The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	49203	57120	5366577		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|49203_51765_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|51870_52527_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_106888725.1|53342_54122_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	7.5e-70
WP_000847985.1|54317_55226_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|55222_56485_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|56481_57120_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 2
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	322496	365096	5366577	integrase,transposase,protease	Enterobacteria_phage(23.08%)	45	316201:316215	356423:356437
316201:316215	attL	TGTTTCGTGGGACGA	NA	NA	NA	NA
WP_033805219.1|322496_323711_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.9	1.4e-139
WP_000002831.1|324254_324458_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	2.8e-08
WP_106888914.1|325298_325478_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	56.9	2.6e-10
WP_158707283.1|325884_326535_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_106888734.1|326527_326992_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920684.1|326984_327170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157109.1|327169_327373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710171.1|327722_329861_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	1.1e-174
WP_001290239.1|330221_330551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000125512.1|330547_330967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126673.1|330963_331413_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_071777439.1|331532_331877_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	43.8	9.2e-12
WP_000559728.1|331866_332160_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001204826.1|333952_334345_+	antitermination protein	NA	A0A0P0ZCW9	Stx2-converting_phage	89.7	2.0e-63
WP_000379435.1|335176_335551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000676929.1|336268_337879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467446.1|338010_338376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525601.1|338385_338958_+	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_000071534.1|338947_339613_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_000341004.1|339622_339883_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_000503294.1|339884_340652_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_001284704.1|340660_341392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024178273.1|341418_341781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060558.1|341841_342135_-	invasion protein	NA	NA	NA	NA	NA
WP_085949146.1|342380_343653_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_000147021.1|344554_345598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|345989_346415_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|346411_346762_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_085947598.1|347453_348615_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001033855.1|348715_349588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000572543.1|349635_349950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001380823.1|349971_350157_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000377254.1|350209_350704_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000555344.1|351203_352163_-	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_024210746.1|354272_354797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001380818.1|355625_355853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096852933.1|356580_357793_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	98.6	4.2e-168
356423:356437	attR	TGTTTCGTGGGACGA	NA	NA	NA	NA
WP_000253495.1|358825_359209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096852934.1|359301_360478_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.7	2.1e-103
WP_001368194.1|360655_361279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155955724.1|361797_362025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000258197.1|362348_362852_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	33.0	1.7e-06
WP_106888735.1|362845_363394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074015482.1|363851_364310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000705121.1|364409_365096_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	1065312	1119123	5366577	integrase,transposase,tRNA,protease	Morganella_phage(17.65%)	42	1095110:1095126	1125800:1125816
WP_000158702.1|1065312_1066584_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	69.5	3.8e-172
WP_042964799.1|1066679_1067633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380339.1|1067802_1068009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000509393.1|1068105_1068636_+	ash family protein	NA	A0A1W6JPK3	Morganella_phage	47.2	8.5e-25
WP_000916858.1|1068628_1069093_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001203999.1|1069085_1069382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000332872.1|1069374_1069689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204662.1|1069681_1070725_+	topoisomerase	NA	A0A1B0VML8	Pseudomonas_phage	49.5	4.9e-40
WP_000198858.1|1070705_1072544_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	37.1	1.1e-100
WP_001370963.1|1073243_1073534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074017404.1|1073950_1074205_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_050554298.1|1074216_1074513_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001005467.1|1074602_1075010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297374.1|1075889_1076714_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_000924289.1|1077005_1077623_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001368338.1|1077619_1079302_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.9e-22
WP_001295237.1|1079559_1080183_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|1080237_1080513_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|1080531_1082640_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_001070177.1|1082646_1083336_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_000678446.1|1083341_1085423_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000747337.1|1085407_1086274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468836.1|1086276_1087482_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|1087761_1089153_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_001368327.1|1089273_1090983_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702898.1|1091035_1093354_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|1093363_1094746_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
1095110:1095126	attL	TTCGACTCCTGTGATCT	NA	NA	NA	NA
WP_001218908.1|1095432_1096617_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
WP_085948812.1|1096950_1098158_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.0e-97
WP_085949146.1|1098233_1099506_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_062863434.1|1099582_1099855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000264907.1|1099888_1100080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368516.1|1100089_1100455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032308929.1|1100946_1105038_-|protease	serine protease autotransporter EspI	protease	Q9LA58	Enterobacterial_phage	44.5	3.3e-310
WP_000634452.1|1105950_1106688_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001223361.1|1107519_1109607_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	32.2	3.4e-08
WP_000593013.1|1109952_1111797_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
WP_106888751.1|1113165_1114197_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.9	1.4e-18
WP_000916806.1|1114467_1114911_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705929.1|1114926_1115214_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345347.1|1115226_1116483_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001254932.1|1117971_1119123_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
1125800:1125816	attR	TTCGACTCCTGTGATCT	NA	NA	NA	NA
>prophage 4
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	1653863	1722073	5366577	transposase,tRNA	Enterobacteria_phage(15.79%)	56	NA	NA
WP_001295074.1|1653863_1655381_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|1655617_1657075_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295383.1|1657133_1659281_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000092909.1|1659360_1660695_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001187182.1|1661060_1662599_-	DNA-binding transcriptional activator CadC	NA	NA	NA	NA	NA
WP_000779483.1|1663480_1663807_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143297.1|1663803_1664067_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000014511.1|1664138_1665005_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839256.1|1665089_1665287_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761662.1|1665298_1665787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854896.1|1665783_1666161_-	toxin	NA	NA	NA	NA	NA
WP_024175300.1|1666207_1666582_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692358.1|1666744_1666966_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186727.1|1667028_1667505_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214386.1|1667520_1668006_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	9.9e-12
WP_001234751.1|1668095_1668914_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	8.8e-45
WP_001117568.1|1669004_1669238_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_106888762.1|1669308_1672155_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_085949146.1|1672303_1673576_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_000634450.1|1673765_1674503_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001228922.1|1676652_1677789_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	1.8e-117
WP_000401034.1|1677884_1679582_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001032733.1|1679650_1679908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001367551.1|1680128_1680344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071525616.1|1680756_1680948_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878008.1|1681089_1682109_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077633076.1|1682820_1683045_+|transposase	transposase	transposase	A0A1B0Z042	Pseudomonas_phage	58.5	6.6e-11
WP_000977392.1|1685209_1686001_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_000021267.1|1686590_1687220_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.2	3.3e-52
WP_001096212.1|1687401_1689189_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001124813.1|1689375_1690596_-	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	34.6	1.6e-63
WP_000936711.1|1690721_1691552_-	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
WP_001237806.1|1691713_1691902_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000545469.1|1691920_1692493_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001165712.1|1692549_1693026_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	45.9	6.1e-30
WP_000935977.1|1693088_1693295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700770.1|1693422_1694625_-	hypothetical protein	NA	Q9MCI8	Enterobacteria_phage	62.5	1.0e-41
WP_085949146.1|1696292_1697565_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_106888918.1|1698155_1699826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368290.1|1700690_1701938_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000835435.1|1701997_1704145_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	7.7e-24
WP_033806437.1|1704149_1705418_-	TolC family protein	NA	NA	NA	NA	NA
WP_000912969.1|1706913_1707957_+	subtilase AB5 cytotoxin subunit A	NA	NA	NA	NA	NA
WP_024166125.1|1707973_1708396_+	subtilase AB5 cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	44.3	3.6e-26
WP_001367443.1|1708710_1709697_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.5	1.8e-108
WP_001282578.1|1709797_1710532_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_001058128.1|1710567_1711491_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000865294.1|1711552_1712662_-	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001380660.1|1712674_1713385_-	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000948499.1|1713430_1714261_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000376548.1|1714264_1715737_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000629093.1|1715785_1716661_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001149831.1|1716693_1717611_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000224561.1|1718514_1719201_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	39.0	1.9e-29
WP_000005864.1|1719312_1720260_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000998048.1|1720534_1722073_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 5
