The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	0	8150	5597475		uncultured_Caudovirales_phage(100.0%)	4	NA	NA
WP_000730096.1|1432_3106_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|3105_3195_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|3507_3714_+	YbfA family protein	NA	NA	NA	NA	NA
WP_106889255.1|3956_8150_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
>prophage 2
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	12234	15176	5597475		Hokovirus(50.0%)	2	NA	NA
WP_000207138.1|12234_13653_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	1.1e-61
WP_001032694.1|13694_15176_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 3
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	18554	19346	5597475		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114037.1|18554_19346_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.0	3.7e-08
>prophage 4
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	55484	59004	5597475		Vibrio_phage(33.33%)	4	NA	NA
WP_000345401.1|55484_56204_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	3.2e-22
WP_000951292.1|56200_57142_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|57255_57636_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109199.1|57951_59004_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	2.0e-81
>prophage 5
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	63359	69932	5597475		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|63359_64376_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|64636_66109_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|66176_66965_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|67093_67243_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000113001.1|67408_68182_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|68181_68871_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|68873_69932_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 6
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	79735	138496	5597475	head,lysis,integrase,protease,terminase,tail,portal,transposase,holin	Enterobacteria_phage(47.83%)	77	75483:75498	83821:83836
75483:75498	attL	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000533654.1|79735_80806_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
WP_001303849.1|80783_81002_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001281774.1|81108_81453_-	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	98.2	4.5e-59
WP_000545733.1|81481_81649_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000002107.1|81721_82006_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_106889256.1|82237_83393_+|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	4.0e-67
WP_000104414.1|83564_84182_-	hypothetical protein	NA	Q716F4	Shigella_phage	64.2	5.6e-36
83821:83836	attR	ATGGCGGCGCGGCAGG	NA	NA	NA	NA
WP_000034231.1|84183_84741_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	83.6	4.6e-45
WP_000812206.1|84737_85295_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	64.3	3.2e-62
WP_001214436.1|85291_85456_-	DUF2737 family protein	NA	K7P7R0	Enterobacteria_phage	98.1	4.2e-23
WP_001111278.1|85466_85760_-	DUF2856 family protein	NA	G8C7L1	Escherichia_phage	99.0	2.5e-50
WP_000951334.1|85783_86167_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	98.4	2.5e-66
WP_000031370.1|86166_86772_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_001243354.1|87028_87181_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.5e-19
WP_000638547.1|87165_87297_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_085948186.1|87784_88941_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000073663.1|89812_90352_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	44.9	8.1e-39
WP_000088201.1|90375_90648_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	7.4e-41
WP_000193240.1|91254_91617_-	hypothetical protein	NA	A0A1P8DTD0	Proteus_phage	51.4	6.2e-19
WP_000428099.1|91885_92590_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	99.6	4.3e-133
WP_000064150.1|92703_92937_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	97.4	4.0e-35
WP_000438538.1|93075_93375_+	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	99.0	4.8e-49
WP_000185473.1|93407_94346_+	replication protein	NA	O48421	Enterobacteria_phage	99.7	1.4e-171
WP_000788880.1|94342_95044_+	Replication protein P	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000145926.1|95040_95331_+	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000344573.1|95627_95984_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	97.3	2.1e-59
WP_085948186.1|96254_97410_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001254255.1|97629_97806_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000924601.1|97808_98210_+	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001341811.1|98169_98379_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.6e-30
WP_001003989.1|98371_99094_+	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.6	5.4e-131
WP_000002261.1|99093_99384_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	2.9e-51
WP_001008193.1|99380_99743_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	2.7e-62
WP_000994516.1|99739_99928_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000750155.1|100139_101099_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|101436_101559_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|101573_102263_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|102447_103191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|103276_103435_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000411802.1|106045_106252_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075132.1|106251_106749_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092325.1|106745_107183_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000881326.1|107332_107950_+	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_001307652.1|108137_108332_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000235451.1|108727_109237_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_096949903.1|109282_111136_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.5	3.0e-258
WP_000259002.1|111119_111326_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_106889257.1|111322_112915_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	3.5e-183
WP_001254029.1|112904_113081_+	hypothetical protein	NA	E4WL22	Enterobacteria_phage	56.4	1.1e-08
WP_001341328.1|113158_113437_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	1.1e-44
WP_000612626.1|113558_113906_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|113954_115493_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_032284507.1|115489_115858_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	88.0	2.4e-50
WP_001143013.1|115865_116618_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|116631_117063_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|117089_117503_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082320.1|117483_120063_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	0.0e+00
WP_000847304.1|120059_120389_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_032325234.1|120388_121087_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.3	2.4e-131
WP_001405642.1|121097_121841_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	5.6e-147
WP_096844540.1|121786_122419_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_000515142.1|122664_126141_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_001230449.1|126208_126808_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_000268998.1|126872_128087_+	short-chain dehydrogenase	NA	B6DZB7	Enterobacteria_phage	95.8	6.6e-81
WP_001023459.1|128088_128358_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000950982.1|128463_129345_+	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	3.9e-147
WP_001428038.1|129561_130395_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	9.3e-151
WP_021351651.1|130518_130890_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_000381395.1|131364_132936_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|132955_133303_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|133302_133980_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001448642.1|134040_134616_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	77.5	1.6e-77
WP_001002868.1|134816_135197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354291.1|135280_135502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121571.1|135514_136168_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_000767389.1|136671_137148_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001307065.1|137206_138496_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 7
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	144977	145886	5597475		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|144977_145886_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 8
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	156482	172573	5597475	transposase	Anomala_cuprea_entomopoxvirus(14.29%)	14	NA	NA
WP_000996091.1|156482_158219_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	1.3e-18
WP_001296990.1|158211_159207_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|159209_159881_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007094.1|160109_161474_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_000443534.1|161704_162790_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|162930_163893_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218655.1|163920_166071_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	25.8	4.8e-42
WP_001145128.1|166190_166673_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000399685.1|166932_167913_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000849301.1|168182_168443_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146345.1|168707_168974_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	2.0e-06
WP_000990177.1|169047_169725_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430039.1|169766_172049_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|172312_172573_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 9
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	176113	181338	5597475		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|176113_176836_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159066.1|176832_177492_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|177630_178377_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|178780_179284_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|179582_180470_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|180704_180770_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|180822_181338_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 10
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	186335	187928	5597475		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|186335_187928_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 11
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	191820	195951	5597475		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|191820_194253_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|194258_195158_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001432715.1|195288_195951_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.1	5.7e-26
>prophage 12
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	199166	201038	5597475		Planktothrix_phage(100.0%)	1	NA	NA
WP_001296993.1|199166_201038_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 13
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	212373	213576	5597475		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|212373_213576_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 14
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	222142	231292	5597475		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|222142_222400_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|222559_222847_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|222830_223553_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|223613_224516_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|224603_225080_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126055.1|225430_226543_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996018.1|226637_227771_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093858.1|227780_228734_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|228730_229576_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|229635_230124_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|230164_231292_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 15
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	234629	237367	5597475		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|234629_235358_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|235575_236091_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160723.1|236216_236540_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|236536_237367_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 16
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	240954	242673	5597475		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|240954_242673_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 17
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	251969	275763	5597475	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188180.1|251969_253916_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|253988_254213_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|254535_254856_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|254885_257162_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|257844_258063_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|258347_259052_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202168.1|259093_260815_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.1e-20
WP_001043619.1|260815_262582_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537421.1|262704_263670_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|264213_264708_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077075.1|264842_268949_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|269103_269715_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067740.1|269725_271069_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	3.6e-80
WP_000886683.1|271159_272452_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|272690_275135_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|275145_275763_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 18
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	282072	285287	5597475		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|282072_282813_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|283004_285287_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 19
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	289385	290474	5597475		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|289385_290474_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 20
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	295560	300101	5597475		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|295560_295845_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705700.1|296051_298316_+	ComEC family protein	NA	NA	NA	NA	NA
WP_106889258.1|298352_300101_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.6	9.6e-57
>prophage 21
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	314806	315355	5597475		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|314806_315355_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 22
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	318904	327218	5597475	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_000977920.1|318904_319993_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|320594_321995_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|322163_323366_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|323631_326244_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090514.1|326450_327218_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
>prophage 23
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	343139	345047	5597475		Tupanvirus(100.0%)	1	NA	NA
WP_000053122.1|343139_345047_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 24
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	357643	359698	5597475		Bacillus_phage(100.0%)	1	NA	NA
WP_001297106.1|357643_359698_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 25
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	363931	462795	5597475	head,integrase,capsid,protease,terminase,tail,transposase,holin	Escherichia_phage(33.33%)	111	428732:428748	465169:465185
WP_000375138.1|363931_364591_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	5.2e-48
WP_001299351.1|364998_366018_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|365995_366238_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_106889259.1|366305_368756_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000199475.1|368851_369040_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|369036_369225_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001331716.1|369625_369790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171921.1|369793_370012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024182289.1|370104_370305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000692026.1|370718_371021_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_001022415.1|371023_371383_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	3.6e-59
WP_000578360.1|371429_371822_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_001172789.1|371948_372209_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	64.8	4.8e-21
WP_000693932.1|372205_372643_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	55.0	1.6e-29
WP_000729535.1|372729_373740_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	88.8	4.9e-170
WP_072096947.1|373651_374194_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	89.5	1.8e-78
WP_000450641.1|374227_374953_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.4	1.2e-77
WP_001040234.1|374968_375361_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	62.6	1.0e-38
WP_001266133.1|375357_375654_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	94.7	5.8e-47
WP_001209480.1|375650_376112_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	92.9	3.4e-38
WP_000403783.1|376089_376446_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	4.6e-59
WP_000935422.1|376496_376709_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	100.0	6.6e-37
WP_001224662.1|376742_376925_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_001289353.1|377090_377726_+	ead/Ea22-like family protein	NA	A0A2R2Z315	Escherichia_phage	100.0	1.3e-115
WP_000209152.1|377813_378032_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	100.0	6.6e-32
WP_001229296.1|378033_378399_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000206830.1|378395_378740_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	100.0	1.7e-58
WP_000220601.1|378944_379244_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	100.0	1.8e-51
WP_001260977.1|379249_379507_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_001342259.1|379642_379915_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001265113.1|379916_380963_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_000904103.1|380975_381335_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	1.8e-34
WP_000640048.1|381343_381874_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917770.1|382115_382313_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301785.1|382447_383161_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466957.1|383610_384042_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_085948186.1|386244_387400_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_122994412.1|387454_387724_+	hypothetical protein	NA	Q5MBW4	Stx1-converting_phage	98.9	2.1e-43
WP_000143463.1|387859_388039_+	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_001290230.1|388079_388325_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072901.1|388402_388618_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_000087714.1|388622_389156_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	99.4	3.0e-102
WP_001056883.1|389430_390000_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	99.5	1.5e-104
WP_000455402.1|389999_390149_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	9.1e-17
WP_001208680.1|390376_390562_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|391088_391403_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001448509.1|391484_391709_-	YlcI/YnfO family protein	NA	A0A0P0ZE23	Stx2-converting_phage	76.1	2.9e-19
WP_025380422.1|391750_392116_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000958380.1|392404_392968_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_062890118.1|392964_394626_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.1	0.0e+00
WP_044165196.1|394689_396627_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_001063099.1|396671_396893_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125984.1|399419_399746_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|399756_400107_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|400103_400550_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|400546_400891_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|400956_401673_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|401678_402053_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|402148_402358_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106889260.1|402409_405652_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.5	0.0e+00
WP_000807927.1|405644_405986_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_032325187.1|405985_406684_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.0	1.5e-130
WP_001429308.1|406689_407433_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_096844540.1|407378_408011_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_106889261.1|408246_411729_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	96.5	0.0e+00
WP_001230429.1|411795_412395_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	2.3e-111
WP_000279017.1|412459_413773_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023995.1|413774_414044_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	7.1e-44
WP_000767050.1|414265_414808_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106420821.1|414752_414947_+	hypothetical protein	NA	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|414937_415519_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_001002867.1|415719_416418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121564.1|416430_417084_-	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_001264955.1|417555_418584_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|418556_419249_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|419388_420561_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062101.1|420560_423107_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209869.1|423103_423703_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024561.1|423795_424101_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|424100_425021_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000097601.1|425280_426540_+	YccE family protein	NA	NA	NA	NA	NA
WP_001044313.1|426831_428073_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|428110_428338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151437.1|428358_428955_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
428732:428748	attL	CCAAAAATAATGGCGTC	NA	NA	NA	NA
WP_001273658.1|429327_429501_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|429583_430912_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|430932_431427_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001171.1|431437_432028_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001341462.1|432037_432838_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126777.1|432845_433232_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001307708.1|433243_433936_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001297176.1|433935_435027_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191700.1|435314_435953_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001341463.1|435992_439955_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979516.1|440009_440219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018496.1|440377_441886_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000497942.1|442551_443382_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154411.1|443439_444567_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199164.1|444572_445844_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_001307105.1|446327_447251_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	9.2e-91
WP_001297190.1|448062_448518_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000279869.1|449142_450345_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000282206.1|450531_452349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303889.1|453460_453757_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000579535.1|453983_454181_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335695.1|454399_455833_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282084.1|456653_457217_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000233452.1|457371_459732_+	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000998026.1|460488_462021_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	3.5e-297
WP_000612591.1|462070_462418_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|462414_462795_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
465169:465185	attR	GACGCCATTATTTTTGG	NA	NA	NA	NA
>prophage 26
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	475710	475851	5597475		Escherichia_phage(100.0%)	1	NA	NA
WP_001135715.1|475710_475851_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
>prophage 27
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	479580	481997	5597475	transposase	Stx2-converting_phage(66.67%)	3	NA	NA
WP_000435663.1|479580_480006_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000624701.1|480002_480353_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000088522.1|480383_481997_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
>prophage 28
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	486517	498860	5597475	protease	Acinetobacter_phage(42.86%)	12	NA	NA
WP_001182418.1|486517_487597_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_001040060.1|487598_488372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280118.1|488364_489507_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	7.7e-31
WP_001035166.1|489516_490575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254140.1|490897_491479_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.5	1.7e-13
WP_001054789.1|491478_492636_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007449.1|492658_493114_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|493136_494177_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|494225_494804_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301248.1|494872_495448_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	2.5e-30
