
>prophage 2
NZ_CP027391	Escherichia coli strain 2015C-4944 plasmid unnamed, complete sequence	98724	79120	94566	98724	transposase,protease	Stx2-converting_phage(75.0%)	13	NA	NA
WP_001339397.1|79120_79798_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_085953672.1|80359_81573_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_136138333.1|81571_81985_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_000114001.1|82283_82541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034100.1|82788_86691_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_136139077.1|87628_88048_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001341423.1|87978_88653_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|88649_88997_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_012917687.1|89000_90569_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	56.0	1.0e-158
WP_000937603.1|90847_92035_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|92034_92400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|92636_92984_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000997978.1|93033_94566_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	4.6e-297