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	1733379	1744567	5366577		Salmonella_phage(42.86%)	13	NA	NA
WP_032308769.1|1733379_1734768_+	replicative DNA helicase	NA	O80281	Escherichia_phage	49.4	2.6e-113
WP_032308770.1|1734757_1736383_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_032308772.1|1736372_1737104_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_000069531.1|1737100_1737679_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_001682043.1|1737675_1737924_+	hypothetical protein	NA	A0A291LBA3	Klebsiella_phage	45.3	9.2e-06
WP_021564879.1|1737933_1738191_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	78.8	1.9e-30
WP_024235032.1|1738225_1738786_+	ead/Ea22-like family protein	NA	A0A2H4FN96	Salmonella_phage	59.6	3.9e-36
WP_050439478.1|1738782_1739493_+	ead/Ea22-like family protein	NA	A0A076GCN9	Escherichia_phage	73.6	6.3e-15
WP_021564882.1|1739489_1739705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021564883.1|1739701_1739929_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	60.3	1.2e-15
WP_032308773.1|1740191_1741478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032308774.1|1741812_1742532_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_106888763.1|1742554_1744567_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.4	1.2e-39
>prophage 6
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	1860859	1923797	5366577	integrase,transposase,protease	Enterobacteria_phage(50.0%)	59	1887876:1887935	1926938:1927706
WP_000312489.1|1860859_1862119_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|1862121_1863126_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|1863207_1863405_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|1863508_1864807_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|1865011_1865437_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|1865475_1867917_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|1868096_1868828_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|1868954_1869356_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|1869374_1870073_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|1870123_1870783_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|1871577_1871976_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101649.1|1871985_1872624_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_001339483.1|1873862_1875488_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|1875604_1875880_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|1876028_1876358_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569709.1|1876539_1877289_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|1877285_1878041_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|1878148_1879213_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|1879567_1880965_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001368101.1|1880980_1881286_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|1881295_1881760_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|1881773_1882424_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|1882433_1883288_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170810.1|1883287_1883974_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|1884102_1884378_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|1884704_1885100_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|1885106_1885421_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|1885425_1885653_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|1885694_1886144_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000695888.1|1886258_1887230_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074015424.1|1887282_1887864_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
1887876:1887935	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000504878.1|1891339_1892683_+	McrC family protein	NA	NA	NA	NA	NA
WP_000148644.1|1892679_1893066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001040175.1|1893116_1895264_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
WP_000357099.1|1895263_1896790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377420.1|1896807_1898094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000007265.1|1898090_1902377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092642.1|1902387_1903236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004904.1|1903238_1904396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323666.1|1904385_1906071_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001368082.1|1906207_1906621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022619.1|1906617_1908087_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001218329.1|1908287_1909553_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_044815386.1|1909768_1909963_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_106888771.1|1910308_1912642_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|1912656_1912977_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001016257.1|1913099_1913846_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_062895918.1|1913860_1915402_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	8.3e-129
WP_000459302.1|1915698_1916154_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|1916146_1916434_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980250.1|1916426_1917026_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001149160.1|1917022_1917289_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283017.1|1917840_1918575_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	9.4e-131
WP_000638628.1|1918571_1919072_+	transactivation protein	NA	NA	NA	NA	NA
WP_001660389.1|1919145_1919718_+	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000931915.1|1920128_1920530_+	protein gop	NA	NA	NA	NA	NA
WP_001357996.1|1920532_1921600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001357997.1|1921627_1922422_-	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	28.6	8.3e-08
WP_000772677.1|1922528_1923797_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.1e-73
1926938:1927706	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCCGATGGTGTTAGGTCATGAAGTTATCGGTAAAGTTATTCATAGCGACTCATCAGAATTACATGAAGGGCAAACGGTAGCCATTAATCCGTCTAAACCGTGCGGTCACTGCAAATACTGCATTGAACATAACGAGAATCAGTGTACAGAGATGCGTTTTTTTGGCAGTGCCATGTATTTCCCTCATGTTGATGGTGGTTTTACCCGTTATAAAATGGTCGAAACGTCGCAATGTGTCCCTTATCCGGCCAAAGCTGACGAAAAGGTTATGGCTTTTGCCGAACCTTTAGCCGTCGCGATTCATGCCGCACATCAGGCCGGCGAGTTACAGGGCAAGCGAGTATTTATTTCCGGTGTTGGACCCATTGGCTGCCTGATTGTCAGTGCAGTGAAAACACTGGGGGCCGCGGAAATTGTCTGTGCTGATGTGAGTCCCCGTTCCCTTTCGCTGGGCAAAGAGATGGGGGCGGATGTGCTCGTAAACCCACAAAACGACGACATGGATCACTGGAAAGCGGAAAAAGGCTATTTCGATGTCAGCTTTGAAGTGTCCGGTCATCCTTCATCAGTGAATACCTGTCTGGAGGTCACTCGTGCACGCGGCGTAATGGTGCAGGTAGGTATGGGAGGCGCGATGGCAGAATTCCCAATGATGACGTTGATTGGTAAGGAGATTTCACTCAGAGGCTCTTTCCGTTTTACCAGCGAAT	NA	NA	NA	NA
>prophage 7
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	2073289	2158343	5366577	holin,transposase,tRNA,portal,lysis,tail,integrase,protease,terminase	Enterobacteria_phage(32.2%)	90	2067893:2067907	2097089:2097103
2067893:2067907	attL	TGTCGCGGATCTCAT	NA	NA	NA	NA
WP_001218299.1|2073289_2074525_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.0	3.8e-233
WP_000008238.1|2077032_2077569_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	97.2	1.3e-97
WP_000081297.1|2077697_2078522_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000135680.1|2078587_2078950_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001020631.1|2079729_2080422_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	95.7	1.4e-120
WP_001191670.1|2080519_2080780_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
WP_000515856.1|2080772_2081324_+	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	100.0	3.4e-101
WP_001087315.1|2081320_2082484_+	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	79.3	2.4e-168
WP_000620686.1|2082480_2082705_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	91.9	8.5e-35
WP_000995577.1|2082701_2083001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092421.1|2082997_2083981_+	hypothetical protein	NA	Q8SBF1	Shigella_phage	98.1	6.0e-56
WP_072108178.1|2083977_2084472_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	5.6e-87
WP_001359044.1|2084471_2085125_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.8e-126
WP_000210181.1|2085121_2085448_+	LexA family transcriptional regulator	NA	U5P451	Shigella_phage	100.0	9.2e-54
WP_000767110.1|2085444_2085840_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072668.1|2086002_2086818_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.9	3.2e-148
WP_001368056.1|2086825_2087815_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001047117.1|2087828_2088581_+	antitermination protein	NA	Q8SBE4	Shigella_phage	97.6	1.1e-134
WP_001368064.1|2088987_2089947_+	Shiga toxin Stx2b subunit A	NA	G8GYD2	Escherichia_phage	97.5	9.3e-171
WP_000719322.1|2089959_2090223_+	Shiga toxin Stx2b subunit B	NA	G8GYD3	Escherichia_phage	100.0	1.7e-42
WP_106888780.1|2090741_2092718_+	DUF1737 domain-containing protein	NA	S5MDQ7	Escherichia_phage	69.6	1.0e-264
WP_001379752.1|2092868_2093051_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	96.7	2.2e-25
WP_000005635.1|2093076_2093361_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	62.8	3.6e-06
WP_000284505.1|2093436_2093652_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	1.5e-33
WP_001368066.1|2093655_2094213_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	4.3e-51
WP_000551499.1|2094224_2094539_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	77.9	5.0e-41
WP_000992077.1|2094667_2095201_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	6.9e-99
WP_000675930.1|2095421_2095535_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	94.6	1.1e-11
WP_001082509.1|2095536_2096004_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	92.9	2.8e-72
WP_033800741.1|2096027_2096252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373398.1|2096673_2097150_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	98.7	1.8e-82
2097089:2097103	attR	ATGAGATCCGCGACA	NA	NA	NA	NA
WP_001077608.1|2097146_2099270_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|2099266_2099479_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2099478_2100981_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_106888781.1|2100984_2102949_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097064.1|2103036_2103363_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	5.2e-49
WP_106888782.1|2103355_2103637_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	5.1e-45
WP_000974953.1|2103639_2104263_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	99.0	9.8e-105
WP_000682716.1|2104275_2104674_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235131.1|2104681_2105431_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.8	5.6e-131
WP_000479069.1|2105450_2105882_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	6.9e-41
WP_044809160.1|2105908_2106313_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	78.4	9.0e-43
WP_158707276.1|2107256_2107895_+	hypothetical protein	NA	A0A0K2FI43	Enterobacteria_phage	99.1	4.5e-105
WP_158707284.1|2107895_2108897_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	75.4	3.3e-118
WP_000847298.1|2108893_2109223_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001368094.1|2109222_2109921_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	5.6e-133
WP_001380365.1|2109931_2110675_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	2.3e-148
WP_077632782.1|2110620_2111253_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_000078852.1|2115160_2115301_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_106888783.1|2115443_2116844_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	91.6	9.5e-148
WP_001367204.1|2116853_2117078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972077.1|2117074_2117749_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	90.1	1.9e-114
WP_000361566.1|2118123_2119275_+	hypothetical protein	NA	Q9LA53	Enterobacteria_phage	93.1	4.5e-79
WP_000864633.1|2119361_2119835_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	4.8e-88
WP_001217531.1|2120047_2120296_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	84.0	1.3e-31
WP_000202566.1|2120514_2122101_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|2122493_2123099_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|2123225_2123387_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|2123508_2124582_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563058.1|2124578_2125361_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088379.1|2125675_2126539_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143253.1|2126510_2128061_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|2128318_2129098_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477808.1|2129224_2130547_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