WP_001053349.1|495869_496256_+	protein TerF	NA	NA	NA	NA	NA
WP_001223350.1|496769_498860_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
>prophage 29
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	514890	519977	5597475	transposase	Flavobacterium_phage(25.0%)	6	NA	NA
WP_071830510.1|514890_515193_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A218M763	Flavobacterium_phage	50.0	1.5e-10
WP_001341487.1|515249_516122_+	DUF3440 domain-containing protein	NA	A0A068F1U8	Mycobacterium_phage	33.0	6.7e-43
WP_000502849.1|516106_516745_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_000226520.1|516823_517093_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001333354.1|517113_517758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|518821_519977_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 30
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	530669	533774	5597475	transposase	Stx2-converting_phage(75.0%)	4	NA	NA
WP_000099160.1|530669_532208_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|532256_532604_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|532600_533005_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000422760.1|533348_533774_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	1.5e-43
>prophage 31
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	543481	545652	5597475		Yersinia_phage(33.33%)	4	NA	NA
WP_001234682.1|543481_544300_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	1.0e-45
WP_000214398.1|544390_544876_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
WP_001186738.1|544891_545368_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|545430_545652_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 32
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	551669	552503	5597475		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|551669_552503_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 33
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	556637	557171	5597475		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857399.1|556637_557171_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
>prophage 34
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	566479	567400	5597475		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|566479_567400_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 35
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	572062	572308	5597475		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|572062_572308_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 36
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	588154	589096	5597475		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|588154_589096_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 37
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	601453	602635	5597475		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008538.1|601453_602188_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.2e-15
WP_000103754.1|602398_602635_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 38
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	605907	607550	5597475		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|605907_606549_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|606545_607550_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 39
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	619873	620131	5597475		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|619873_620131_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 40
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	627420	631143	5597475		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|627420_628122_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|628121_629366_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|629394_630306_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|630321_631143_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 41
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	634589	712987	5597475	head,integrase,holin,protease,terminase,tail,transposase,capsid	Stx2-converting_phage(32.2%)	83	625390:625405	692520:692535
625390:625405	attL	CGGATCACACTGTTCA	NA	NA	NA	NA
WP_000074983.1|634589_635708_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|635676_635946_-	excisionase	NA	NA	NA	NA	NA
WP_106889264.1|636007_638479_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.3	1.0e-59
WP_000199475.1|638573_638762_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032240573.1|638758_638947_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_122993340.1|639347_639494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394528.1|639479_639854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171923.1|639876_640095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001448352.1|640254_640410_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_000103687.1|640682_641399_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|641448_641664_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693943.1|641660_642086_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|642108_643071_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_001151209.1|643111_643534_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000004322.1|643530_643785_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	94.0	4.8e-42
WP_001002672.1|643777_644089_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	97.1	1.1e-59
WP_001204666.1|644394_644973_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_000156210.1|644932_646030_-	hypothetical protein	NA	A0A0U2S621	Escherichia_phage	99.5	1.4e-210
WP_000882662.1|646530_646743_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_012817871.1|646910_647183_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	9.4e-12
WP_032323995.1|647184_648123_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	44.5	6.7e-73
WP_000140024.1|648123_648489_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	1.6e-38
WP_000640017.1|648497_649040_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000917767.1|649271_649469_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611215.1|649619_650669_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.7	3.4e-190
WP_001340026.1|651467_651599_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	7.0e-05
WP_000871291.1|651879_652215_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_069358388.1|652474_654328_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	97.6	0.0e+00
WP_032272343.1|654477_654693_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	4.5e-33
WP_021569237.1|654697_655042_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	4.2e-57
WP_062854056.1|655092_655626_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	96.0	1.4e-99
WP_032140280.1|656180_656267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|656489_656675_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000828068.1|657075_657402_+	TonB family protein	NA	H6WZK5	Escherichia_phage	99.1	1.5e-56
WP_032277401.1|657533_657734_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	95.5	2.8e-29
WP_000829192.1|657775_658141_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|658428_658992_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_106875426.1|658988_660650_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	98.9	0.0e+00
WP_044165196.1|660713_662651_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_001063099.1|662695_662917_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_106889256.1|663796_664953_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	4.0e-67
WP_000125984.1|666709_667036_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|667046_667397_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|667393_667840_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|667836_668181_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|668246_668963_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|668968_669343_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|669438_669648_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106889265.1|669699_672942_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.2	0.0e+00
WP_000807940.1|672934_673276_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|673275_673974_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_044723512.1|673979_674723_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	1.3e-148
WP_064755952.1|674668_675301_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	1.4e-103
WP_000839179.1|678063_678468_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|678464_678812_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|678860_680399_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000902073.1|680421_681471_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	100.0	4.5e-195
WP_001228278.1|681538_682138_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	95.5	5.9e-107
WP_000381395.1|683634_685206_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|685225_685573_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|685572_686250_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001023357.1|686310_686580_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_106409364.1|690525_690648_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|690754_691666_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|691731_692301_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|693468_693747_-	hypothetical protein	NA	NA	NA	NA	NA
692520:692535	attR	CGGATCACACTGTTCA	NA	NA	NA	NA
WP_001414184.1|694174_694321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|694457_695105_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|695288_695879_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|698641_698860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079509.1|699361_699868_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|699913_700414_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|700499_700679_-	general stress protein	NA	NA	NA	NA	NA
WP_000443067.1|701059_701866_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|701865_703059_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_032323871.1|704431_706027_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001700591.1|707679_707724_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|707861_708743_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001342101.1|708739_709360_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|709460_710333_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278906.1|710372_710963_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559281.1|710959_711718_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|711937_712987_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 42
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	721174	721765	5597475		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|721174_721765_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 43
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	729580	735240	5597475		Lactococcus_phage(50.0%)	4	NA	NA
WP_000484968.1|729580_731515_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	26.9	6.9e-32
WP_000506490.1|732856_733645_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968850.1|734012_734366_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|734433_735240_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 44
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	748155	749421	5597475		Klosneuvirus(100.0%)	1	NA	NA
WP_032323875.1|748155_749421_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-23
>prophage 45
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	782686	783202	5597475		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945026.1|782686_783202_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	7.0e-24
>prophage 46
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	789527	875649	5597475	head,tRNA,integrase,holin,terminase,tail,capsid	Escherichia_phage(36.0%)	105	793237:793252	870383:870398
WP_000628065.1|789527_790760_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|791014_791998_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_032323876.1|792475_793849_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
793237:793252	attL	CCAGGCTGTCTGCGAC	NA	NA	NA	NA
WP_001157407.1|793977_794913_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|794964_796200_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|796201_796417_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|796516_796705_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|796742_796892_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|796947_797757_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105153.1|797749_800350_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	6.7e-248
WP_001344816.1|800451_800727_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|800801_800972_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|800971_801193_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|801634_802123_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|802119_802275_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|802285_802465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|802707_803127_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|803206_803461_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|803457_803880_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|803957_804746_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|804752_805499_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|805521_806283_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|806298_806721_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|806826_807039_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_042350895.1|807124_807289_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.7	2.0e-17
WP_000224233.1|807290_807554_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|807564_807726_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|807804_808050_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|808481_809633_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|809600_810590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|810589_811981_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|812480_813080_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|813079_813370_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|813366_813921_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_032324351.1|814482_814914_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	96.5	5.6e-67
WP_000143077.1|815488_817342_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_000284522.1|817491_817707_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_032325202.1|817711_818056_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	7.9e-56
WP_000992086.1|818106_818640_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.7	1.3e-100
WP_000661712.1|818913_819609_+	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_001280923.1|819703_819835_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	93.0	3.8e-11
WP_012817877.1|820057_820243_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	4.0e-22
WP_000828070.1|820643_820970_+	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_032277401.1|821101_821302_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	95.5	2.8e-29
WP_000829192.1|821343_821709_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000958380.1|821997_822561_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_106889267.1|822557_824219_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.3	0.0e+00
WP_096948424.1|824282_826220_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001063025.1|826264_826486_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|829012_829339_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|829348_829699_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|829695_830142_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|830138_830483_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|830548_831265_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|831270_831645_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|831740_831950_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106889260.1|832001_835244_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	96.5	0.0e+00
WP_000807927.1|835236_835578_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_032325187.1|835577_836276_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.0	1.5e-130
WP_001429308.1|836281_837025_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_096844540.1|836970_837603_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	3.5e-102
WP_032325372.1|837838_841321_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	94.8	0.0e+00
WP_032271866.1|841389_842013_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_001023455.1|843391_843661_+|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001131642.1|843773_844349_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|844639_845221_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_106889268.1|845288_845924_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.3	8.3e-75
WP_001299273.1|846051_847110_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|847184_847835_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132151.1|848018_848609_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001435497.1|848825_848990_+|tail	tail fiber assembly domain protein	tail	K7PMH7	Enterobacteria_phage	87.5	2.2e-16
WP_000799402.1|849222_850086_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|850069_851206_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359438.1|851455_852685_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|852830_853952_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085258.1|854200_855430_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	8.4e-132
WP_000953272.1|855795_855984_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_012816761.1|856041_857070_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_096957805.1|857059_857317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|857289_857523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204981.1|857515_857749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770175.1|857754_858054_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833618.1|858050_859451_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000192401.1|859651_859903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126687.1|859899_860310_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|860320_860593_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|860719_860944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796958.1|861195_861402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106889269.1|861401_862457_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.4	7.8e-70
WP_050439453.1|862469_862838_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224599.1|862813_863227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001432354.1|863433_863976_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	5.1e-33
WP_000133424.1|864231_864513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|865114_866575_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|866574_867246_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|867413_868784_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|868787_869429_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|869464_870571_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
870383:870398	attR	GTCGCAGACAGCCTGG	NA	NA	NA	NA
WP_000476093.1|870624_871086_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|871095_871749_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|871920_873171_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|873273_873597_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_032141808.1|874129_874240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|874292_874697_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|874917_875649_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 47
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	881516	883838	5597475		Escherichia_phage(100.0%)	1	NA	NA
WP_001369554.1|881516_883838_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
>prophage 48
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	892356	894044	5597475		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|892356_892776_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457626.1|892775_894044_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	2.3e-209
>prophage 49
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	920803	923555	5597475		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|920803_922483_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|922607_923555_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 50
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	926691	930699	5597475		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|926691_927774_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|927773_928607_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|928603_928996_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257045.1|928999_929809_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|929844_930699_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 51
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	933800	934031	5597475		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|933800_934031_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 52
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	945284	955295	5597475		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|945284_946823_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|946819_947530_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|947529_948207_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555854.1|948932_949775_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.4e-13
WP_001307143.1|949824_950283_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|950395_951301_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193437.1|951392_952406_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|952607_953516_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287380.1|953659_954073_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|954677_955295_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 53
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	964705	966720	5597475		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|964705_965719_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|965715_966720_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 54
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	974654	1025378	5597475	head,integrase,holin,terminase,tail,transposase,capsid	Stx2-converting_phage(35.56%)	59	970374:970388	1003754:1003768
970374:970388	attL	ATTTTCCTGAATATG	NA	NA	NA	NA
WP_000113674.1|974654_975785_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|975762_976011_-	excisionase	NA	NA	NA	NA	NA
WP_000048478.1|976075_978547_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000199480.1|978642_978831_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449172.1|978827_979016_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001342117.1|979415_979583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|979576_979810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|979787_980195_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|980217_980436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|980508_980808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|981072_981480_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|981556_981784_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|981767_982319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|982290_983331_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|983242_983785_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_001505071.1|984548_984713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|985411_986170_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|986448_986661_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|986881_987139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|987208_987487_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265290.1|987488_988544_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	4.9e-88
WP_000140002.1|988544_988910_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_032324106.1|988906_989596_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.5	1.8e-59
WP_000023141.1|991117_992971_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	96.6	0.0e+00
WP_000284522.1|993120_993336_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_032325202.1|993340_993685_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	96.5	7.9e-56
WP_000992088.1|993735_994269_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	98.3	5.6e-101
WP_001056803.1|994539_995106_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	2.9e-103
WP_000539792.1|995105_995252_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|995479_995686_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|995750_995975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|996069_997225_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000347013.1|997598_997739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001428130.1|997868_998054_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.3	1.3e-20
WP_000829190.1|998095_998461_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	97.5	1.1e-63
WP_000958380.1|998754_999318_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_044165196.1|1000989_1002927_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.1	0.0e+00
WP_001063099.1|1002971_1003193_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125984.1|1005717_1006044_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
1003754:1003768	attR	CATATTCAGGAAAAT	NA	NA	NA	NA
WP_001007905.1|1006054_1006405_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1006401_1006848_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1006844_1007189_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_106881370.1|1007254_1007971_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	3.1e-126
WP_001030063.1|1007976_1008351_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1008446_1008656_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_106889272.1|1008707_1011950_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	97.2	0.0e+00
WP_000807927.1|1011942_1012284_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_001357740.1|1012283_1012982_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_106889273.1|1012987_1013731_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.8	7.0e-150
WP_000649829.1|1014498_1015026_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515042.1|1015159_1018657_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_001230550.1|1018727_1019327_+	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000268955.1|1019391_1020705_+|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023992.1|1020706_1020976_+|tail	phage tail protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_001131659.1|1021088_1021664_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|1021736_1022366_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|1022447_1023089_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|1023669_1024104_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|1024244_1025378_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 55
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1030338	1031328	5597475		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|1030338_1031328_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 56
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1062614	1066517	5597475		Klosneuvirus(100.0%)	1	NA	NA
WP_000139556.1|1062614_1066517_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 57
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1070456	1071405	5597475		Escherichia_phage(50.0%)	2	NA	NA
WP_001307188.1|1070456_1070987_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|1071231_1071405_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 58
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1083207	1093386	5597475	transposase	Escherichia_phage(20.0%)	9	NA	NA
WP_000826406.1|1083207_1084416_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	9.2e-208
WP_071997226.1|1084455_1085676_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|1085728_1086265_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001341357.1|1086337_1088299_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000494244.1|1088390_1088621_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|1088842_1089019_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|1089064_1089481_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000047456.1|1091209_1092355_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|1092372_1093386_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 59
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1096745	1097555	5597475		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|1096745_1097555_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 60
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1101820	1103923	5597475		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|1101820_1103923_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 61
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1108830	1115215	5597475		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103194.1|1108830_1110939_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	1.9e-27
WP_000014753.1|1111006_1115215_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
>prophage 62
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1121609	1123154	5597475		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|1121609_1123154_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 63
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1130039	1130330	5597475		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|1130039_1130330_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 64
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1136342	1137784	5597475		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|1136342_1136627_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|1136773_1137784_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 65
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1141058	1142964	5597475		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285544.1|1141058_1141985_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	2.4e-14
WP_000193551.1|1141977_1142964_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.2e-18
>prophage 66
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1147279	1151086	5597475		Klosneuvirus(50.0%)	2	NA	NA
WP_001427328.1|1147279_1149679_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426272.1|1149703_1151086_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 67
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1156365	1163301	5597475		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001345363.1|1156365_1159161_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.3e-18
WP_000832502.1|1159205_1161578_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628552.1|1161615_1163301_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	2.2e-10
>prophage 68
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1170610	1278969	5597475	head,integrase,holin,tail,portal,transposase,capsid	Escherichia_phage(30.36%)	110	1159153:1159169	1285606:1285622
1159153:1159169	attL	TATCTCCATGCGAAAAC	NA	NA	NA	NA
WP_085948178.1|1170610_1171823_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000520676.1|1172090_1173005_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825452.1|1173063_1173567_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|1173579_1174110_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000123648.1|1174123_1176775_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195166.1|1176816_1177527_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296758.1|1177887_1178451_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001125458.1|1179402_1180725_-	type II toxin-antitoxin system serine/threonine protein kinase toxin HipA	NA	NA	NA	NA	NA
WP_001296726.1|1180724_1180991_-	type II toxin-antitoxin system antitoxin HipB	NA	NA	NA	NA	NA
WP_000127325.1|1181213_1181693_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.7	1.7e-43
WP_000154339.1|1188588_1189542_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_106889276.1|1189790_1191326_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	2.2e-20
WP_000911171.1|1191319_1192348_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222721.1|1192347_1193340_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|1193351_1194374_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774200.1|1194400_1195270_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_072097594.1|1195223_1195730_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001341531.1|1195733_1196648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854640.1|1196854_1198306_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558044.1|1198532_1199951_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191027.1|1200089_1200449_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|1200448_1201375_-	glutaminase B	NA	NA	NA	NA	NA
WP_001296740.1|1201438_1202827_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366496.1|1202927_1203809_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001323836.1|1203886_1204345_+	putative protein YneK	NA	NA	NA	NA	NA
WP_001341528.1|1204293_1205001_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210799.1|1205150_1206341_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|1206365_1207031_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|1207242_1207677_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|1207696_1208080_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1208111_1208330_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_085948186.1|1208789_1209945_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001022772.1|1211117_1212791_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|1212846_1213158_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001375402.1|1213185_1214508_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|1214622_1214934_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577179.1|1215132_1215831_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087216.1|1215875_1216775_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|1216969_1218157_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1218283_1218379_+	protein MgtS	NA	NA	NA	NA	NA
WP_000671731.1|1220518_1220911_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024559.1|1221186_1221705_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001341522.1|1221749_1223795_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1223931_1224678_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1224766_1225453_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214712.1|1225630_1225834_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527750.1|1225869_1227330_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.3	5.6e-42
WP_000347482.1|1227418_1228702_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_096846665.1|1228761_1229076_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_122993102.1|1229446_1230460_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|1230674_1230752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023407.1|1230862_1231132_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_106889277.1|1231133_1232447_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	1.2e-75
WP_106889278.1|1232511_1233111_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.6e-110
WP_123010699.1|1236898_1237531_-|tail	tail assembly protein	tail	A0A0N7KZG2	Stx2-converting_phage	95.7	1.6e-94
WP_000194707.1|1237476_1238220_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|1238230_1238929_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|1238928_1239258_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533442.1|1241846_1242260_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|1242286_1242709_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|1242722_1243475_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|1243482_1243878_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975098.1|1243874_1244453_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	5.0e-79
WP_000752994.1|1244464_1244818_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_022581670.1|1244829_1245225_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	5.3e-56
WP_000063258.1|1245266_1246292_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1246347_1246680_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123292.1|1246689_1248009_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.5e-232
WP_001443752.1|1247989_1249591_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1249587_1249794_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000453587.1|1251690_1252236_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_044705177.1|1252624_1252849_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	7.8e-20
WP_001302717.1|1252930_1253245_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|1253770_1253956_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|1254178_1254325_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|1254324_1254894_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|1255164_1255698_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|1255748_1256093_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411802.1|1256097_1256304_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_032325211.1|1256751_1258602_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_001299632.1|1259080_1259512_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	98.6	7.8e-69
WP_000498121.1|1259701_1259911_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	65.2	2.5e-20
WP_000735807.1|1259963_1260188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047111.1|1261032_1261785_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_001375683.1|1261798_1262848_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	4.6e-115
WP_012817785.1|1262849_1263119_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	3.0e-10
WP_001452497.1|1263172_1263400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032325073.1|1263623_1263995_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000042395.1|1263987_1264305_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000882662.1|1264407_1264620_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000211993.1|1264834_1265386_-	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	53.3	5.5e-43
WP_000215512.1|1265737_1265923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450895.1|1265982_1266744_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	63.6	2.4e-73
WP_000790460.1|1266773_1267514_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	4.7e-114
WP_000054520.1|1267520_1268486_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000705368.1|1268466_1268988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920571.1|1268971_1269202_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379972.1|1269285_1269693_+	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	58.7	3.1e-14
WP_000380319.1|1269859_1270012_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000394548.1|1270023_1270662_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|1270662_1270872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|1271436_1271625_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|1271621_1271810_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102128.1|1271902_1274365_+	exonuclease	NA	V5UQJ3	Shigella_phage	47.5	2.3e-125
WP_001368608.1|1274452_1274689_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001206148.1|1274708_1276004_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_072095801.1|1276023_1276134_-	transporter	NA	NA	NA	NA	NA
WP_000836079.1|1276191_1277211_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|1277222_1278437_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1278642_1278969_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
1285606:1285622	attR	TATCTCCATGCGAAAAC	NA	NA	NA	NA
>prophage 69
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1283850	1288415	5597475		Escherichia_phage(100.0%)	4	NA	NA
WP_001342196.1|1283850_1286274_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.2e-208
WP_000213028.1|1286284_1286902_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526492.1|1286903_1287758_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1287800_1288415_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 70
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1295254	1313304	5597475	head,integrase,protease,terminase,portal,transposase,capsid	uncultured_Caudovirales_phage(90.91%)	24	1300879:1300894	1324484:1324499
WP_001260840.1|1295254_1296076_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|1296114_1296444_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|1296430_1296796_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001303517.1|1296902_1297073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133423.1|1298109_1298391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000127891.1|1298404_1300066_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	2.0e-277
WP_000113645.1|1300049_1300406_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001145905.1|1300695_1301136_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
1300879:1300894	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|1301135_1301432_-	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020674.1|1301428_1301767_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_001398592.1|1301763_1302939_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	4.8e-185
WP_000504055.1|1302976_1303549_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	4.7e-61
WP_001137345.1|1303588_1304746_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_085948186.1|1305151_1306308_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_159026385.1|1306364_1306529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233310.1|1306654_1306927_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126691.1|1306937_1307348_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000125509.1|1307344_1307590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261490.1|1309690_1309990_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001113154.1|1309996_1310317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024184083.1|1310309_1310600_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001496008.1|1310532_1311459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000953271.1|1311511_1311700_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	5.9e-13
WP_000085277.1|1312074_1313304_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
1324484:1324499	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 71
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1322320	1323622	5597475		Bacillus_phage(100.0%)	1	NA	NA
WP_000732497.1|1322320_1323622_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
>prophage 72
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1333516	1335328	5597475		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945880.1|1333516_1335328_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 73
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1355200	1356475	5597475	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|1355200_1356475_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 74
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1363386	1364885	5597475		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|1363386_1363908_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|1363988_1364885_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 75
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1373687	1382491	5597475		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101183.1|1373687_1374515_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|1374642_1375224_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|1375369_1376539_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|1376704_1376794_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|1377092_1378118_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|1378114_1379047_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|1379159_1380371_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|1380661_1381810_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|1381849_1382491_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 76
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1387995	1390262	5597475		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|1387995_1388808_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069997.1|1388811_1389597_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|1389593_1390262_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 77
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1398552	1403636	5597475		environmental_halophage(33.33%)	5	NA	NA
WP_000144575.1|1398552_1399773_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|1399769_1401041_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948856.1|1401015_1401762_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001297388.1|1401771_1403259_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|1403267_1403636_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 78
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1422226	1441819	5597475	tRNA	Tupanvirus(22.22%)	18	NA	NA
WP_000553696.1|1422226_1423927_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
WP_000069375.1|1423983_1426362_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368048.1|1426694_1427528_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082235.1|1427684_1428731_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	7.2e-84
WP_001270809.1|1428862_1429054_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175600.1|1429057_1430494_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001209780.1|1431515_1431980_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029479.1|1432057_1432807_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|1432806_1433358_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|1433420_1434401_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|1434501_1434801_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|1434805_1437193_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|1437207_1438191_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|1438474_1438519_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1438641_1438998_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1439050_1439248_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1439344_1439887_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|1439890_1441819_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 79
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1453116	1455378	5597475		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|1453116_1455378_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 80
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1461716	1462544	5597475		Bacillus_virus(100.0%)	1	NA	NA
WP_000175041.1|1461716_1462544_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 81
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1470020	1471241	5597475		Klosneuvirus(100.0%)	1	NA	NA
WP_000081962.1|1470020_1471241_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.1e-27
>prophage 82
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1478005	1478659	5597475		Planktothrix_phage(100.0%)	1	NA	NA
WP_000882826.1|1478005_1478659_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.0	9.9e-15
>prophage 83
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1484247	1486209	5597475		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235820.1|1484247_1486209_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 84
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1491135	1491777	5597475		Tupanvirus(100.0%)	1	NA	NA
WP_001120527.1|1491135_1491777_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 85
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1495020	1495875	5597475		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|1495020_1495875_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 86
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1499193	1503770	5597475		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|1499193_1500477_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616411.1|1500623_1502099_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|1502279_1503770_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 87
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1509721	1607041	5597475	head,tRNA,lysis,integrase,protease,holin,tail,portal,transposase,capsid	Escherichia_phage(34.38%)	109	1549227:1549241	1607044:1607058
WP_071830504.1|1509721_1510930_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.5	1.7e-206
WP_000604932.1|1510937_1511369_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	4.8e-42
WP_000513743.1|1511384_1511573_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|1511576_1511936_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457202.1|1512108_1512747_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|1512873_1513797_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000978494.1|1513899_1514985_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_000987525.1|1515235_1516846_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067805.1|1516877_1518002_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001287005.1|1518057_1519023_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001342154.1|1519076_1520192_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|1520273_1521959_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1522163_1522745_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001221003.1|1522784_1523480_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1523537_1525448_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1525579_1525924_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1526286_1526646_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1526765_1526945_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|1527018_1528380_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|1528383_1528962_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_032324016.1|1529145_1530510_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|1530640_1532239_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000150551.1|1534260_1535232_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|1535294_1536095_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|1536107_1536959_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156255.1|1537013_1537472_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|1537900_1538467_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010107.1|1538463_1539273_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|1539438_1539648_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|1539660_1539804_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006866.1|1540472_1540760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1540834_1540978_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|1541136_1541376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|1541518_1542310_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127210.1|1542486_1543860_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|1543905_1544787_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001427396.1|1544978_1547027_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|1547046_1547745_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|1547841_1548339_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207284.1|1548468_1549752_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
1549227:1549241	attL	CCCGCTACGCCTGCG	NA	NA	NA	NA
WP_001299674.1|1549720_1552354_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057024.1|1552433_1553873_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1553990_1554227_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1554331_1554523_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|1554523_1555180_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001121225.1|1556134_1556785_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000491545.1|1557009_1557885_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	7.2e-162
WP_001023379.1|1558025_1558295_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	95.5	8.7e-42
WP_032325224.1|1558296_1559610_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.3	2.8e-77
WP_001230428.1|1559674_1560274_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_106889281.1|1560341_1563734_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.9	0.0e+00
WP_136865658.1|1563979_1564612_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.6e-102
WP_032325227.1|1564557_1565301_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	4.5e-149
WP_001152185.1|1565311_1566010_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.7	3.1e-131
WP_000847302.1|1566009_1566339_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	94.5	1.2e-53
WP_106889282.1|1566335_1568915_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533431.1|1568895_1569309_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|1569335_1569767_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_032325228.1|1569780_1570533_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	95.6	1.3e-130
WP_000683137.1|1570540_1570936_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_000975096.1|1570932_1571511_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000752994.1|1571522_1571876_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|1571887_1572283_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|1572324_1573350_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|1573405_1573738_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|1573747_1575067_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001443752.1|1575047_1576649_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	3.6e-308