WP_000816471.1|2130598_2131822_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224879.1|2131901_2132621_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566150.1|2132781_2133045_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000105851.1|2133076_2134093_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|2134120_2134765_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|2134870_2135839_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|2135887_2137270_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|2137290_2138523_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|2138829_2140497_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|2140707_2142645_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|2142734_2143061_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001297279.1|2143145_2143667_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942344.1|2143718_2144366_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|2144362_2145232_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|2145442_2145916_+	protein CreA	NA	NA	NA	NA	NA
WP_001188666.1|2145928_2146618_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000920308.1|2148100_2149453_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|2149511_2150228_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|2150323_2150464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223164.1|2150863_2151550_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001386572.1|2151763_2151829_+	thr operon leader peptide	NA	NA	NA	NA	NA
WP_001264697.1|2151909_2154372_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_000241660.1|2154373_2155306_+	homoserine kinase	NA	NA	NA	NA	NA
WP_000781063.1|2155306_2156593_+	threonine synthase	NA	NA	NA	NA	NA
WP_000738723.1|2156806_2157103_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000399648.1|2157362_2158343_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	2268717	2354597	5366577	transposase,head,tRNA,plate,tail,integrase,protease	Shigella_phage(53.49%)	91	2263294:2263309	2323822:2323837
2263294:2263309	attL	CGAACACACGCCGCCC	NA	NA	NA	NA
WP_001217338.1|2268717_2269761_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
WP_000077537.1|2270331_2270862_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|2271052_2271301_+	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289282.1|2271302_2273393_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	1.5e-165
WP_000129798.1|2273469_2274402_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	44.1	3.5e-66
WP_000259979.1|2274404_2274626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057198.1|2274638_2274896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032320537.1|2274970_2275243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049300.1|2275247_2275541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129556.1|2275552_2276083_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_001368057.1|2276167_2276746_+	DUF5420 family protein	NA	NA	NA	NA	NA
WP_000564275.1|2276749_2277283_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	68.9	6.3e-68
WP_000465567.1|2277282_2277798_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	52.4	8.0e-44
WP_000973027.1|2277801_2278353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633436.1|2278349_2278682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000409990.1|2278819_2279107_+	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	48.9	1.8e-16
WP_001280089.1|2279087_2279327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032308652.1|2279397_2279910_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	43.1	3.6e-28
WP_000852377.1|2279979_2280405_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125307.1|2280476_2280977_+	lysozyme	NA	I7HDJ5	Xanthomonas_virus	41.9	1.0e-27
WP_122993908.1|2281011_2281440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001122255.1|2281423_2281642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342744.1|2281652_2281880_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|2281860_2282169_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|2282165_2282456_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_001057665.1|2283039_2284704_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532594.1|2284703_2286293_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.3	7.2e-168
WP_000046903.1|2286276_2287608_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.6	3.5e-152
WP_000094812.1|2287729_2288203_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_106888791.1|2288378_2289512_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	52.7	4.6e-92
WP_001142976.1|2289511_2290459_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	65.9	7.4e-120
WP_032182827.1|2290502_2290886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104957.1|2290882_2291302_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	52.9	8.0e-34
WP_000627430.1|2291298_2291862_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	2.2e-42
WP_000207435.1|2291865_2292096_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_032308646.1|2292095_2293577_+|tail	tail protein	tail	A0A0C4UQS0	Shigella_phage	51.1	1.1e-130
WP_000015475.1|2293585_2293951_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000213222.1|2293965_2294442_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	49.2	2.3e-21
WP_001107491.1|2294569_2296624_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	39.4	1.1e-75
WP_000168758.1|2296610_2297969_+	DMT family permease	NA	A0A0C4UR32	Shigella_phage	31.2	4.2e-52
WP_000098563.1|2297952_2299077_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	47.7	3.7e-94
WP_072098124.1|2299066_2299681_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	49.7	8.0e-51
WP_000763303.1|2299673_2300111_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	57.6	1.6e-40
WP_001146842.1|2300110_2301193_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	52.6	1.5e-97
WP_000301574.1|2301183_2301744_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	7.9e-45
WP_096955004.1|2301743_2302640_+|tail	phage tail protein	tail	A0A0C4UQS2	Shigella_phage	58.7	6.9e-27
WP_024178248.1|2302761_2303283_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.0	1.6e-47
WP_077239279.1|2303317_2303662_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	58.9	5.4e-20
WP_000904930.1|2303766_2304327_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_074433801.1|2304426_2306469_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	81.3	1.1e-280
WP_000144787.1|2306616_2306799_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114107.1|2306834_2307080_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001310452.1|2307695_2307896_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528252.1|2307849_2308587_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.5	3.4e-104
WP_062863566.1|2309625_2311011_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_000360902.1|2311020_2311461_-	prepilin peptidase-dependent pilin	NA	NA	NA	NA	NA
WP_001135174.1|2311663_2312557_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_000923735.1|2312644_2313196_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
WP_000172006.1|2313192_2314047_+	beta-lactamase regulator AmpE	NA	NA	NA	NA	NA
WP_000399033.1|2314089_2315460_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
WP_000331776.1|2316003_2316768_+	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000003820.1|2316928_2319592_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000963518.1|2319606_2321499_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_000102485.1|2321823_2323248_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_001389252.1|2323318_2325076_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
2323822:2323837	attR	GGGCGGCGTGTGTTCG	NA	NA	NA	NA
WP_001307570.1|2325430_2328028_+	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_000384306.1|2328203_2328566_+	YacL family protein	NA	NA	NA	NA	NA
WP_000734287.1|2328603_2329398_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000818411.1|2329413_2330280_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_001295568.1|2330385_2330733_-	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_001189600.1|2330898_2332449_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_106888792.1|2332495_2334886_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|2335091_2335628_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|2335668_2336331_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|2336439_2337366_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000972203.1|2337362_2338133_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000901989.1|2338237_2338678_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000277872.1|2338741_2339971_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000621515.1|2339974_2340355_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_001439410.1|2340678_2341530_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.6	6.1e-57
WP_000905383.1|2341603_2342455_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_000805455.1|2342466_2343261_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_158707277.1|2343373_2344648_-	fimbrial-like adhesin	NA	NA	NA	NA	NA
WP_000553764.1|2344700_2345297_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000143205.1|2345323_2345926_-	fimbrial-like protein YadL	NA	NA	NA	NA	NA
WP_000591057.1|2345940_2346510_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000465930.1|2349938_2350679_-	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000038438.1|2350783_2351368_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000215124.1|2351737_2352217_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000174639.1|2352213_2353632_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|2353670_2354597_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	2696471	2774042	5366577	transposase,head,tRNA,portal,lysis,tail,capsid,integrase,protease,terminase	Enterobacteria_phage(52.73%)	81	2719083:2719129	2765516:2765562
WP_001295836.1|2696471_2697095_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|2697065_2697752_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000580859.1|2701048_2702716_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|2702725_2703985_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001301143.1|2703995_2704811_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855361.1|2704807_2705701_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815545.1|2705837_2706905_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001368239.1|2706901_2707411_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|2707528_2708251_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|2708253_2708748_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|2708921_2710307_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|2710342_2710864_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|2710971_2711184_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|2711185_2712052_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001315309.1|2712532_2713075_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|2713294_2713987_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001368238.1|2714017_2716627_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|2716639_2717647_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_024178274.1|2717657_2718173_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|2718175_2718808_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
2719083:2719129	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001298992.1|2719142_2720306_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000433946.1|2720161_2720533_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	82.8	2.5e-47
WP_000206810.1|2720532_2720838_-	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_001242707.1|2720837_2721200_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008165.1|2721190_2721727_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|2721854_2722679_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|2722744_2723107_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|2723577_2724093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|2724307_2724982_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|2725072_2725273_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|2725316_2725874_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|2726049_2726229_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001300314.1|2727157_2727652_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	3.6e-86
WP_000066917.1|2727651_2728305_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210187.1|2728301_2728628_+	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000767117.1|2728624_2729014_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_001061438.1|2729033_2729843_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_001360050.1|2729850_2730840_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001204780.1|2730857_2731241_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|2731430_2732528_-	porin	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|2733116_2733332_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|2733331_2733829_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|2734045_2734228_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|2734318_2734612_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001298896.1|2734902_2735313_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2735598_2735805_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2735969_2736164_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453587.1|2736552_2737098_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_062863639.1|2737072_2738998_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198149.1|2738994_2739201_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001368373.1|2739197_2740799_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	3.2e-309
WP_000123334.1|2740779_2742099_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	3.7e-234
WP_001368365.1|2742108_2742441_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.4e-54
WP_000063218.1|2742496_2743522_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158866.1|2743563_2743959_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	5.2e-59
WP_000785283.1|2743970_2744324_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	96.6	8.4e-61
WP_000985116.1|2744335_2744914_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	7.8e-80
WP_000683105.1|2744910_2745306_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001368370.1|2745313_2746054_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	7.3e-131
WP_000479169.1|2746069_2746492_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_096849140.1|2746518_2746770_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.7	2.6e-40
WP_085947772.1|2746790_2748003_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001167882.1|2748013_2748169_+	hypothetical protein	NA	A0A2R9YJK0	Escherichia_phage	92.3	1.3e-05
WP_000840358.1|2748161_2750723_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.2	0.0e+00
WP_000847345.1|2750719_2751049_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152667.1|2751048_2751747_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
WP_106888803.1|2751751_2752495_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	5.6e-147
WP_071525611.1|2752431_2753064_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	96.7	2.3e-93
WP_000515543.1|2753124_2756523_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_001230388.1|2756589_2757189_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_024178296.1|2757253_2760616_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885603.1|2760615_2761200_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|2761254_2761923_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937515.1|2761979_2762285_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	3.6e-12
WP_001226370.1|2762468_2763953_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201842.1|2764139_2765093_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|2765605_2766367_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
2765516:2765562	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|2766549_2767440_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662373.1|2767440_2770413_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383946.1|2770399_2772637_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420939.1|2772905_2774042_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	3116027	3124428	5366577	integrase	uncultured_Caudovirales_phage(33.33%)	9	3105420:3105434	3130490:3130504
3105420:3105434	attL	GCTAAAACCGCCATC	NA	NA	NA	NA
WP_000188139.1|3116027_3117974_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|3118046_3118271_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_106888809.1|3118675_3119914_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.5	1.2e-125
WP_001206970.1|3120324_3120534_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_106888810.1|3120544_3121801_+	host cell division inhibitor Icd-like protein	NA	Q8W643	Enterobacteria_phage	51.1	6.8e-12
WP_000920685.1|3121793_3121979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000332806.1|3121982_3122192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186248.1|3122236_3122428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833604.1|3122604_3124428_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.5	2.6e-129
3130490:3130504	attR	GCTAAAACCGCCATC	NA	NA	NA	NA
>prophage 11
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	3275460	3342274	5366577	transposase,holin,lysis,tail,capsid,integrase,terminase	Escherichia_phage(62.32%)	75	3271612:3271671	3288486:3289255
3271612:3271671	attL	GGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGG	NA	NA	NA	NA
WP_001368133.1|3275460_3276771_-|integrase	site-specific integrase	integrase	A0A0P0ZGA8	Escherichia_phage	99.8	2.0e-253
WP_001208773.1|3276823_3277108_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_000497816.1|3277153_3277405_-	DUF4222 domain-containing protein	NA	G9L6F5	Escherichia_phage	98.8	5.4e-38
WP_021351637.1|3277392_3277626_-	hypothetical protein	NA	G3CFG9	Escherichia_phage	100.0	2.3e-35
WP_044721833.1|3277769_3278159_-	DUF1627 domain-containing protein	NA	A0A0H4J3B1	Shigella_phage	99.2	4.6e-52
WP_001291843.1|3278194_3278407_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163448.1|3278366_3278993_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_000809302.1|3278989_3279421_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000203832.1|3279476_3280115_-	phage antirepressor Ant	NA	A0A0P0ZG08	Escherichia_phage	99.1	1.2e-118
WP_085949146.1|3281285_3282558_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
WP_106888816.1|3282483_3283110_-	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	88.6	3.7e-51
WP_000476200.1|3283106_3283346_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	1.1e-35
WP_000158004.1|3283338_3283542_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_024178254.1|3283538_3284417_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	97.6	5.7e-175
WP_032344414.1|3284524_3284968_-	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	97.3	2.3e-76
WP_000080417.1|3285044_3285866_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_001071603.1|3285929_3286277_-	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000344637.1|3286351_3286939_-	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_000187063.1|3286938_3287628_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000995348.1|3288646_3288928_-	host nuclease inhibitor GamL	NA	A0A2R2Z319	Escherichia_phage	98.9	1.9e-47
WP_000934192.1|3288948_3289230_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	92.5	2.0e-41
WP_000917251.1|3289241_3289454_-	hypothetical protein	NA	A0A0P0ZGD1	Escherichia_phage	98.6	2.2e-32
3288486:3289255	attR	CCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCCCTTCGCCCATGTCAGCGTTGGTTCAGTTAATGCCTCGCAGAAAAAGCGCTCCTGCTGCTTAACAAATTCAACGATATCGAACATTTTTTTTGTCCTGAAAATCAGAAAGGACAGGGGGAGAATTTTCTCTCCCATTCTTCTTCCGCCCGTGCATAGGCGATCGCTGAGATATAATCGTTGTACGCCTCTTCAGCTTTATCGCCAGTGAGTGCCAGCTGGGCTTCTTTGGGTAAAAAAAGGCTGCTCATAAGCAATGGTTTATCGGGGAACATGCTGATAAGCTCCTGTGCCCGATCGTCAATCCATTTATCCTTTTCATCCTGAATTTGCTGATTAACCCAGCGACGCTCCTCTATGCGGTCGCAGGTGAGGTATGCGTTCATGGCGGAACTCCTGATTCCGGTTAATGCATTAAATTAATTTGTCGGGAAAGCTGACAGACAGGGCAGTTACATTCTTCCTCCTGCTCTTTAGCAAGGAAATATGCAGCGGCCTGTAATGCGATGTCTTCGGGGCGTTCTGTGATAAATATAACATTGCCTTCCGTATCAATAACTGAAATAGCCTCATCAGGCAGGACGACAAAATAGGCGATGATTTTATTATCCATAAAAACTTCTCCCATTATCGTTCCTGCTGGAGTTACGACGCTTTTTGCATTGATATTAATTTTTTGGTTGAGCATGATATTTCCTTTCAGGCTGGCGAGA	NA	NA	NA	NA
WP_158707279.1|3289524_3290307_-	hypothetical protein	NA	A0A0P0ZG86	Escherichia_phage	80.1	1.6e-112
WP_000513533.1|3291058_3291307_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000681611.1|3291303_3291648_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_000081325.1|3291935_3292838_-	serine dehydrogenasease	NA	NA	NA	NA	NA
WP_071525586.1|3293017_3293179_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	92.5	3.6e-19
WP_001056249.1|3293275_3293989_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	99.6	1.8e-131
WP_001240876.1|3294084_3294288_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|3294458_3294653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|3294819_3295197_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_000913118.1|3295190_3296711_+	DEAD/DEAH box helicase	NA	A0A2R2Z335	Escherichia_phage	99.2	3.0e-304
WP_001193568.1|3296700_3297672_+	DNA primase	NA	A0A2R2Z336	Escherichia_phage	96.3	5.5e-187
WP_000402094.1|3297671_3298121_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	99.3	3.8e-82
WP_000813672.1|3298128_3298692_+	bacteriophage lambda NinG family protein	NA	A0A0P0ZG59	Escherichia_phage	99.5	2.0e-104
WP_000144767.1|3298688_3298883_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|3298875_3299310_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_001368310.1|3299816_3300764_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	99.7	2.0e-170
WP_000752026.1|3300773_3301043_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000143459.1|3303623_3303803_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	100.0	2.2e-25
WP_001368314.1|3303843_3304089_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	98.8	7.2e-19
WP_000284510.1|3304166_3304382_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000087455.1|3304386_3304920_+	lysozyme	NA	A0A088CC28	Shigella_phage	100.0	6.0e-103
WP_001056878.1|3305194_3305767_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	100.0	5.1e-108
WP_001368309.1|3305922_3306360_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	98.6	1.0e-71
WP_000644480.1|3306558_3307056_+	DNA-binding protein	NA	Q9AZ05	Salmonella_phage	100.0	3.1e-93
WP_001283921.1|3307052_3307310_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000999684.1|3307535_3307910_+	hypothetical protein	NA	Q716B1	Shigella_phage	74.6	1.4e-42
WP_001086071.1|3308318_3309125_+|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	99.6	1.7e-133
WP_000143996.1|3309105_3310812_+	hypothetical protein	NA	G9L6K0	Escherichia_phage	98.9	0.0e+00
WP_000787037.1|3310811_3312956_+	hypothetical protein	NA	A0A0P0ZG74	Escherichia_phage	99.0	0.0e+00
WP_000345012.1|3313113_3314121_+	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.4	8.8e-180
WP_000214474.1|3314144_3315359_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140444.1|3315414_3315804_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_001367376.1|3315853_3316315_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000207913.1|3316847_3317498_+	hypothetical protein	NA	Q08J85	Stx2-converting_phage	95.8	2.0e-116
WP_106888817.1|3317494_3319576_+|tail	phage tail protein	tail	A0A0P0ZGL7	Escherichia_phage	93.1	1.0e-113
WP_001367204.1|3319585_3319810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888818.1|3319806_3320481_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	89.2	9.0e-112
WP_024199968.1|3321018_3322644_+	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	100.0	0.0e+00
WP_000197192.1|3322640_3323909_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|3323923_3324202_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|3324207_3324825_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835363.1|3324915_3325650_+	Ail/Lom family outer membrane beta-barrel protein	NA	V5URH5	Shigella_phage	100.0	1.3e-135
WP_000078907.1|3325881_3326022_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000710194.1|3326373_3327585_+	hemagglutinin	NA	NA	NA	NA	NA
WP_001380385.1|3327720_3328074_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	99.1	9.9e-62
WP_000509485.1|3328168_3328825_+	hypothetical protein	NA	G3CFP6	Escherichia_phage	100.0	2.4e-109
WP_000455656.1|3328827_3329274_+	hypothetical protein	NA	V5UT82	Shigella_phage	99.3	2.4e-76
WP_000540399.1|3329283_3329556_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	92.3	1.6e-11
WP_000012443.1|3329566_3330832_+	hypothetical protein	NA	Q08J71	Stx2-converting_phage	97.6	8.2e-199
WP_106888819.1|3330901_3339244_+	hypothetical protein	NA	Q08J70	Stx2-converting_phage	95.1	0.0e+00
WP_001273658.1|3340174_3340348_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240631.1|3340430_3341759_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.2	1.9e-230
WP_001028095.1|3341779_3342274_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 12
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	3448750	3524576	5366577	holin,head,tRNA,transposase,tail,capsid,integrase,terminase	Escherichia_phage(42.86%)	91	3440225:3440242	3501279:3501296
3440225:3440242	attL	TGGATGATTTTTCAGATT	NA	NA	NA	NA
WP_044721854.1|3448750_3449308_-	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	66.5	1.8e-49
WP_157911216.1|3449444_3449588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106888821.1|3449584_3450703_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	2.0e-84
WP_000003742.1|3450671_3450941_-	excisionase	NA	NA	NA	NA	NA
WP_106888822.1|3451002_3453390_-	exonuclease	NA	V5UQJ3	Shigella_phage	60.0	1.1e-175
WP_044809962.1|3453430_3453754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044809961.1|3453869_3454094_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	78.1	4.1e-29