WP_000198153.1|1576645_1576852_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_000453587.1|1578748_1579294_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|1579682_1579877_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|1580064_1580682_-	hypothetical protein	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092325.1|1580831_1581269_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.7e-71
WP_000075132.1|1581265_1581763_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000411802.1|1581762_1581969_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000143049.1|1582416_1584267_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000762928.1|1585437_1586259_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217413.1|1586255_1586630_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	5.4e-34
WP_001265229.1|1586642_1587692_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|1587693_1587966_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|1588087_1588432_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|1588551_1588764_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|1588997_1589555_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|1589556_1589775_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|1589902_1590214_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|1590206_1590434_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|1590430_1590712_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450872.1|1590744_1591506_-	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.2	3.9e-79
WP_001444941.1|1592279_1593242_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.5	2.7e-69
WP_000693943.1|1593264_1593690_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|1593686_1593989_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_001169687.1|1594086_1594458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302048.1|1594478_1594670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1594671_1594950_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001427316.1|1595236_1595389_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	2.3e-07
WP_000560218.1|1595809_1596031_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	1.8e-37
WP_001427414.1|1596030_1596201_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	3.3e-23
WP_001307773.1|1596274_1596550_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	96.7	3.0e-42
WP_106889256.1|1598522_1599679_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	4.0e-67
WP_000166317.1|1600559_1601369_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|1601425_1601620_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|1601612_1601801_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001443927.1|1601907_1602189_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_106889283.1|1602154_1603231_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.4	6.9e-98
WP_000976492.1|1603623_1603965_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|1603977_1604850_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1604853_1605228_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1605366_1605597_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|1605698_1606355_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1606378_1607041_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
1607044:1607058	attR	CGCAGGCGTAGCGGG	NA	NA	NA	NA
>prophage 88
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1615097	1616573	5597475		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|1615097_1616573_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 89
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1630151	1631279	5597475		Planktothrix_phage(100.0%)	1	NA	NA
WP_106889284.1|1630151_1631279_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	2.7e-20
>prophage 90
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1638741	1645805	5597475		Bacillus_virus(50.0%)	9	NA	NA
WP_001184054.1|1638741_1640064_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|1640079_1641012_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1641090_1641846_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|1641842_1642628_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1642774_1643785_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580328.1|1643793_1644405_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1644543_1644609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024917.1|1644679_1645282_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1645283_1645805_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 91
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1649823	1725793	5597475	head,tRNA,integrase,plate,holin,terminase,tail,portal,capsid	Enterobacteria_phage(72.34%)	85	1689405:1689464	1726736:1726856
WP_000639271.1|1649823_1650642_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
WP_000252979.1|1650694_1651090_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|1651130_1651874_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564746.1|1651870_1652842_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_032323745.1|1653006_1655436_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|1655460_1656561_-	cytochrome c	NA	NA	NA	NA	NA
WP_032323742.1|1656948_1657695_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001300190.1|1657708_1658275_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025336.1|1658490_1660224_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|1660400_1660889_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|1661008_1661401_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067000.1|1661400_1663479_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_106889285.1|1663471_1664620_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|1664821_1665466_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1665476_1665866_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1665880_1666930_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1666932_1667793_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483235.1|1667811_1669416_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	1.2e-13
WP_001342228.1|1669461_1671123_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1671267_1671771_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|1671791_1673756_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|1673760_1674687_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906335.1|1674683_1675571_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1675697_1676276_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1676278_1676629_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|1677408_1677837_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|1677843_1679268_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|1679242_1680043_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|1680209_1681196_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|1681210_1682725_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_106889286.1|1682794_1683784_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|1684580_1685084_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082123.1|1685162_1685414_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1685528_1685615_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|1685877_1686201_+	lipoprotein, function unknown	NA	NA	NA	NA	NA
WP_000917208.1|1686371_1686869_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1686906_1687146_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|1687336_1688548_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|1688609_1689275_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1689405:1689464	attL	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCT	NA	NA	NA	NA
WP_001342226.1|1689631_1690633_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.2	9.3e-105
WP_000865208.1|1690638_1690986_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290352.1|1691015_1691666_-	membrane protein	NA	NA	NA	NA	NA
WP_000786769.1|1691681_1692086_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|1692175_1692313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|1692384_1692588_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000742491.1|1692609_1692960_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.0	1.2e-48
WP_000158976.1|1692970_1693249_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	6.9e-34
WP_000357025.1|1693260_1693503_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_032323740.1|1693499_1693613_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	5.2e-09
WP_000985152.1|1693699_1693903_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	9.5e-25
WP_000564224.1|1694226_1694616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272083.1|1694612_1697453_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000686499.1|1697529_1698489_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|1698493_1698805_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289969.1|1698868_1699459_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.8e-31
WP_000087812.1|1699948_1700995_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613774.1|1700994_1702746_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262641.1|1702900_1703737_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	7.9e-150
WP_001055094.1|1703760_1704813_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	3.2e-188
WP_000632311.1|1704858_1705659_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	1.5e-126
WP_000063100.1|1705760_1706255_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864911.1|1706254_1706455_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	7.9e-32
WP_001342221.1|1706457_1706781_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072343.1|1706777_1707170_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	98.5	2.9e-70
WP_000780555.1|1707166_1707574_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	4.2e-64
WP_000202151.1|1707712_1709590_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	82.2	1.1e-305
WP_001342220.1|1709613_1710081_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	94.8	6.7e-82
WP_032324046.1|1710073_1710709_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_001271909.1|1710705_1711287_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.4	1.2e-101
WP_000213447.1|1711283_1711634_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111967.1|1711637_1712534_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	1.9e-154
WP_000071738.1|1712526_1713057_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_000108514.1|1713059_1715192_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.2	8.0e-130
WP_000144010.1|1715191_1715770_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.5	2.2e-95
WP_000954196.1|1715813_1716386_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000979950.1|1716542_1717031_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	7.5e-84
WP_000853455.1|1717043_1719851_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.7	0.0e+00
WP_000763327.1|1719837_1719966_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|1720001_1720367_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|1720421_1720934_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005439.1|1720933_1722118_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	3.4e-223
WP_000132847.1|1722275_1723376_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.1e-203
WP_001317900.1|1723775_1724915_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|1725201_1725462_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078921.1|1725652_1725793_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	5.9e-18
1726736:1726856	attR	AAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 92
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1732048	1732801	5597475		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|1732048_1732801_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 93
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1744601	1745270	5597475		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334596.1|1744601_1745270_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	1.6e-81
>prophage 94
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1759287	1769487	5597475		Bacillus_phage(40.0%)	8	NA	NA
WP_001375614.1|1759287_1760982_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	7.7e-19
WP_000009307.1|1761219_1761402_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001443725.1|1761480_1762398_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212225.1|1762570_1763491_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228683.1|1763479_1763950_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001157256.1|1763930_1765349_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000826783.1|1767457_1768816_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001339045.1|1768815_1769487_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 95
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1778389	1798975	5597475		Bacillus_phage(50.0%)	5	NA	NA
WP_001342205.1|1778389_1780192_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	4.6e-22
WP_000098401.1|1780178_1781981_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	28.0	3.8e-32
WP_000140404.1|1782147_1783107_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000623060.1|1783297_1789405_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	8.9e-33
WP_000369479.1|1789492_1798975_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
>prophage 96
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1835606	1836762	5597475	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948186.1|1835606_1836762_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 97
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1844292	1845542	5597475		Pseudomonas_phage(50.0%)	3	NA	NA
WP_000855059.1|1844292_1844766_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186774.1|1844781_1845258_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1845320_1845542_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 98
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1850804	1851971	5597475		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001383231.1|1850804_1851971_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	2.2e-227
>prophage 99
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1859615	1860515	5597475		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1859615_1860515_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 100
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1867868	1870690	5597475		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704858.1|1867868_1869035_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
WP_001383267.1|1869283_1870690_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
>prophage 101
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1876101	1886010	5597475		Enterobacteria_phage(25.0%)	10	NA	NA
WP_001484691.1|1876101_1877208_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	31.0	5.2e-40
WP_024168774.1|1877227_1877623_-	WxcM-like domain-containing protein	NA	NA	NA	NA	NA
WP_016247326.1|1877618_1878167_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	48.4	4.2e-43
WP_001484692.1|1878204_1879014_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_001383307.1|1879040_1879913_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.1	2.8e-105
WP_016247327.1|1879970_1880870_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	4.4e-29
WP_001383310.1|1880869_1881955_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	8.8e-101
WP_000183060.1|1882326_1883220_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|1883462_1884458_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_016247328.1|1884615_1886010_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	8.3e-19
>prophage 102
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1892010	1898804	5597475		Bacillus_phage(25.0%)	6	NA	NA
WP_016247331.1|1892010_1893381_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.6	9.9e-33
WP_029399006.1|1893573_1895010_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.0	1.0e-43
WP_029399007.1|1895012_1896236_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_024176189.1|1896232_1896712_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_029397738.1|1896714_1897680_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.3e-87
WP_000048190.1|1897682_1898804_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 103
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1903048	1913699	5597475		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|1903048_1903888_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137129.1|1904065_1906228_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_032323937.1|1906230_1906674_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|1906679_1907819_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001339006.1|1908477_1910061_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_032187493.1|1910509_1912363_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|1912384_1912966_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|1913057_1913699_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 104
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1918425	1919778	5597475		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469709.1|1918425_1919778_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	4.1e-07
>prophage 105
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1933625	1939739	5597475	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675141.1|1933625_1935029_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	1.0e-32
WP_000137877.1|1935025_1935748_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1935938_1936271_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1936417_1937779_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001394463.1|1938108_1938426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032323936.1|1938839_1939739_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 106
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1948960	1952517	5597475		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|1948960_1949965_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011957.1|1949961_1950927_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|1950900_1951647_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|1951698_1952517_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
>prophage 107
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1963163	1965197	5597475	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|1963163_1965197_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 108
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	1977763	1989500	5597475	transposase	Enterobacteria_phage(50.0%)	11	NA	NA
WP_001292774.1|1977763_1978900_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001342301.1|1978896_1980897_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001171523.1|1981228_1981609_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1981605_1981953_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|1982002_1983388_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000950404.1|1983819_1984290_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|1984336_1985056_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001240401.1|1986958_1987690_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|1987749_1987857_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1987837_1988569_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569327.1|1988573_1989500_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 109
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2009833	2011354	5597475		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255042.1|2009833_2011354_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 110
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2015048	2018834	5597475		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2015048_2015717_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425428.1|2015974_2016811_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|2016842_2018834_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 111
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2022903	2023761	5597475		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|2022903_2023761_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 112
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2029034	2030191	5597475	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_106889256.1|2029034_2030191_-|transposase	IS3-like element IS600 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	4.0e-67
>prophage 113
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2039523	2043824	5597475		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848223.1|2039523_2040990_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_032323917.1|2041107_2042094_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001296828.1|2042132_2042846_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|2043257_2043824_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 114
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2049578	2161923	5597475	head,lysis,integrase,protease,terminase,tail,portal,transposase,holin	Enterobacteria_phage(36.14%)	121	2096929:2096947	2171138:2171156
WP_000194876.1|2049578_2051168_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|2051171_2051516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213360.1|2051848_2053039_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2053066_2053762_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|2053910_2055671_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|2055795_2056080_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|2056218_2057226_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
WP_001135667.1|2057407_2057635_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256205.1|2057654_2059415_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000101718.1|2059784_2061026_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	43.1	1.2e-98
WP_000387479.1|2061522_2061729_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001443784.1|2062412_2062973_+	host cell division inhibitor Icd-like protein	NA	Q8SBF3	Shigella_phage	45.5	9.0e-17
WP_001372127.1|2062962_2063184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204070.1|2063176_2063398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204970.1|2063399_2063633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2063638_2063938_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833625.1|2063934_2065335_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.1	1.6e-115
WP_000391151.1|2065911_2066106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018604.1|2066109_2066271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229487.1|2066398_2066887_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	4.6e-25
WP_000624042.1|2067049_2067973_+	hypothetical protein	NA	A0A0R6PHC6	Moraxella_phage	24.9	6.9e-14
WP_001113637.1|2071351_2071999_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_106889291.1|2073081_2073639_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_000982426.1|2073635_2075579_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001026418.1|2075575_2076055_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000186540.1|2076051_2076261_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001295447.1|2076257_2076995_-	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000971723.1|2077036_2077699_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000528376.1|2078330_2078933_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835177.1|2078942_2079392_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000013509.1|2079388_2080252_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091291.1|2080238_2080934_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778069.1|2080940_2083427_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000557378.1|2083423_2083687_-	chaperone NapD	NA	NA	NA	NA	NA
WP_000849214.1|2084578_2085067_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000758074.1|2085215_2086862_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000422231.1|2087079_2088723_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884922.1|2088798_2089449_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000786386.1|2089448_2090513_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406116.1|2090586_2091642_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865576.1|2091753_2092845_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.1	9.4e-119
WP_001249127.1|2093583_2096256_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001061917.1|2096272_2096923_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
2096929:2096947	attL	TGTAGGCCAGATAAGACGC	NA	NA	NA	NA
WP_000876014.1|2097008_2099858_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_001225855.1|2100132_2100909_-	YfaP family protein	NA	NA	NA	NA	NA
WP_001104541.1|2100913_2102563_-	DUF2300 domain-containing protein	NA	NA	NA	NA	NA
WP_001676637.1|2102563_2106958_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_001025664.1|2107759_2109082_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
WP_001448330.1|2109775_2110423_-	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	2.4e-37
WP_001023397.1|2110632_2110902_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	3.2e-44
WP_106889292.1|2110903_2112217_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	1.3e-77
WP_001230428.1|2112281_2112881_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_071829211.1|2112947_2113163_-	hypothetical protein	NA	A0A0P0ZCI5	Stx2-converting_phage	97.2	1.3e-32
WP_000099160.1|2113225_2114764_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_000612626.1|2114812_2115160_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2115156_2115561_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_032325348.1|2115589_2118889_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	94.9	0.0e+00
WP_000090884.1|2118949_2119582_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000194778.1|2119518_2120262_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	6.6e-148
WP_001152619.1|2120267_2120966_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847413.1|2120965_2121295_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.3e-52
WP_000082375.1|2121291_2123853_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.0	0.0e+00
WP_000533403.1|2123833_2124247_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479086.1|2124273_2124705_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|2124718_2125471_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|2125478_2125874_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|2125870_2126446_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|2126460_2126814_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|2126806_2127181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522643.1|2127232_2128117_-	hypothetical protein	NA	C6ZCY2	Enterobacteria_phage	54.1	6.5e-94
WP_000256849.1|2128174_2128522_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	1.5e-22
WP_001254039.1|2128558_2130064_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_001430223.1|2130053_2131646_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.1e-184
WP_000258991.1|2131642_2131849_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_024017589.1|2131832_2133761_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	2.7e-262