WP_033801180.1|3454899_3455115_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	87.5	9.7e-12
WP_062873438.1|3455116_3455272_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	4.4e-06
WP_001444087.1|3455543_3455831_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001090455.1|3455834_3456023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444086.1|3456052_3456460_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047654503.1|3456567_3456846_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	42.3	7.4e-12
WP_106888823.1|3456829_3457351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|3457331_3458297_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_106888824.1|3458303_3459044_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	85.0	9.2e-118
WP_106888825.1|3459069_3459825_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.3	2.6e-75
WP_000702797.1|3459846_3460071_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_106888826.1|3460067_3460424_+	eae-like protein	NA	A0A222YY85	Escherichia_phage	64.4	2.7e-14
WP_106888827.1|3460433_3460610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273106.1|3460606_3460918_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_106888828.1|3461044_3461608_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	93.9	1.7e-47
WP_001278460.1|3461717_3461822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032152334.1|3462009_3462222_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.6e-27
WP_062883712.1|3462389_3462668_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	57.4	6.0e-14
WP_106888829.1|3462669_3463728_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	3.6e-91
WP_106888830.1|3463728_3464094_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.8e-37
WP_000640044.1|3464102_3464663_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.6e-67
WP_000917768.1|3464879_3465077_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_106888831.1|3465227_3466286_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	92.9	1.5e-193
WP_106888832.1|3466669_3467629_+	Shiga toxin Stx2 subunit A	NA	G8GYD2	Escherichia_phage	98.1	2.4e-171
WP_000719322.1|3467641_3467905_+	Shiga toxin Stx2b subunit B	NA	G8GYD3	Escherichia_phage	100.0	1.7e-42
WP_106888833.1|3468427_3470383_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	75.8	1.5e-287
WP_106888834.1|3470533_3470716_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	98.3	2.9e-25
WP_106888835.1|3470741_3471026_+	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	62.8	6.2e-06
WP_000284506.1|3471102_3471318_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001015165.1|3471321_3471963_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	82.3	2.1e-65
WP_001371270.1|3471990_3472218_+	DUF1327 domain-containing protein	NA	Q5G8W5	Enterobacteria_phage	50.7	4.6e-12
WP_000406285.1|3472222_3472510_-	hypothetical protein	NA	I6S632	Salmonella_phage	55.8	1.4e-21
WP_001092887.1|3472634_3473168_+	lysozyme	NA	G9L6J6	Escherichia_phage	95.5	1.4e-99
WP_001280925.1|3473523_3473655_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	7.2e-10
WP_000650395.1|3473662_3474598_+	site-specific DNA-methyltransferase	NA	A0A088FRS2	Escherichia_phage	54.8	9.9e-93
WP_071852370.1|3474814_3475000_+	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	1.4e-19
WP_000735659.1|3475085_3475310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828070.1|3475654_3475981_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|3476112_3476313_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_033883566.1|3476354_3476720_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	2.1e-62
WP_000958372.1|3477009_3477573_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_033883565.1|3477569_3479231_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173022.1|3479294_3481232_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001063099.1|3481276_3481498_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126002.1|3484025_3484352_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	99.1	1.6e-53
WP_001007900.1|3484361_3484712_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	98.3	1.7e-58
WP_000573400.1|3484708_3485155_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	98.6	9.9e-75
WP_000133388.1|3485151_3485496_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_033883560.1|3485562_3486279_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	1.4e-126
WP_000710952.1|3486293_3486668_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001513217.1|3486763_3486973_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_062891024.1|3487020_3490263_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807934.1|3490255_3490597_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	93.8	2.6e-59
WP_021565053.1|3492165_3492864_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	95.7	2.7e-127
WP_106888836.1|3492874_3493618_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	96.4	7.3e-147
WP_134793502.1|3493563_3494196_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.4	1.6e-102
WP_000078854.1|3498371_3498512_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.2e-17
WP_106888837.1|3498654_3500391_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	96.8	4.2e-169
WP_096853638.1|3500454_3501126_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	92.4	1.0e-115
WP_106888838.1|3501289_3501619_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
3501279:3501296	attR	TGGATGATTTTTCAGATT	NA	NA	NA	NA
WP_000799399.1|3501785_3502649_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|3502632_3503769_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|3504018_3505248_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|3505393_3506515_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_106888839.1|3506590_3508051_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|3508050_3508722_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|3508889_3510260_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|3510263_3510905_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|3510940_3512047_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|3512100_3512562_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|3512571_3513225_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|3513396_3514647_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|3514749_3515073_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|3515605_3515716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|3515768_3516173_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|3516393_3517125_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_001299269.1|3517329_3518541_-	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000554144.1|3518854_3519091_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
WP_000857995.1|3519133_3519406_+	two-component-system connector protein YmgA	NA	NA	NA	NA	NA
WP_000888772.1|3519434_3519701_+	biofilm/acid-resistance regulator AriR	NA	NA	NA	NA	NA
WP_001065752.1|3519813_3520062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001246498.1|3520393_3521917_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_001299921.1|3522824_3523043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949146.1|3523303_3524576_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	2.3e-172
>prophage 13
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	3625740	3705040	5366577	transposase,holin,head,tail,capsid,integrase,protease,terminase	Escherichia_phage(35.09%)	83	3624898:3624914	3683985:3684001
3624898:3624914	attL	GTATTACCGTGAAGGAG	NA	NA	NA	NA
WP_062895918.1|3625740_3627282_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.3	8.3e-129
WP_074015438.1|3627460_3628348_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001368012.1|3628438_3629158_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|3629197_3629596_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808667.1|3629700_3630240_-	septation protein A	NA	NA	NA	NA	NA
WP_000028551.1|3630269_3631013_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000737218.1|3631369_3632023_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113692.1|3632068_3633208_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.7	8.3e-102
WP_000113186.1|3633185_3633434_-	excisionase	NA	NA	NA	NA	NA
WP_001033168.1|3633498_3635970_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.9	5.3e-53
WP_000199470.1|3636065_3636254_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450223.1|3636250_3636439_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000389971.1|3636966_3637152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693933.1|3638083_3638521_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	54.4	1.0e-28
WP_000729531.1|3638607_3639618_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.2	1.4e-169
WP_157911324.1|3639529_3640072_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	2.8e-79
WP_000450613.1|3640105_3640822_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	2.8e-71
WP_074015058.1|3640854_3641136_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	71.4	2.8e-27
WP_001266017.1|3641132_3641438_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.9	1.7e-49
WP_000014352.1|3641424_3641769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001368005.1|3641770_3642139_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	62.1	1.8e-29
WP_000567227.1|3642135_3642489_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	62.5	5.1e-34
WP_000902691.1|3642722_3642935_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.9	6.9e-18
WP_000756598.1|3643056_3643401_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	97.4	1.8e-55
WP_000191873.1|3643523_3643796_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	54.7	5.0e-13
WP_001265191.1|3643797_3644847_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	8.2e-112
WP_001217428.1|3644859_3645222_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.1e-35
WP_001064919.1|3645214_3645904_+	antiterminator	NA	I6PDF8	Cronobacter_phage	47.2	3.5e-55
WP_071525566.1|3646097_3646499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134790173.1|3646624_3646822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917743.1|3646841_3647039_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000231840.1|3649389_3650325_+	SAM-dependent DNA methyltransferase	NA	A0A0M3LQ47	Mannheimia_phage	42.5	3.0e-41
WP_096849131.1|3651350_3653318_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	67.8	4.4e-252
WP_000143455.1|3653468_3653648_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.1e-24
WP_001290220.1|3653688_3653934_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	92.6	1.5e-16
WP_000284510.1|3654010_3654226_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_106888843.1|3654229_3655219_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	63.5	5.4e-105
WP_001092904.1|3655255_3655789_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.0	3.6e-100
WP_052834940.1|3655945_3656128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3657273_3657480_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_001170911.1|3657544_3657769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828070.1|3658119_3658446_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000095744.1|3658577_3658778_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000829192.1|3658819_3659185_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958383.1|3659475_3660039_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	97.9	4.4e-88
WP_001380454.1|3660035_3661697_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.6	0.0e+00
WP_000173022.1|3661760_3663698_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001063099.1|3663742_3663964_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125999.1|3666652_3666979_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	99.1	2.7e-53
WP_001007908.1|3666988_3667339_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000573391.1|3667335_3667782_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133378.1|3667778_3668123_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	3.2e-57
WP_001275449.1|3668188_3668905_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.2	4.0e-126
WP_000710935.1|3668919_3669294_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	1.7e-64
WP_122993918.1|3669389_3669599_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	97.1	7.4e-33
WP_000212870.1|3669646_3672889_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	89.6	0.0e+00
WP_000343410.1|3672881_3673223_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_001379814.1|3673430_3674576_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.7	1.3e-139
WP_001152196.1|3674785_3675484_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	98.3	1.2e-132
WP_033882927.1|3675494_3676238_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	98.4	9.2e-150
WP_122995430.1|3676183_3676816_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.5	1.1e-100
WP_106888844.1|3677529_3681003_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	91.5	0.0e+00
WP_000078852.1|3681201_3681342_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_106888845.1|3681484_3683212_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.6	6.5e-231
WP_000547695.1|3683253_3683925_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	98.6	2.5e-122
WP_024213780.1|3684330_3685575_+	hypothetical protein	NA	Q9LA60	Enterobacterial_phage	55.6	3.4e-80
3683985:3684001	attR	CTCCTTCACGGTAATAC	NA	NA	NA	NA
WP_000864633.1|3685661_3686135_+	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	4.8e-88
WP_089610354.1|3690920_3691079_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	74.5	5.5e-12
WP_001079504.1|3691412_3691919_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|3691964_3692465_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|3692550_3692730_-	general stress protein	NA	NA	NA	NA	NA
WP_000443056.1|3693110_3693917_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|3693916_3695110_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001368015.1|3695121_3696480_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|3696483_3698079_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194611.1|3698078_3699641_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3699732_3699777_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|3699914_3700796_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3700792_3701413_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|3701513_3702386_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|3702425_3703016_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559291.1|3703012_3703771_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	2.0e-06
WP_000422045.1|3703990_3705040_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 14
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	4008354	4021338	5366577	terminase,capsid,head,protease	uncultured_Caudovirales_phage(87.5%)	18	NA	NA
WP_001260840.1|4008354_4009176_+|protease	serine protease	protease	NA	NA	NA	NA
WP_062863622.1|4009265_4009544_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|4009530_4009896_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|4010002_4010173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001364204.1|4010756_4010915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133415.1|4011063_4011345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127881.1|4011358_4013020_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	2.0e-277
WP_000089568.1|4013003_4013360_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.5	2.1e-51
WP_001145908.1|4013649_4014090_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	67.8	7.8e-56
WP_033882701.1|4014089_4014383_-	bacteriophage protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	64.9	8.0e-33
WP_016241300.1|4014379_4014718_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	51.8	2.5e-30
WP_001475696.1|4015928_4016486_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	64.1	4.1e-62
WP_001137341.1|4016541_4017699_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_000233314.1|4018003_4018252_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126675.1|4018262_4018673_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001294165.1|4018682_4018988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164428.1|4018984_4019236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761829.1|4019583_4021338_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.3	2.1e-91
>prophage 15
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	4146205	4193226	5366577	holin,head,tRNA,portal,plate,tail,capsid,integrase,terminase	Enterobacteria_phage(75.51%)	60	4148608:4148632	4185867:4185891
WP_000029466.1|4146205_4146955_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|4146954_4147506_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|4147568_4148549_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
4148608:4148632	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000416304.1|4148738_4149134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057728563.1|4149144_4150080_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	7.4e-80
WP_000021112.1|4150168_4150480_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	49.5	8.3e-20
WP_001151412.1|4150575_4150854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917795.1|4150868_4151207_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_000158971.1|4151217_4151505_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|4151516_4151759_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021668.1|4151755_4151869_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|4151955_4152159_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_024230414.1|4152155_4152401_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	87.7	5.5e-35
WP_033806520.1|4152542_4152908_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.1e-60
WP_033806519.1|4152914_4155737_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.4	0.0e+00
WP_033806518.1|4155813_4156773_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_033806517.1|4156777_4157089_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	49.0	2.7e-15
WP_033806516.1|4157302_4158358_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	39.2	8.1e-67
WP_024181078.1|4158335_4158713_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	50.8	4.8e-30
WP_001407222.1|4159619_4160144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407221.1|4160158_4161205_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	5.0e-202
WP_033806515.1|4161204_4162956_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262688.1|4163110_4163947_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.5e-119
WP_001055107.1|4163970_4165023_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	3.9e-194
WP_033806513.1|4165068_4165869_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	87.6	4.2e-124
WP_012907687.1|4165971_4166466_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.0e-88
WP_000864897.1|4166465_4166666_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_012907686.1|4166668_4166992_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	91.6	2.4e-46
WP_032152536.1|4167046_4167592_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	87.7	2.2e-92
WP_033806512.1|4167588_4167996_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	8.8e-62
WP_000920594.1|4168133_4168601_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_033806511.1|4168593_4169229_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	3.1e-114
WP_001271938.1|4169225_4169807_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	2.9e-103
WP_033806510.1|4169803_4170154_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	2.0e-59
WP_033806509.1|4170157_4171045_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.0	1.5e-151
WP_033806508.1|4171037_4171568_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	96.3	6.9e-91
WP_106888862.1|4171570_4173535_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	58.0	5.0e-195
WP_000972170.1|4173537_4174071_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	99.4	5.5e-96
WP_033806505.1|4174099_4174627_-|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	96.0	5.2e-91
WP_106888863.1|4174630_4175539_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	94.7	4.2e-165
WP_033806503.1|4176474_4177074_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	96.7	1.0e-95
WP_000979945.1|4177100_4177589_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_096849247.1|4177601_4180409_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.0	0.0e+00
WP_000333503.1|4180395_4180551_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|4180559_4180934_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_106888864.1|4180989_4181502_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.7e-92
WP_021545631.1|4181501_4182686_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.2	1.2e-220
WP_033806412.1|4182843_4183953_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	6.3e-195
WP_000488108.1|4183995_4184256_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032140709.1|4184447_4184588_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	65.2	3.8e-09
WP_001353016.1|4184837_4185035_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_033806411.1|4184979_4185771_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	3.3e-65
WP_001229265.1|4185908_4186208_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
4185867:4185891	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672381.1|4186212_4188600_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|4188614_4189598_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|4189881_4189926_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|4190048_4190405_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|4190457_4190655_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|4190751_4191294_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|4191297_4193226_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 16
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	4298006	4388479	5366577	integrase,head,tRNA,portal,lysis,tail,capsid,terminase,protease,holin	Enterobacteria_phage(33.33%)	106	4317878:4317893	4391234:4391249
WP_000984517.1|4298006_4298888_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_106888866.1|4299079_4301128_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
WP_000431370.1|4301147_4301846_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|4301942_4302440_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001542926.1|4302569_4303853_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|4303821_4306455_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001295499.1|4308090_4308327_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|4308431_4308623_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|4308623_4309280_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|4309675_4310017_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879285.1|4310029_4310902_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|4310905_4311280_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4311418_4311649_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|4311750_4312407_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4312430_4313093_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_032308998.1|4313089_4315150_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|4315358_4316018_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|4316344_4316701_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|4316767_4317058_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173474.1|4317191_4318370_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
4317878:4317893	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
WP_000800512.1|4318425_4319067_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069469.1|4319103_4320915_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|4321149_4322625_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056706.1|4322962_4323832_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091148.1|4323959_4325402_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|4325532_4326504_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|4326623_4327946_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|4327961_4328894_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4328972_4329728_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|4329724_4330510_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4330656_4331667_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4331675_4332287_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|4332425_4332491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024954.1|4332561_4333164_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_106888867.1|4333165_4333687_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|4333721_4334462_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|4334490_4334943_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|4335060_4336833_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016232182.1|4338063_4338312_+	DinI-like family protein	NA	H6WZN4	Escherichia_phage	80.2	1.6e-29
WP_158707282.1|4338348_4338522_-	hypothetical protein	NA	A0A2L1IV33	Escherichia_phage	65.5	7.1e-13
WP_032217753.1|4338526_4339000_-	hypothetical protein	NA	Q9LA59	Enterobacterial_phage	94.2	1.8e-79
WP_032217750.1|4339088_4340363_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	47.7	1.3e-74
WP_106888869.1|4341169_4341841_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	85.5	3.3e-106
WP_106888870.1|4341904_4343347_-|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	99.1	5.0e-59
WP_106888871.1|4343531_4347062_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	82.8	0.0e+00
WP_158707286.1|4347317_4347950_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	3.2e-103
WP_032308822.1|4347895_4348639_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	7.7e-149
WP_106888873.1|4348649_4349348_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	2.4e-128