WP_000235436.1|2133732_2134242_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001427981.1|2134636_2134831_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000738423.1|2135190_2135484_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|2135574_2135757_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000075153.1|2135973_2136471_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	96.4	1.6e-89
WP_000284524.1|2136470_2136686_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|2136828_2137227_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|2137307_2137466_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|2137551_2138295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|2138547_2139171_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001028854.1|2139167_2139833_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223927.1|2139829_2140432_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	1.6e-91
WP_001108084.1|2140406_2140973_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001429269.1|2141460_2143296_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001254228.1|2143799_2143982_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_000153270.1|2143978_2144506_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000810176.1|2144502_2144949_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	92.6	3.4e-75
WP_000229807.1|2144956_2145163_-	hypothetical protein	NA	G8C7M4	Escherichia_phage	97.1	1.8e-26
WP_000145926.1|2145235_2145526_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788878.1|2145522_2146224_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_032325349.1|2146220_2147159_-	replication protein	NA	C1JJ53	Enterobacteria_phage	99.7	1.8e-171
WP_000035947.1|2147191_2147488_-	hypothetical protein	NA	A0A0N7C1W0	Escherichia_phage	96.9	1.3e-46
WP_000276885.1|2147597_2147783_-	hypothetical protein	NA	K7PHK4	Enterobacteria_phage	100.0	1.2e-26
WP_001095982.1|2147863_2148514_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	100.0	4.9e-123
WP_000256573.1|2148828_2149134_+	hypothetical protein	NA	K7PJM7	Enterobacteria_phage	99.0	7.0e-48
WP_000930321.1|2149136_2149475_+	hypothetical protein	NA	K7PJW2	Enterobacteria_phage	99.1	5.8e-59
WP_000167595.1|2149608_2150079_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065385.1|2150228_2150597_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	97.5	3.8e-64
WP_001198860.1|2150669_2150834_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000372926.1|2150802_2150967_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	98.1	3.2e-23
WP_000995439.1|2151021_2151318_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2151323_2152109_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|2152105_2152783_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|2152782_2152965_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|2152937_2153129_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|2153139_2153421_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763358.1|2153519_2153741_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_001289868.1|2153737_2154343_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	96.9	1.7e-45
WP_001345188.1|2154339_2154690_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	80.2	3.3e-33
WP_000457736.1|2154764_2155007_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	96.2	3.7e-36
WP_001281192.1|2155125_2155470_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001444001.1|2155575_2155794_+	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_000533670.1|2155771_2156842_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	98.0	1.1e-196
WP_001215756.1|2156856_2157462_-	DUF1175 domain-containing protein	NA	NA	NA	NA	NA
WP_000012302.1|2157458_2159147_-	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_001281242.1|2159295_2161923_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
2171138:2171156	attR	GCGTCTTATCTGGCCTACA	NA	NA	NA	NA
>prophage 115
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2167348	2173350	5597475		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075177.1|2167348_2169634_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|2169722_2170853_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|2170852_2171107_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|2171160_2171811_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|2172273_2173350_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 116
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2179243	2180146	5597475	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|2179243_2180146_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 117
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2183298	2188302	5597475		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|2183298_2183901_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001427556.1|2184208_2185348_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	5.0e-30
WP_000461661.1|2185351_2186320_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_000860259.1|2186319_2188302_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 118
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2224645	2227861	5597475		Salmonella_phage(50.0%)	3	NA	NA
WP_032165114.1|2224645_2225233_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	6.8e-07
WP_001012899.1|2225291_2227124_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|2227210_2227861_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 119
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2238420	2240281	5597475		Sodalis_phage(50.0%)	2	NA	NA
WP_000156114.1|2238420_2239311_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	4.0e-67
WP_001293612.1|2239507_2240281_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 120
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2244492	2246010	5597475		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|2244492_2246010_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 121
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2252486	2253623	5597475		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|2252486_2253623_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 122
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2262178	2263264	5597475		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|2262178_2263264_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 123
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2281137	2282070	5597475		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|2281137_2282070_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 124
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2290812	2293428	5597475	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001339397.1|2290812_2291490_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|2291489_2291837_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2291856_2293428_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 125
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2305754	2307016	5597475		Pseudomonas_phage(50.0%)	3	NA	NA
WP_000214413.1|2305754_2306240_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	4.0e-13
WP_001186773.1|2306255_2306732_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2306794_2307016_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 126
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2310486	2311920	5597475		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|2310486_2311920_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 127
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2318573	2326150	5597475		Hokovirus(50.0%)	4	NA	NA
WP_001443604.1|2318573_2322167_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|2322222_2323368_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|2323441_2324386_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|2324455_2326150_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 128
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2329841	2330762	5597475		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2329841_2330762_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 129
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2334580	2335315	5597475		Clostridioides_phage(100.0%)	1	NA	NA
WP_001341597.1|2334580_2335315_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	2.7e-13
>prophage 130
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2361007	2376377	5597475		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|2361007_2363023_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|2363093_2364080_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|2364309_2365071_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2365255_2366227_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2366610_2366868_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|2366912_2368640_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|2368680_2369190_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|2369231_2370083_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|2370187_2370556_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|2370558_2371470_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|2371603_2372701_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852685.1|2372690_2373566_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|2373565_2374399_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|2374398_2375415_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517439.1|2375585_2376377_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	8.9e-18
>prophage 131
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2379855	2384793	5597475		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|2379855_2381160_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|2381217_2382117_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|2382212_2382788_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001325675.1|2382848_2383298_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2383284_2383710_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|2383923_2384793_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 132
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2403346	2404297	5597475		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2403346_2404297_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 133
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2422342	2423056	5597475		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2422342_2423056_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 134
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2444307	2448309	5597475		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|2444307_2445597_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|2445682_2446309_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001341612.1|2446633_2447671_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|2447670_2448309_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 135
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2454743	2461040	5597475		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|2454743_2454917_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669403.1|2455230_2455746_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	6.5e-62
WP_000755172.1|2455761_2456301_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	99.4	9.9e-45
WP_000138282.1|2456395_2457973_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|2458041_2459508_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937895.1|2459669_2461040_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.0	2.6e-41
>prophage 136
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2469869	2470301	5597475		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2469869_2470301_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 137
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2480186	2486643	5597475		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|2480186_2481470_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|2481647_2481848_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|2481859_2482195_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|2482196_2484047_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|2484063_2484579_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2484674_2484998_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2485014_2485401_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2485428_2486643_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 138
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2501936	2503448	5597475		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493455.1|2501936_2503448_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	9.6e-13
>prophage 139
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2509213	2520521	5597475		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|2509213_2510467_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883122.1|2510794_2511985_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2512029_2512368_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|2512428_2513763_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215888.1|2513752_2514466_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001341630.1|2514630_2516058_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.9e-16
WP_000970107.1|2516633_2520521_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	9.1e-132
>prophage 140
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2524640	2524901	5597475		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|2524640_2524901_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 141
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2528359	2532101	5597475		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|2528359_2529040_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2529311_2530286_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|2530301_2532101_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 142
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2537003	2757456	5597475	head,tRNA,integrase,holin,protease,terminase,tail,portal,transposase,capsid	Enterobacteria_phage(26.88%)	228	2699371:2699386	2756733:2756748
WP_001298974.1|2537003_2537741_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2537872_2539207_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001341633.1|2539415_2540297_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2540399_2540987_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2541042_2541426_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|2541730_2542420_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|2542467_2543505_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2543711_2544131_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001341635.1|2544199_2544898_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000083007.1|2544929_2547590_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2547703_2549059_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2549104_2549428_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2549424_2550723_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2556575_2559149_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|2559278_2560010_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079094.1|2560006_2560987_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2561121_2561859_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2562129_2562471_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2562574_2562622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200116.1|2562720_2563881_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2563923_2565045_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168054.1|2565055_2566126_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
WP_000976004.1|2566335_2566701_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2566850_2567369_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969036.1|2567358_2568585_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|2568600_2569083_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2569159_2569507_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2569548_2570316_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2570346_2570895_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2570913_2571162_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460032.1|2571410_2572772_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2572938_2573730_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2573750_2575037_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2575091_2575685_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2575807_2576686_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2576771_2578433_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2578581_2578923_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2578984_2579275_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2579264_2579741_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_032324018.1|2579872_2580355_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	1.5e-28
WP_000938111.1|2582109_2583471_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	4.3e-52
WP_032324038.1|2583847_2587249_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.3	1.0e-219
WP_001301673.1|2587840_2590189_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2590208_2590298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|2590404_2590674_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_000268987.1|2590675_2591989_-|tail	tail fiber protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	4.8e-77
WP_001228241.1|2592053_2592653_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_085948186.1|2593168_2594324_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_032325365.1|2594365_2597461_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	97.0	0.0e+00
WP_122996338.1|2597699_2598332_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_062896255.1|2598277_2599021_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	3.3e-147
WP_001341641.1|2599031_2599730_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|2599729_2600071_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_106889295.1|2600063_2603306_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2603357_2603567_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2603662_2604037_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2604042_2604759_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2604827_2605172_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2605168_2605615_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_048970963.1|2605611_2605962_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	99.1	7.8e-59
WP_000125984.1|2605971_2606298_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063096.1|2608824_2609046_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_106875433.1|2609090_2611028_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.1	0.0e+00
WP_033816804.1|2611091_2612753_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2612749_2613313_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_000279801.1|2613604_2613970_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.9	2.3e-61
WP_000095732.1|2614011_2614212_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	95.5	3.7e-29
WP_000828072.1|2614343_2614670_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	3.4e-56
WP_106889296.1|2615015_2615507_-	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.4	2.2e-83
WP_085948186.1|2615545_2616701_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_071529499.1|2617072_2617258_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	1.3e-17
WP_001280922.1|2617480_2617612_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	90.7	8.5e-11
WP_000661712.1|2617706_2618402_-	phage antirepressor protein	NA	Q5MBW0	Stx1-converting_phage	99.1	2.8e-124
WP_000087733.1|2618675_2619209_-	lysozyme	NA	G9L6J6	Escherichia_phage	100.0	1.0e-102
WP_001072901.1|2619213_2619429_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
WP_001290230.1|2619506_2619752_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143463.1|2619792_2619972_-	DUF1378 family protein	NA	Q5MBW3	Stx1-converting_phage	100.0	4.4e-26
WP_106889297.1|2620107_2622045_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	99.2	0.0e+00
WP_000752026.1|2622544_2622814_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|2622823_2623771_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_032324021.1|2624277_2624712_-	antitermination protein	NA	Q5MBW8	Stx1-converting_phage	100.0	4.8e-82
WP_000144759.1|2624704_2624899_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_085948186.1|2624975_2626131_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_001303849.1|2626405_2626624_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|2626601_2627675_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_000818472.1|2630584_2631658_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|2631705_2631879_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|2631868_2632099_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|2632073_2632262_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|2632272_2632485_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|2632770_2632983_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001295358.1|2633424_2633730_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247610.1|2633836_2634481_+	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001038062.1|2634477_2635224_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742345.1|2635223_2637320_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001295357.1|2637365_2638505_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|2638492_2638939_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208650.1|2638958_2641139_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_001300464.1|2641253_2642552_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_000270305.1|2642631_2642724_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460810.1|2642736_2643873_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_071527988.1|2643884_2645381_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000063972.1|2646416_2646815_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003671.1|2646811_2647399_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186421.1|2647395_2648103_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107384.1|2648121_2649915_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2649911_2651030_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_071528025.1|2652147_2652759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001023445.1|2652883_2653153_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_032271866.1|2654531_2655155_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.9	8.7e-69
WP_032325372.1|2655223_2658706_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	94.8	0.0e+00
WP_158707842.1|2658941_2659574_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.3	6.5e-104
WP_000194707.1|2659519_2660263_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	99.2	1.2e-149
WP_001443841.1|2660273_2660972_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	97.4	4.4e-130
WP_000847298.1|2660971_2661301_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533442.1|2663889_2664303_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479051.1|2664329_2664752_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235067.1|2664765_2665518_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683137.1|2665525_2665921_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	92.4	3.7e-65
WP_032325339.1|2665917_2666496_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	85.9	8.6e-79
WP_000752994.1|2666507_2666861_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158897.1|2666872_2667268_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.4e-56
WP_000063258.1|2667309_2668335_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	98.8	5.1e-191
WP_001365129.1|2668390_2668723_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	5.5e-54
WP_000123251.1|2668732_2670052_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	7.6e-232
WP_001415980.1|2670032_2671634_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.3e-307
WP_000198153.1|2671630_2671837_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2671833_2673759_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2673733_2674279_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_000736383.1|2674603_2674828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106889298.1|2675615_2676149_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.2	3.6e-100
WP_001063217.1|2676274_2676595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024219893.1|2676574_2677243_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.5	3.7e-65
WP_000411805.1|2677246_2677453_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_106889299.1|2677900_2679751_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_032273331.1|2680546_2681605_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	3.1e-199
WP_000917733.1|2681755_2681953_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_001064906.1|2682166_2682856_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	5.5e-56
WP_024221875.1|2682852_2683212_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	8.0e-35
WP_057762880.1|2683224_2684274_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	1.3e-109
WP_001342259.1|2684275_2684548_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	47.5	5.2e-10
WP_001012717.1|2684718_2685597_-	type II restriction endonuclease NgoMIV	NA	NA	NA	NA	NA
WP_001427299.1|2685610_2686729_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.7	1.7e-35
WP_001278450.1|2686923_2687028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032325214.1|2687143_2687767_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	91.4	1.5e-76
WP_000951710.1|2687763_2687973_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	94.2	8.8e-34
WP_024174960.1|2687974_2688163_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	95.2	1.2e-29
WP_000935420.1|2688392_2688605_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_009453172.1|2688655_2689012_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	1.1e-57
WP_106889300.1|2689069_2689465_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	3.8e-30
WP_106889301.1|2689480_2690251_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.1	5.3e-76
WP_000139447.1|2690284_2690746_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_140395314.1|2690738_2691770_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	70.4	2.4e-87
WP_000693921.1|2691838_2692264_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261756.1|2692260_2692488_-	cell division protein	NA	NA	NA	NA	NA
WP_000444611.1|2692587_2693232_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	6.1e-09
WP_000380316.1|2693505_2693658_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394543.1|2693669_2694308_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	3.3e-07
WP_001133037.1|2694308_2694518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2695085_2695274_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2695270_2695462_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_009448824.1|2695555_2698006_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.1e-58
WP_000273151.1|2698073_2698316_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|2698293_2699313_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
2699371:2699386	attL	TAATACCTTGATTTTT	NA	NA	NA	NA
WP_095585410.1|2699595_2699748_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.4	4.3e-14
WP_000938124.1|2700124_2701486_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	40.2	1.5e-49
WP_001023483.1|2701940_2702210_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.2e-43
WP_000381395.1|2702247_2703819_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2703838_2704186_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2704185_2704863_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001228241.1|2706295_2706895_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.0	2.4e-100
WP_106889302.1|2706962_2710436_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	97.6	0.0e+00
WP_122996338.1|2710671_2711304_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.1	4.9e-104
WP_062896255.1|2711249_2711993_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	3.3e-147
WP_001341641.1|2712003_2712702_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	97.4	7.6e-130
WP_000807927.1|2712701_2713043_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	98.2	4.3e-62
WP_106889295.1|2713035_2716278_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2716329_2716539_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|2716634_2717009_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|2717014_2717731_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|2717799_2718144_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|2718140_2718587_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|2718583_2718934_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|2718943_2719270_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063099.1|2721796_2722018_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_032325321.1|2722062_2723841_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	90.1	0.0e+00
WP_032323913.1|2723904_2725566_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000958380.1|2725562_2726126_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_025380422.1|2726414_2726780_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	5.8e-65
WP_000095736.1|2726821_2727049_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_085948186.1|2727535_2728692_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_047091958.1|2728994_2729180_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.3	1.3e-17
WP_000992122.1|2729698_2730232_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.3	2.8e-100
WP_000731236.1|2730282_2730627_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000284519.1|2730631_2730847_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_001290231.1|2730923_2731196_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143462.1|2731236_2731416_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_032212763.1|2731551_2733489_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	96.7	0.0e+00
WP_001131907.1|2735522_2736071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|2736083_2736425_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001379493.1|2736442_2737432_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	7.3e-195
WP_024220650.1|2737439_2738249_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	97.8	4.5e-150
WP_000767117.1|2738268_2738658_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|2738654_2738981_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|2738977_2739631_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|2739630_2740125_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|2740121_2741063_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|2741052_2741232_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|2741407_2741959_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|2741951_2742212_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|2742309_2743002_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|2743321_2743837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|2744307_2744670_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081319.1|2744735_2745560_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	5.0e-149
WP_000008174.1|2745688_2746225_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	99.4	2.8e-100
WP_032323952.1|2746215_2747094_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	94.5	1.2e-169
WP_032323951.1|2747090_2747294_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.2e-30
WP_000476199.1|2747286_2747526_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	3.7e-36
WP_000034210.1|2747522_2747852_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	37.5	1.1e-25
WP_000206753.1|2747853_2748717_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	53.6	3.2e-69
WP_000457722.1|2748801_2749044_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	82.5	1.8e-30
WP_000557643.1|2749047_2749194_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	90.9	1.7e-20
WP_000516611.1|2749366_2750542_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.2	4.6e-204
WP_001431537.1|2751024_2751933_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	100.0	2.3e-171
WP_001341819.1|2752231_2753461_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2753499_2753916_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214985.1|2753987_2755736_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	100.0	0.0e+00
WP_000577251.1|2755737_2757456_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	100.0	6.5e-308
2756733:2756748	attR	TAATACCTTGATTTTT	NA	NA	NA	NA
>prophage 143
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2764027	2768152	5597475		Klosneuvirus(50.0%)	4	NA	NA
WP_001087606.1|2764027_2765308_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_001325764.1|2765618_2767019_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|2767039_2767702_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|2767702_2768152_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 144
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2772086	2777382	5597475		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2772086_2772332_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|2772328_2772739_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246514.1|2772711_2774856_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	7.1e-195
WP_000777938.1|2774865_2775825_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	5.9e-133
WP_000985494.1|2776179_2777382_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 145
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2790340	2795900	5597475	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2790340_2790526_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|2790760_2793391_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140519.1|2793518_2794019_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2794261_2795323_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|2795402_2795900_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 146
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2801366	2802332	5597475		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|2801366_2802332_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 147
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2809905	2810919	5597475		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001341827.1|2809905_2810919_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	3.9e-26
>prophage 148
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2830376	2837516	5597475		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|2830376_2832938_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141347.1|2833043_2833700_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.2	5.6e-50
WP_001297141.1|2833750_2834518_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2834713_2835622_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2835618_2836881_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2836877_2837516_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 149
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2842730	2846446	5597475		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|2842730_2843723_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|2843785_2844925_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2845064_2845691_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2845684_2846446_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 150
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2849558	2851591	5597475		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|2849558_2850164_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090394.1|2850163_2851591_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	3.7e-30
>prophage 151
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2880821	2885741	5597475		Vibrio_phage(33.33%)	5	NA	NA
WP_001199970.1|2880821_2881493_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|2881631_2881772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268451.1|2881785_2882658_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|2882717_2884016_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2884103_2885741_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 152
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2889773	2893888	5597475		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046800.1|2889773_2891075_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_032323900.1|2891131_2893888_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 153
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2901421	2902270	5597475		Vibrio_phage(100.0%)	1	NA	NA
WP_000100393.1|2901421_2902270_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 154
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2907128	2907884	5597475		Bacillus_phage(100.0%)	1	NA	NA
WP_106889303.1|2907128_2907884_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.9e-09
>prophage 155
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2919410	2940291	5597475	tRNA	Bacillus_phage(22.22%)	14	NA	NA
WP_001299897.1|2919410_2920616_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
WP_000184265.1|2920615_2921059_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|2921109_2921916_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|2921992_2923090_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001341841.1|2923675_2924623_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.9	6.9e-17
WP_001066231.1|2924694_2925291_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	33.5	1.8e-23
WP_000350900.1|2925259_2926468_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000810575.1|2926467_2928048_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
WP_000582832.1|2928079_2928904_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000016907.1|2929163_2930417_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|2930648_2931980_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775978.1|2932041_2933868_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	2.0e-25
WP_001285982.1|2933867_2937410_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	2.6e-08
WP_001138192.1|2937402_2940291_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	6.9e-68
>prophage 156
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2945767	2952540	5597475		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2945767_2946562_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2946568_2947444_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|2947594_2949841_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2949853_2950384_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|2951068_2951758_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2951826_2952540_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 157
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2962172	2964667	5597475		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2962172_2963591_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603508.1|2963905_2964667_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 158
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	2989385	2999702	5597475	integrase,transposase	Stx2-converting_phage(42.86%)	8	2987342:2987358	2996426:2996442
2987342:2987358	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_000381395.1|2989385_2990957_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2990976_2991324_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|2991323_2992001_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000082600.1|2992395_2993124_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	41.2	7.1e-14
WP_000852869.1|2994031_2994691_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	33.9	3.6e-33
WP_000935135.1|2994683_2996291_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.0	4.3e-11
WP_000023788.1|2996532_2997753_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2996426:2996442	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
WP_106889306.1|2997860_2999702_-	hypothetical protein	NA	A0A1Q1N989	Escherichia_phage	26.5	4.6e-33
>prophage 159
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3007644	3010814	5597475		Sodalis_phage(50.0%)	4	NA	NA
WP_001273866.1|3007644_3008196_+	recombinase family protein	NA	Q2A092	Sodalis_phage	44.4	5.4e-30
WP_001232281.1|3008848_3009169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001570270.1|3009202_3009409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272558.1|3010058_3010814_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 160
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3035091	3050483	5597475	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|3035091_3036492_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|3036509_3037826_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|3037861_3039229_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|3039264_3039753_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001345944.1|3039752_3041672_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3042107_3043556_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|3043557_3043683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3043679_3043751_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192827.1|3043805_3044354_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003086.1|3044396_3045914_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	7.7e-87
WP_001701073.1|3045923_3047022_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813220.1|3047112_3048846_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|3048851_3049562_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3049586_3050483_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 161
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3054407	3059775	5597475		Pandoravirus(50.0%)	3	NA	NA
WP_001341859.1|3054407_3055841_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.3e-30
WP_000951964.1|3055897_3056641_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195029.1|3056901_3059775_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	4.8e-263
>prophage 162
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3068303	3069536	5597475		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3068303_3069536_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 163
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3087542	3088220	5597475		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|3087542_3088220_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 164
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3109221	3110376	5597475		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3109221_3110376_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 165
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3136206	3140587	5597475	integrase	Pseudomonas_phage(50.0%)	2	3128732:3128745	3138169:3138182
3128732:3128745	attL	ATTTTGAACGCTTT	NA	NA	NA	NA
WP_032324717.1|3136206_3137472_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.1	6.9e-81
WP_001223345.1|3138496_3140587_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
3138169:3138182	attR	ATTTTGAACGCTTT	NA	NA	NA	NA
>prophage 166
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3156679	3157852	5597475		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524974.1|3156679_3157852_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	2.5e-40
>prophage 167
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3181344	3182229	5597475		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3181344_3182229_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 168
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3188306	3199129	5597475		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|3188306_3189134_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|3189333_3190260_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3190310_3190568_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3190610_3192830_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|3192940_3194353_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|3194427_3195165_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281899.1|3195397_3197656_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.1e-84
WP_000183500.1|3198201_3198684_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|3198736_3199129_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 169
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3202956	3213918	5597475		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3202956_3204849_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3204877_3205459_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444756.1|3205458_3206286_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3206310_3206733_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3206733_3207363_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_106889307.1|3207567_3209049_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3209196_3209868_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3209873_3211034_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188373.1|3211071_3211887_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3212002_3212776_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3212833_3213004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3213264_3213918_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 170
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3223434	3224868	5597475		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_106889308.1|3223434_3224868_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	1.5e-39
>prophage 171
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3230005	3231244	5597475	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708470.1|3230005_3231244_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.3	1.7e-92
>prophage 172
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3237626	3253811	5597475	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|3237626_3238640_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3238877_3239093_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918826.1|3239203_3240949_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3241143_3242985_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3243063_3243570_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065885.1|3243823_3244588_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018000.1|3244864_3245488_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094682.1|3245641_3247162_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000627213.1|3247468_3248959_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.8e-33
WP_000450589.1|3249000_3249333_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|3249551_3250535_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082879.1|3250718_3253811_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	5.9e-158
>prophage 173
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3266227	3267193	5597475		Escherichia_phage(100.0%)	1	NA	NA
WP_032323880.1|3266227_3267193_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	32.7	3.0e-36
>prophage 174
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3293195	3295490	5597475		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032323879.1|3293195_3295490_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	1.8e-156
>prophage 175
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3303477	3304623	5597475		Streptococcus_phage(100.0%)	1	NA	NA
WP_001297158.1|3303477_3304623_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 176
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3327630	3335423	5597475		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809253.1|3327630_3328491_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249157.1|3328554_3330591_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246855.1|3330548_3330944_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|3330963_3331554_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|3331563_3332139_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147635.1|3332252_3333293_-	permease	NA	NA	NA	NA	NA
WP_001298741.1|3333365_3334001_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|3334128_3334647_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449041.1|3334626_3335070_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189314.1|3335120_3335423_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 177
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3342529	3344419	5597475		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|3342529_3344419_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 178
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3349899	3356537	5597475		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|3349899_3352572_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031055.1|3352596_3354084_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3354111_3354564_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|3355193_3356537_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 179
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3360619	3361468	5597475		Pandoravirus(100.0%)	1	NA	NA
WP_000764731.1|3360619_3361468_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 180
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3370119	3371596	5597475		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|3370119_3371091_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3371317_3371596_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 181
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3375664	3390457	5597475		Staphylococcus_phage(25.0%)	16	NA	NA
WP_000438245.1|3375664_3376474_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|3376683_3377661_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3377674_3378661_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030018.1|3378681_3379248_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	6.5e-55
WP_000030537.1|3379244_3379820_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3379788_3380346_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3380352_3381078_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|3381125_3382559_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3382581_3382869_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3382986_3383478_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3383523_3384378_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3384374_3384647_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|3384859_3385492_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3385488_3386217_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000809774.1|3387095_3389432_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001176896.1|3389527_3390457_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 182
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3400383	3401874	5597475		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|3400383_3401874_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 183
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3405579	3406077	5597475	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3405579_3406077_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 184
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3410043	3412568	5597475	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|3410043_3411411_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3411500_3412568_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 185
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3429064	3430108	5597475		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3429064_3430108_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 186
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3440150	3444663	5597475		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000132907.1|3440150_3441650_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	5.8e-18
WP_001341904.1|3441710_3442601_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275535.1|3442636_3443491_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|3443832_3444663_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 187
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3450000	3450885	5597475		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|3450000_3450885_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 188
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3457389	3462855	5597475	transposase	uncultured_Mediterranean_phage(33.33%)	4	NA	NA
WP_000738579.1|3457389_3458415_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_085948178.1|3458926_3460139_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001297685.1|3460985_3462089_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078339.1|3462096_3462855_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 189
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3473191	3474663	5597475	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114986.1|3473191_3473701_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
WP_000004477.1|3473715_3474663_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	3.2e-06
>prophage 190
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3494540	3500114	5597475		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|3494540_3495725_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|3495795_3497910_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|3498006_3498477_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3498573_3498948_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|3499073_3499361_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|3499368_3499728_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|3499727_3500114_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 191
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3505684	3515224	5597475		Tupanvirus(25.0%)	8	NA	NA