WP_000847280.1|4349347_4349677_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_032308824.1|4349673_4352247_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.9	0.0e+00
WP_000533428.1|4352227_4352641_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	86.9	2.9e-44
WP_032217777.1|4352667_4353099_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	66.7	5.3e-41
WP_016232503.1|4353112_4353865_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.0	3.1e-129
WP_000683079.1|4353872_4354268_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|4354264_4354798_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|4354813_4355167_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|4355159_4355543_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522592.1|4355594_4356623_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_000256795.1|4356680_4357028_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_032308826.1|4357064_4358570_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.2e-100
WP_062895700.1|4358559_4360152_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.7	1.3e-185
WP_000258993.1|4360148_4360355_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_042200580.1|4360338_4362267_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.9e-261
WP_000235436.1|4362238_4362748_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_033800741.1|4363203_4363428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082509.1|4363451_4363919_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	92.9	2.8e-72
WP_000675930.1|4363920_4364034_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	94.6	1.1e-11
WP_000992077.1|4364254_4364788_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	95.5	6.9e-99
WP_000551499.1|4364916_4365231_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	77.9	5.0e-41
WP_001368066.1|4365242_4365800_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	4.3e-51
WP_000284505.1|4365803_4366019_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	98.6	1.5e-33
WP_024185460.1|4366094_4366385_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	68.8	1.7e-06
WP_024185459.1|4366410_4366605_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	1.2e-21
WP_062857750.1|4366745_4368728_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	58.7	5.7e-215
WP_016232130.1|4369311_4369509_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	1.0e-28
WP_087900278.1|4369713_4370109_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	92.9	2.9e-62
WP_024185495.1|4370123_4371113_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.3	1.7e-191
WP_001072669.1|4371120_4371936_-	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_000767110.1|4372098_4372494_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_000210152.1|4372490_4372817_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_001409632.1|4372813_4373467_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.8e-126
WP_012601564.1|4373466_4373961_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	87.2	1.5e-76
WP_000092422.1|4373957_4374941_-	hypothetical protein	NA	Q8SBF1	Shigella_phage	97.2	1.7e-55
WP_000995577.1|4374937_4375237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000620699.1|4375233_4375458_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	91.9	5.0e-35
WP_001530587.1|4375454_4376603_-	rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	86.7	2.3e-176
WP_000515860.1|4376599_4377151_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001191670.1|4377143_4377404_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	100.0	1.6e-40
WP_032151347.1|4377501_4378194_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	1.1e-120
WP_000135680.1|4378917_4379280_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_106888876.1|4379345_4380170_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	1.3e-149
WP_000008178.1|4380297_4380834_+	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	99.4	2.2e-100
WP_106888877.1|4380824_4381187_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	96.7	5.8e-65
WP_000111289.1|4381183_4381387_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_021524341.1|4381379_4381619_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	94.9	2.0e-34
WP_021524342.1|4381615_4382164_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	94.1	1.0e-57
WP_001229189.1|4382165_4382681_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	97.7	2.3e-99
WP_000628771.1|4382677_4383436_+	phage protein	NA	A0A1U9AJ59	Stx1_converting_phage	82.4	1.6e-109
WP_000457723.1|4383520_4383763_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001030156.1|4383766_4383913_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000528718.1|4383921_4384158_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_000362005.1|4384213_4385527_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_048818231.1|4385508_4386279_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252979.1|4386331_4386727_+	membrane protein	NA	NA	NA	NA	NA
WP_000019584.1|4386767_4387511_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|4387507_4388479_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
4391234:4391249	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
>prophage 17
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	4634461	4643902	5366577		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|4634461_4635598_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|4635594_4637595_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|4637719_4638181_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|4638220_4638691_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|4638737_4639457_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4639453_4641139_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4641360_4642092_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|4642151_4642259_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4642239_4642971_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|4642975_4643902_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 18
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	4751550	4820369	5366577	integrase,transposase,capsid,holin	Escherichia_phage(46.3%)	59	4762688:4762702	4823208:4823222
WP_106888886.1|4751550_4755543_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	93.0	0.0e+00
WP_000864633.1|4755914_4756388_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	98.7	4.8e-88
WP_033806686.1|4756474_4757491_-	hypothetical protein	NA	Q9LA60	Enterobacterial_phage	48.9	4.7e-56
WP_106888887.1|4757851_4766230_-	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	96.4	0.0e+00
4762688:4762702	attL	GTCGCGGTTGGTGGC	NA	NA	NA	NA
WP_000012443.1|4766299_4767565_-	hypothetical protein	NA	Q08J71	Stx2-converting_phage	97.6	8.2e-199
WP_000540399.1|4767575_4767848_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	92.3	1.6e-11
WP_000455656.1|4767857_4768304_-	hypothetical protein	NA	V5UT82	Shigella_phage	99.3	2.4e-76
WP_000509485.1|4768306_4768963_-	hypothetical protein	NA	G3CFP6	Escherichia_phage	100.0	2.4e-109
WP_001380385.1|4769057_4769411_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	99.1	9.9e-62
WP_106888888.1|4769546_4770740_-	hemagglutinin	NA	NA	NA	NA	NA
WP_000078907.1|4771090_4771231_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000197193.1|4771432_4773199_-	DUF1983 domain-containing protein	NA	A0A2R2Z364	Escherichia_phage	96.6	2.7e-192
WP_106888889.1|4773195_4774821_-	hypothetical protein	NA	G9L6L3	Escherichia_phage	97.0	0.0e+00
WP_000864635.1|4775170_4775644_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	89.2	5.4e-79
WP_001368540.1|4775732_4776848_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	58.6	3.9e-88
WP_001100187.1|4777655_4778237_-	DUF4376 domain-containing protein	NA	Q9MCI9	Enterobacteria_phage	92.7	6.4e-98
WP_106888890.1|4778252_4780316_-	hypothetical protein	NA	A0A2L1IV40	Escherichia_phage	97.2	1.3e-63
WP_000207914.1|4780312_4780963_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	95.3	7.6e-116
WP_000829201.1|4780962_4781526_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_001367376.1|4781509_4781971_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_001140444.1|4782020_4782410_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|4782465_4783680_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_062874436.1|4783703_4784120_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.3	5.8e-69
WP_106888891.1|4784277_4784712_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.2e-71
WP_000787037.1|4784869_4787014_-	hypothetical protein	NA	A0A0P0ZG74	Escherichia_phage	99.0	0.0e+00
WP_000143996.1|4787013_4788720_-	hypothetical protein	NA	G9L6K0	Escherichia_phage	98.9	0.0e+00
WP_001086080.1|4788700_4789552_-	hypothetical protein	NA	A0A2L1IV66	Escherichia_phage	80.9	1.9e-95
WP_012816804.1|4790633_4790819_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000087720.1|4791370_4791904_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	3.3e-101
WP_000284510.1|4791908_4792124_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290232.1|4792200_4792473_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	97.8	7.2e-20
WP_032320589.1|4792498_4792681_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	88.3	2.3e-22
WP_062872599.1|4792826_4794866_-	DUF1737 domain-containing protein	NA	A0A0P0ZGE0	Escherichia_phage	62.7	2.5e-237
WP_106888892.1|4796289_4796934_-	type II restriction endonuclease subunit M	NA	NA	NA	NA	NA
WP_024178293.1|4797740_4799699_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	36.6	3.3e-82
WP_106888893.1|4800940_4801366_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	66.7	2.2e-47
WP_001561701.1|4801444_4802308_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	80.4	1.2e-132
WP_000844634.1|4802307_4803276_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	81.4	1.0e-156
WP_106888894.1|4803277_4804936_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	77.5	1.6e-258
WP_001271873.1|4804969_4805338_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	68.9	1.2e-41
WP_000349381.1|4806214_4806874_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	49.1	4.7e-49
WP_000107960.1|4806959_4807337_+	helix-turn-helix transcriptional regulator	NA	Q8W649	Enterobacteria_phage	57.9	1.6e-17
WP_000781554.1|4807338_4807530_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	96.8	1.5e-27
WP_000856688.1|4807526_4807727_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	80.3	2.4e-20
WP_000651133.1|4807901_4808264_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	70.0	1.5e-36
WP_000657001.1|4808671_4809232_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	46.2	3.3e-19
WP_000127373.1|4809218_4809803_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.6	2.7e-32
WP_000749823.1|4809826_4810693_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	72.6	4.8e-118
WP_000998048.1|4810952_4812491_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612589.1|4812540_4812888_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_001171530.1|4812884_4813265_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.6e-65
WP_000587146.1|4813514_4813739_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	67.1	9.5e-18
WP_000656486.1|4813735_4814638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000504369.1|4814630_4814873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078339.1|4814893_4815040_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	72.9	1.5e-16
WP_000447742.1|4815047_4815302_+	DUF1233 family excisionase	NA	Q859D3	Escherichia_coli_phage	84.5	4.6e-37
WP_000063634.1|4815335_4816625_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	73.2	1.9e-187
WP_001061917.1|4816669_4817320_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_000876014.1|4817519_4820369_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
4823208:4823222	attR	GCCACCAACCGCGAC	NA	NA	NA	NA
>prophage 19
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	4957829	5022732	5366577	integrase,capsid,holin	Escherichia_phage(80.6%)	68	4972314:4972373	5034309:5035078
WP_000368131.1|4957829_4958762_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_062863647.1|4958983_4967362_-	hypothetical protein	NA	A0A2R2Z366	Escherichia_phage	95.8	0.0e+00
WP_106888898.1|4967446_4968709_-	hypothetical protein	NA	A0A2R2Z372	Escherichia_phage	87.4	7.6e-197
WP_000540393.1|4968719_4968971_-	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_062891065.1|4968980_4969427_-	hypothetical protein	NA	A0A2L1IV89	Escherichia_phage	99.3	8.9e-76
WP_106888899.1|4969429_4970086_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	99.1	6.9e-109
WP_001380385.1|4970180_4970534_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	99.1	9.9e-62
WP_106888888.1|4970669_4971863_-	hemagglutinin	NA	NA	NA	NA	NA
WP_106888900.1|4972213_4972321_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	1.3e-12
4972314:4972373	attL	GTGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTG	NA	NA	NA	NA
WP_000197193.1|4973332_4975099_-	DUF1983 domain-containing protein	NA	A0A2R2Z364	Escherichia_phage	96.6	2.7e-192