WP_000634798.1|3505684_3507598_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000907085.1|3508612_3508831_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|3508884_3509754_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|3509808_3510213_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|3510514_3511147_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|3511197_3513288_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|3513354_3514575_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601850.1|3514660_3515224_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	3.5e-61
>prophage 192
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3539449	3540286	5597475		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3539449_3540286_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 193
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3557262	3561029	5597475		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|3557262_3558885_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253689.1|3558960_3560313_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3560309_3561029_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 194
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3567592	3568471	5597475		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|3567592_3568471_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 195
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3574440	3576834	5597475		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3574440_3576834_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 196
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3581213	3582440	5597475		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105463.1|3581213_3582440_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.0	3.4e-133
>prophage 197
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3591669	3594117	5597475		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3591669_3594117_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 198
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3614157	3615968	5597475		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073591.1|3614157_3614901_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	1.9e-09
WP_000907790.1|3614897_3615968_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 199
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3619508	3620991	5597475		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|3619508_3620222_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|3620223_3620991_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 200
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3626724	3629543	5597475		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|3626724_3627579_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042001.1|3627823_3628882_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|3628874_3629543_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 201
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3632549	3636681	5597475		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|3632549_3633176_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106580.1|3633249_3635448_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.1	1.9e-118
WP_000130621.1|3635549_3635795_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|3636015_3636681_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 202
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3644574	3650226	5597475		Bacillus_virus(50.0%)	3	NA	NA
WP_000173630.1|3644574_3645381_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|3645386_3645788_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_069358362.1|3645990_3650226_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.9	2.1e-25
>prophage 203
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3653601	3656337	5597475		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149160.1|3653601_3656337_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 204
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3669942	3671985	5597475		Indivirus(100.0%)	1	NA	NA
WP_001341942.1|3669942_3671985_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	2.0e-45
>prophage 205
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3675330	3677365	5597475		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000008957.1|3675330_3675684_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000065769.1|3676939_3677365_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 206
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3682246	3682894	5597475		Bacillus_virus(100.0%)	1	NA	NA
WP_001341943.1|3682246_3682894_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 207
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3731354	3732338	5597475		Planktothrix_phage(100.0%)	1	NA	NA
WP_001196495.1|3731354_3732338_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 208
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3749367	3751701	5597475		Escherichia_phage(100.0%)	1	NA	NA
WP_000013916.1|3749367_3751701_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 209
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3755355	3755568	5597475		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3755355_3755568_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 210
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3759791	3760787	5597475		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182671.1|3759791_3760787_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	1.6e-11
>prophage 211
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3766105	3767647	5597475		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146482.1|3766105_3767647_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 212
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3791833	3801970	5597475		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_000582492.1|3791833_3793678_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	6.7e-16
WP_000779792.1|3795162_3795771_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000015217.1|3795999_3800121_+	RHS element protein RhsA	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	4.6e-25
WP_000072850.1|3800141_3800984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001346013.1|3801136_3801970_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 213
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3823775	3834516	5597475		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|3823775_3824027_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|3824168_3824600_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|3824844_3826389_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|3826398_3827682_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483865.1|3827685_3828645_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|3828631_3829666_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|3829916_3830942_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|3830951_3832148_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_001307464.1|3832422_3833295_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|3833583_3834516_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 214
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3846447	3851010	5597475		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|3846447_3846927_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|3846965_3847775_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3847872_3848040_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3848060_3848297_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|3848513_3849182_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|3849353_3850574_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|3850554_3851010_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 215
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3854383	3861134	5597475		Morganella_phage(25.0%)	6	NA	NA
WP_001297374.1|3854383_3855208_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_000924289.1|3855499_3856117_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032323841.1|3856113_3857796_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.5	1.1e-22
WP_001295237.1|3858053_3858677_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3858731_3859007_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|3859025_3861134_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 216
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3866255	3867647	5597475		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3866255_3867647_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 217
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3873788	3887121	5597475	integrase,transposase	Enterobacteria_phage(66.67%)	15	3873606:3873628	3887606:3887628
3873606:3873628	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218979.1|3873788_3874958_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.1	1.7e-198
WP_000119815.1|3874977_3876837_+	DEAD/DEAH box helicase family protein	NA	A0A097BY72	Enterococcus_phage	22.4	1.8e-13
WP_000186475.1|3876833_3877259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446132.1|3877586_3878159_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|3878232_3878733_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283024.1|3878729_3879464_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	5.7e-128
WP_001149160.1|3880015_3880282_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_106889314.1|3880278_3880878_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	1.3e-50
WP_001244665.1|3880870_3881158_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459320.1|3881150_3881606_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	6.1e-64
WP_000381395.1|3881681_3883253_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_106889315.1|3883272_3883620_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	2.2e-45
WP_001339397.1|3883619_3884297_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000856729.1|3884452_3884773_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783645.1|3884787_3887121_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
3887606:3887628	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 218
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3893763	3895098	5597475		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3893763_3895098_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 219
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3902520	3911682	5597475		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_106889316.1|3902520_3904209_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	7.9e-56
WP_001315912.1|3904314_3904413_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|3904977_3905067_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|3905485_3906670_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148063.1|3906677_3907175_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3907171_3907534_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3907523_3907871_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|3907980_3908430_+	membrane protein	NA	NA	NA	NA	NA
WP_000828487.1|3908476_3909970_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.2	5.5e-29
WP_001087147.1|3909966_3911682_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 220
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3918035	3918989	5597475		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|3918035_3918464_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3918575_3918989_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 221
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3923416	3924565	5597475		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3923416_3924565_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 222
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3929271	3936640	5597475		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3929271_3931686_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|3931714_3932788_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3932787_3933888_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059106.1|3933892_3935296_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|3935592_3935673_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|3935902_3936043_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3936059_3936419_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3936382_3936640_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 223
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3946838	3948176	5597475		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|3946838_3948176_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 224
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3959166	3963007	5597475		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|3959166_3959940_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|3960030_3960921_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3960920_3961880_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3961966_3963007_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 225
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3968537	3971899	5597475		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_106889317.1|3968537_3970367_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	1.5e-132
WP_000933736.1|3970528_3971899_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 226
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3983850	3984843	5597475		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|3983850_3984843_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 227
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	3988011	3993864	5597475		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102345.1|3988011_3989880_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|3990046_3990466_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387752.1|3990473_3991979_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|3991983_3992949_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3992973_3993864_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 228
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4007254	4008901	5597475		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012624.1|4007254_4008901_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.2e-66
>prophage 229
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4017374	4022786	5597475		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|4017374_4019396_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001299253.1|4019442_4020927_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047503.1|4021060_4022326_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	7.0e-41
WP_001280776.1|4022456_4022786_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 230
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4026828	4032972	5597475		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866672.1|4026828_4027959_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
WP_000006625.1|4027955_4029218_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226587.1|4029217_4030285_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
WP_000676056.1|4030303_4031185_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|4031162_4031837_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|4031841_4032972_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 231
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4049281	4052082	5597475		Salmonella_phage(100.0%)	2	NA	NA
WP_000678272.1|4049281_4050607_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.3e-07
WP_001300182.1|4050603_4052082_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
>prophage 232
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4055125	4058984	5597475		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4055125_4056022_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213590.1|4056021_4056738_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383411.1|4056821_4058984_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
>prophage 233
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4066469	4068299	5597475		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|4066469_4068299_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 234
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4080711	4083998	5597475		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|4080711_4082352_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|4082430_4082700_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4082703_4083219_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4083221_4083998_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 235
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4092788	4093403	5597475		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|4092788_4093403_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 236
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4107083	4109870	5597475		uncultured_virus(100.0%)	1	NA	NA
WP_000250057.1|4107083_4109870_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.3e-71
>prophage 237
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4113948	4116419	5597475		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|4113948_4115358_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4115369_4116419_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 238
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4131368	4134148	5597475		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718893.1|4131368_4132265_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621656.1|4132432_4133329_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|4133362_4134148_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 239
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4144300	4147351	5597475		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4144300_4147351_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 240
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4163175	4168070	5597475		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_001297064.1|4163175_4163796_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_032324508.1|4165185_4165860_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4166001_4167375_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4167371_4168070_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 241
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4179642	4184145	5597475		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|4179642_4180488_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4180912_4181158_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4181242_4181728_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4181820_4182747_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|4182813_4184145_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 242
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4189782	4193967	5597475		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000015408.1|4189782_4193967_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.0e-24
>prophage 243
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4208236	4208899	5597475		Synechococcus_phage(100.0%)	1	NA	NA
WP_000424845.1|4208236_4208899_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
>prophage 244
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4213185	4215483	5597475		Serratia_phage(100.0%)	1	NA	NA
WP_000184877.1|4213185_4215483_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 245
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4232518	4234363	5597475		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591366.1|4232518_4234363_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 246
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4242866	4245919	5597475		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|4242866_4243817_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|4244734_4245919_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 247
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4250035	4258364	5597475		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|4250035_4254064_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|4254140_4258364_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 248
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4267580	4269344	5597475		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|4267580_4268252_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940105.1|4268294_4268885_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|4269071_4269344_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 249
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4274712	4276302	5597475		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|4274712_4276302_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 250
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4291673	4295357	5597475		Dickeya_phage(100.0%)	1	NA	NA
WP_000096066.1|4291673_4295357_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 251
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4307238	4308030	5597475		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|4307238_4308030_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 252
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4324036	4325152	5597475		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4324036_4325152_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 253
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4334366	4334975	5597475		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4334366_4334975_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 254
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4341565	4344131	5597475		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|4341565_4342981_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147329.1|4343033_4344131_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.1	2.4e-29
>prophage 255
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4348320	4351933	5597475		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|4348320_4351143_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|4351396_4351933_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 256
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4355750	4357100	5597475		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|4355750_4357100_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 257
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4362685	4364644	5597475		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|4362685_4364644_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 258
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4373925	4376073	5597475		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|4373925_4376073_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 259
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4381318	4383304	5597475		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001066006.1|4381318_4383304_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 260
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4387280	4387961	5597475		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000611428.1|4387280_4387961_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 261
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4394433	4395222	5597475		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|4394433_4395222_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 262
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4400063	4401566	5597475		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|4400063_4401566_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 263
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4422762	4425974	5597475	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|4422762_4424280_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856834.1|4424516_4425974_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
>prophage 264
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4432974	4433553	5597475		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000491535.1|4432974_4433553_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	78.1	8.6e-79
>prophage 265
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4444327	4445866	5597475		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723928.1|4444327_4445866_-	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	28.9	2.0e-10
>prophage 266
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4481138	4482128	5597475		Salmonella_phage(100.0%)	1	NA	NA
WP_000953025.1|4481138_4482128_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	6.3e-98
>prophage 267
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4486047	4526573	5597475	protease,integrase,transposase	Stx2-converting_phage(30.77%)	32	4479899:4479915	4518119:4518135
4479899:4479915	attL	ATCCAGCGCCTGACGGA	NA	NA	NA	NA
WP_071830505.1|4486047_4487667_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
WP_032325301.1|4487663_4489235_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	2.2e-294
WP_001218841.1|4489351_4490617_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_001188520.1|4490996_4491572_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068905.1|4491608_4493306_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883338.1|4493281_4493620_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|4493735_4495037_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|4495154_4496591_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|4496927_4497404_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|4497419_4498676_-	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001026276.1|4498951_4499245_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4499288_4500935_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|4501072_4501426_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000399685.1|4501678_4502659_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001387276.1|4505722_4505776_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_032323928.1|4505960_4506908_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	3.5e-13
WP_001297258.1|4507026_4508448_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001341327.1|4508497_4510153_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187778.1|4510546_4512685_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106238.1|4512843_4513308_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	1.1e-52
WP_000839179.1|4513743_4514148_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4514144_4514492_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|4514540_4516079_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
WP_001162171.1|4516383_4517736_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166267.1|4517829_4518381_+	ribosome-associated protein	NA	NA	NA	NA	NA
4518119:4518135	attR	TCCGTCAGGCGCTGGAT	NA	NA	NA	NA
WP_001219792.1|4518536_4519910_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4520085_4521084_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596015.1|4521116_4522112_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|4522098_4523121_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205813.1|4523134_4524637_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_000265933.1|4524776_4525733_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4526042_4526573_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 268