WP_106888901.1|4975095_4976721_-	hypothetical protein	NA	G9L6L3	Escherichia_phage	94.5	8.3e-305
WP_000864635.1|4977070_4977544_-	hypothetical protein	NA	Q9LA52	Enterobacteria_phage	89.2	5.4e-79
WP_000037410.1|4977632_4978766_-	hypothetical protein	NA	A0A2L1IV32	Escherichia_phage	52.1	2.2e-70
WP_062872600.1|4979258_4979924_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	88.6	1.6e-108
WP_000117974.1|4980195_4981992_-	hypothetical protein	NA	A0A1I9LJS9	Stx_converting_phage	100.0	9.2e-63
WP_000207914.1|4981988_4982639_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	95.3	7.6e-116
WP_000829201.1|4982638_4983202_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	99.5	9.2e-102
WP_001367376.1|4983185_4983647_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_001140444.1|4983696_4984086_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_000214474.1|4984141_4985356_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_000345012.1|4985379_4986387_-	hypothetical protein	NA	Q08J90	Stx2-converting_phage	99.4	8.8e-180
WP_000787037.1|4986544_4988689_-	hypothetical protein	NA	A0A0P0ZG74	Escherichia_phage	99.0	0.0e+00
WP_000143996.1|4988688_4990395_-	hypothetical protein	NA	G9L6K0	Escherichia_phage	98.9	0.0e+00
WP_001086080.1|4990375_4991227_-	hypothetical protein	NA	A0A2L1IV66	Escherichia_phage	80.9	1.9e-95
WP_012816804.1|4992308_4992494_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000087720.1|4993045_4993579_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	97.7	3.3e-101
WP_000284510.1|4993583_4993799_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290232.1|4993875_4994148_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	97.8	7.2e-20
WP_032320589.1|4994173_4994356_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	88.3	2.3e-22
WP_062872599.1|4994501_4996541_-	DUF1737 domain-containing protein	NA	A0A0P0ZGE0	Escherichia_phage	62.7	2.5e-237
WP_062863667.1|4997323_4997476_-	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	98.0	8.9e-20
WP_062863668.1|4997940_4998771_-	molecular chaperone	NA	A0A1B5FPA5	Escherichia_phage	88.0	7.6e-129
WP_032308962.1|4998806_4999001_-	protein ninH	NA	G9L694	Escherichia_phage	96.9	7.1e-30
WP_106888902.1|4998997_4999561_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	97.9	8.3e-103
WP_000402092.1|4999568_5000018_-	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_032274376.1|5000017_5000989_-	DNA primase	NA	A0A0H4IPK0	Shigella_phage	99.7	9.4e-195
WP_032274375.1|5000978_5002499_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	98.8	8.6e-304
WP_000470023.1|5002492_5002879_-	hypothetical protein	NA	A0A286S263	Klebsiella_phage	44.8	2.6e-23
WP_001240875.1|5003412_5003616_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	98.5	9.8e-30
WP_001056250.1|5003711_5004425_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_032274372.1|5004519_5005989_+	SAM-dependent methyltransferase	NA	A0A2L1IV91	Escherichia_phage	99.4	4.3e-284
WP_106888903.1|5005985_5006939_+	restriction endonuclease	NA	A0A0P0ZG22	Escherichia_phage	99.7	6.0e-186
WP_106888904.1|5007660_5008446_+	hypothetical protein	NA	A0A0P0ZGC2	Escherichia_phage	86.6	3.7e-125
WP_000917252.1|5008516_5008729_+	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_032274367.1|5008740_5009022_+	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.9	8.7e-45
WP_044191085.1|5009042_5009324_+	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	98.9	4.2e-47
WP_062863456.1|5009340_5010291_+	recombinase RecT	NA	A0A0P0ZFY9	Escherichia_phage	95.9	4.9e-172
WP_000187063.1|5010287_5010977_+	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000344637.1|5010976_5011564_+	hypothetical protein	NA	A0A0N7KZV4	Escherichia_phage	100.0	1.2e-107
WP_001071603.1|5011638_5011986_+	hypothetical protein	NA	A0A0P0ZGH3	Escherichia_phage	100.0	5.9e-59
WP_000080417.1|5012049_5012871_+	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_032308967.1|5012947_5013391_+	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	98.0	3.6e-77
WP_062863458.1|5013498_5014377_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	98.6	1.2e-177
WP_000157000.1|5014373_5014577_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	100.0	4.7e-32
WP_062863459.1|5014569_5014809_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	98.7	5.2e-38
WP_032308884.1|5014805_5015699_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	91.7	2.3e-163
WP_032298844.1|5015805_5016420_+	DUF551 domain-containing protein	NA	H6WZG0	Escherichia_phage	49.8	3.3e-44
WP_000002114.1|5016412_5016697_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	95.7	5.0e-48
WP_001451754.1|5016931_5017501_+	hypothetical protein	NA	A0A0N7BS22	Escherichia_phage	100.0	7.3e-99
WP_001451755.1|5017938_5018136_-	hypothetical protein	NA	A0A0N7BYR2	Escherichia_phage	100.0	4.1e-33
WP_001260981.1|5018264_5018522_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	98.8	2.8e-37
WP_000211992.1|5018846_5019524_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	100.0	1.3e-123
WP_000809302.1|5019579_5020011_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000163448.1|5020007_5020634_+	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_016232247.1|5020593_5020806_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	98.6	2.7e-30
WP_106888905.1|5020841_5021318_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	79.1	3.2e-47
WP_000453637.1|5021396_5021579_+	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_032308540.1|5021562_5022732_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	99.7	4.8e-230
5034309:5035078	attR	GTGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTATGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGTCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
>prophage 20
NZ_CP027340	Escherichia coli strain 2015C-3121 chromosome, complete genome	5366577	5256535	5338145	5366577	integrase,transposase,head,tRNA,portal,lysis,plate,tail,capsid,terminase	Salmonella_phage(69.23%)	88	5301206:5301251	5335448:5335493
WP_001298974.1|5256535_5257273_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|5257404_5258739_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|5258947_5259829_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|5259931_5260519_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|5260574_5260958_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|5261262_5261952_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_106888910.1|5261999_5263037_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|5263243_5263663_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001343689.1|5263731_5264430_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082950.1|5264461_5267122_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|5267235_5268591_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|5268637_5268961_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001235102.1|5276893_5279467_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|5279596_5280328_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|5280324_5281305_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|5281439_5282177_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|5282447_5282789_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|5282892_5282940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|5283038_5284199_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|5284241_5285363_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|5285373_5286444_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_001368400.1|5286653_5287019_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212408.1|5287168_5287687_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969014.1|5287676_5288903_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|5288918_5289401_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|5289477_5289825_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|5289866_5290634_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|5290664_5291213_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|5291231_5291480_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|5291728_5293090_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|5293256_5294048_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|5294068_5295355_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|5295409_5296003_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|5296125_5297004_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|5297089_5298751_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|5298899_5299241_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|5299302_5299593_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|5299582_5300059_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|5300190_5300673_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
5301206:5301251	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000391794.1|5301373_5301856_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|5301882_5302101_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_001011753.1|5302169_5303270_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	1.2e-177
WP_000980391.1|5303266_5303752_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_001282733.1|5303748_5306826_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.4	0.0e+00
WP_000763311.1|5306818_5306938_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|5306952_5307255_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207656.1|5307309_5307825_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046140.1|5307834_5309007_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	2.7e-204
WP_000905028.1|5309149_5309716_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	4.2e-86
WP_001145388.1|5309746_5310280_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.1	5.3e-59
WP_001030534.1|5310279_5310882_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.5	7.0e-100
WP_000782982.1|5310853_5311273_-|tail	tail assembly chaperone	tail	M1SNQ2	Escherichia_phage	65.8	6.5e-36
WP_000104782.1|5311269_5312691_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	82.3	5.8e-161
WP_001086829.1|5312687_5313293_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	8.9e-111
WP_106888911.1|5313285_5314194_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	6.6e-142
WP_000177590.1|5314180_5314540_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000993754.1|5314536_5315115_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000829135.1|5315183_5315630_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	2.5e-62
WP_001039936.1|5315622_5316054_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_001368405.1|5316149_5316578_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	4.9e-47
WP_000727858.1|5316574_5316952_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	7.9e-17
WP_001442491.1|5316953_5317427_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|5317446_5317662_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|5317665_5317869_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|5317868_5318333_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059200.1|5318428_5319079_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_000742526.1|5319082_5320141_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	7.6e-182
WP_000216252.1|5320157_5320991_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.5	4.1e-122
WP_001098431.1|5321133_5322900_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_000520362.1|5322899_5323934_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.3	2.4e-172
WP_000961024.1|5323971_5324820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368407.1|5324829_5325492_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000106358.1|5325511_5326321_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_001217575.1|5326684_5326918_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|5326928_5327117_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_062863572.1|5327270_5329685_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_000104159.1|5329681_5330539_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	3.2e-162
WP_000145290.1|5330535_5330838_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752625.1|5330834_5331062_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.0e-35
WP_001244163.1|5331061_5331295_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000996716.1|5331362_5331704_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	3.9e-55
WP_000956176.1|5331821_5332118_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460849.1|5332125_5332635_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
WP_000102105.1|5332667_5332910_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932271.1|5333031_5333664_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.9	3.7e-59
WP_000218400.1|5333666_5334683_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.7	2.8e-189
WP_001083624.1|5334693_5335362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106888913.1|5336931_5338145_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	1.4e-99
5335448:5335493	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