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4548573	4550404	5597475	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_032325300.1|4548573_4549782_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	2.4e-208
WP_072097616.1|4549789_4550404_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	1.8e-42
>prophage 269
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4564071	4565235	5597475		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943991.1|4564071_4565235_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 270
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4569166	4582198	5597475	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|4569166_4571608_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4571646_4572072_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4572276_4573575_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4573678_4573876_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4573957_4574962_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4574964_4576224_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460361.1|4576309_4577590_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4577666_4577975_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280349.1|4578060_4579011_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122520.1|4579003_4580851_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_000990321.1|4580860_4582198_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 271
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4586234	4586780	5597475		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|4586234_4586780_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 272
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4594763	4595741	5597475		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4594763_4595741_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 273
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4600661	4601195	5597475		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|4600661_4601195_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 274
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4605268	4668788	5597475	tRNA,integrase,transposase	Stx2-converting_phage(46.15%)	60	4614072:4614087	4646214:4646229
WP_000399648.1|4605268_4606249_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000047539.1|4606525_4606912_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4606984_4607446_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4607458_4608394_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4608397_4608532_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230273.1|4608812_4609208_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500687.1|4609338_4610052_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|4610122_4610716_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583470.1|4610860_4611313_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_001074121.1|4611435_4612947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012897.1|4613131_4614145_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
4614072:4614087	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000002953.1|4614306_4614723_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|4614768_4615272_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000416407.1|4616714_4619570_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|4619569_4620013_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4620366_4621878_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|4622144_4623245_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4623244_4624327_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001332879.1|4624445_4625948_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_000061768.1|4626077_4627097_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000772685.1|4627540_4628803_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.3	2.8e-74
WP_000356577.1|4629046_4629886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000091133.1|4630025_4631612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|4631901_4632579_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4632578_4632926_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4632945_4634517_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000221529.1|4635256_4635826_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271003.1|4635991_4636393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|4636380_4636815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4637169_4637550_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|4637546_4637894_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|4637943_4639329_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_159026387.1|4639567_4640926_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000555341.1|4641658_4641916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283626.1|4643667_4644189_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4644185_4645139_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_106889324.1|4645225_4647550_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
4646214:4646229	attR	TCAACAGCCTGCTGCA	NA	NA	NA	NA
WP_000879164.1|4647594_4648497_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_106889325.1|4648493_4649492_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|4649488_4650445_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4650445_4651213_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4651770_4652028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227281.1|4653381_4653954_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4654002_4654827_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000016235.1|4655732_4658066_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_000842358.1|4658080_4658404_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001014979.1|4658400_4658625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761643.1|4658624_4659173_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.8	5.9e-29
WP_001084853.1|4659169_4659430_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	4.6e-24
WP_000214377.1|4660344_4661097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991130.1|4661093_4661648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185332.1|4661649_4661922_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	46.9	8.3e-08
WP_000381395.1|4662231_4663803_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|4663822_4664170_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|4664169_4664847_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001344112.1|4664914_4665091_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_077221339.1|4665724_4666003_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000839179.1|4666452_4666857_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4666853_4667201_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099160.1|4667249_4668788_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.8	3.9e-296
>prophage 275
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4681013	4682275	5597475		Pseudomonas_phage(50.0%)	3	NA	NA
WP_000849588.1|4681013_4681499_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001186774.1|4681514_4681991_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|4682053_4682275_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 276
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4685903	4686884	5597475		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000991415.1|4685903_4686884_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	6.1e-101
>prophage 277
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4690246	4691923	5597475		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|4690246_4690849_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|4691326_4691923_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 278
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4701050	4702511	5597475		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208222.1|4701050_4702511_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	2.8e-49
>prophage 279
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4709080	4709635	5597475		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151863.1|4709080_4709635_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.0	6.0e-37
>prophage 280
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4717135	4718080	5597475	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181189.1|4717135_4718080_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	5.0e-60
>prophage 281
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4724642	4728611	5597475		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001341289.1|4724642_4726112_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_032323778.1|4726178_4728611_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 282
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4745220	4746885	5597475		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919568.1|4745220_4746885_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 283
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4757499	4758779	5597475		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|4757499_4758237_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|4758239_4758779_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 284
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4766705	4769581	5597475		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|4766705_4768295_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4768687_4769293_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4769419_4769581_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 285
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4775620	4776943	5597475		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|4775620_4776943_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 286
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4783686	4789041	5597475		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093813.1|4783686_4784919_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046749.1|4785225_4786893_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409443.1|4787103_4789041_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 287
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4792324	4794438	5597475		Bacillus_phage(50.0%)	2	NA	NA
WP_001188663.1|4792324_4793014_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219614.1|4793013_4794438_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 288
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4806207	4815275	5597475		Cyanophage(20.0%)	9	NA	NA
WP_000130189.1|4806207_4807161_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|4807275_4807863_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|4807896_4808463_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|4808611_4809325_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|4809350_4809755_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|4810131_4812048_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4812136_4813267_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|4813370_4813580_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681360.1|4814108_4815275_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 289
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4822316	4825133	5597475	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286856.1|4822316_4825133_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 290
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4829539	4830688	5597475		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4829539_4830688_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 291
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4836158	4841819	5597475		Hepacivirus(50.0%)	4	NA	NA
WP_000351348.1|4836158_4837712_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	2.1e-31
WP_000349932.1|4837785_4839003_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|4839131_4840274_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|4840304_4841819_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 292
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4849714	4852467	5597475		Bacillus_phage(50.0%)	4	NA	NA
WP_000624375.1|4849714_4850194_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000998542.1|4850214_4850394_+	antitoxin	NA	NA	NA	NA	NA
WP_000796358.1|4850994_4851594_-	DUF4291 domain-containing protein	NA	NA	NA	NA	NA
WP_000257163.1|4851618_4852467_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 293
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4860211	4865634	5597475		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|4860211_4863118_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035672.1|4863282_4865634_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.6	6.0e-38
>prophage 294
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4871966	4872665	5597475		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|4871966_4872665_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 295
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4885367	4887092	5597475		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|4885367_4887092_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 296
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4914344	4915388	5597475		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4914344_4915388_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 297
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4919633	4920185	5597475		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|4919633_4920185_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 298
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4928812	4930237	5597475		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4928812_4930237_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 299
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4937886	4944354	5597475		Mamastrovirus(33.33%)	5	NA	NA
WP_001189601.1|4937886_4939437_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001341254.1|4939483_4941874_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4942079_4942616_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4942656_4943319_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|4943427_4944354_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 300
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4947616	4948519	5597475		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|4947616_4948519_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 301
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4958425	4965231	5597475	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|4958425_4959844_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|4959882_4960809_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4960845_4961301_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|4961478_4962183_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|4962197_4962728_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001369168.1|4962801_4965231_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	2.3e-40
>prophage 302
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4970410	4971208	5597475		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|4970410_4971208_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 303
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4977119	4977464	5597475		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4977119_4977464_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 304
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	4995410	4996169	5597475		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001341242.1|4995410_4996169_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.7	2.2e-26
>prophage 305
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5004997	5005594	5597475		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000569430.1|5004997_5005594_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
>prophage 306
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5023349	5024381	5597475		Planktothrix_phage(100.0%)	1	NA	NA
WP_106889330.1|5023349_5024381_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 307
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5034689	5038891	5597475		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_000644685.1|5034689_5036048_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|5036119_5036875_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326291.1|5036908_5037631_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|5037627_5038095_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|5038159_5038891_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
>prophage 308
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5049367	5052151	5597475		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614344.1|5049367_5052151_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	3.1e-81
>prophage 309
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5065549	5069462	5597475		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|5065549_5066128_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|5066333_5067101_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|5067071_5067812_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032183258.1|5067967_5068255_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|5068242_5068503_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543897.1|5068688_5069462_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
>prophage 310
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5083330	5086288	5597475		Hokovirus(50.0%)	2	NA	NA
WP_000859525.1|5083330_5083726_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_001143094.1|5083843_5086288_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
>prophage 311
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5109523	5110690	5597475		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001399806.1|5109523_5110690_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	1.2e-31
>prophage 312
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5115366	5119078	5597475		Streptococcus_phage(66.67%)	3	NA	NA
WP_000749860.1|5115366_5116422_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	3.5e-118
WP_001285288.1|5116709_5117813_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|5117824_5119078_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
>prophage 313
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5127148	5128304	5597475	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948186.1|5127148_5128304_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
>prophage 314
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5144726	5148031	5597475		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001299025.1|5144726_5145596_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	9.3e-53
WP_001299021.1|5145755_5146349_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|5146360_5146597_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046293.1|5146705_5148031_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 315
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5153606	5164082	5597475	holin	Catovirus(33.33%)	5	NA	NA
WP_001159100.1|5153606_5155277_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.3e-60
WP_000089072.1|5155290_5156763_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001295527.1|5156776_5157364_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|5157492_5159526_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001341217.1|5160098_5164082_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	2.5e-124
>prophage 316
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5176075	5177560	5597475		Bacillus_virus(100.0%)	1	NA	NA
WP_000447335.1|5176075_5177560_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
>prophage 317
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5188988	5194685	5597475		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010284.1|5188988_5190875_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076236.1|5191213_5192473_+	cytosine permease	NA	NA	NA	NA	NA
WP_001299008.1|5192462_5193746_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_000952485.1|5193785_5194685_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 318
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5198525	5202805	5597475		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177914.1|5198525_5201600_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.9	0.0e+00
WP_000805913.1|5201722_5202805_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	99.2	1.8e-191
>prophage 319
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5208215	5210176	5597475		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044328.1|5208215_5209166_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	6.6e-36
WP_001013499.1|5209162_5210176_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 320
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5213354	5214464	5597475		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|5213354_5214464_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 321
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5219761	5220529	5597475		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939373.1|5219761_5220529_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 322
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5224155	5225317	5597475	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085948193.1|5224155_5225317_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	8.9e-51
>prophage 323
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5228756	5229914	5597475		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830745.1|5228756_5229914_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 324
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5237329	5238445	5597475		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|5237329_5238445_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 325
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5242734	5252706	5597475		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|5242734_5243646_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219321.1|5243770_5244679_+	fructokinase	NA	NA	NA	NA	NA
WP_001342329.1|5244821_5246006_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698929.1|5246131_5249275_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|5249271_5250474_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000198399.1|5250663_5251353_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893609.1|5251410_5252706_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	2.9e-26
>prophage 326
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5259658	5268638	5597475	tRNA	uncultured_Mediterranean_phage(60.0%)	9	NA	NA
WP_000667301.1|5259658_5260786_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	1.4e-88
WP_000007629.1|5260808_5261141_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|5261168_5263016_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|5263026_5263998_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|5264126_5264474_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|5264650_5265535_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000543535.1|5266522_5266972_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150472.1|5266975_5268079_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_001021161.1|5268167_5268638_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 327
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5292470	5297517	5597475	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|5292470_5293094_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|5293219_5294494_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|5294681_5297036_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|5297244_5297517_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 328
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5300645	5301341	5597475		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|5300645_5301341_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 329
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5304664	5308211	5597475		Bacillus_phage(100.0%)	2	NA	NA
WP_001235581.1|5304664_5306437_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	2.0e-49
WP_001256174.1|5306429_5308211_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.4e-42
>prophage 330
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5317046	5320196	5597475		Leptospira_phage(100.0%)	1	NA	NA
WP_001132475.1|5317046_5320196_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 331
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5328483	5337045	5597475		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|5328483_5329035_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|5329163_5331095_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|5331147_5331477_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|5331476_5332082_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678194.1|5332191_5334066_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|5334246_5334891_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250125.1|5335126_5336089_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|5336085_5337045_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 332
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5345288	5348248	5597475		Escherichia_phage(50.0%)	2	NA	NA
WP_001342071.1|5345288_5345630_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	2.1e-40
WP_000078269.1|5345743_5348248_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
>prophage 333
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5352787	5353465	5597475		Bacillus_virus(100.0%)	1	NA	NA
WP_001157532.1|5352787_5353465_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	3.1e-27
>prophage 334
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5356601	5364339	5597475		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|5356601_5357288_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561851.1|5357284_5359699_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_106889334.1|5360127_5364339_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	44.6	1.3e-22
>prophage 335
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5369597	5371379	5597475		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001342079.1|5369597_5371379_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 336
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5377568	5378714	5597475		Streptococcus_phage(100.0%)	1	NA	NA
WP_001315307.1|5377568_5378714_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
>prophage 337
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5390133	5457693	5597475	head,tRNA,lysis,integrase,protease,terminase,tail,portal,transposase,capsid	Enterobacteria_phage(58.62%)	79	5400294:5400340	5449167:5449213
WP_000912342.1|5390133_5391519_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.0e-45
WP_001143540.1|5391554_5392076_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|5392183_5392396_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|5392397_5393264_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|5393744_5394287_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988363.1|5394506_5395199_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000701359.1|5395229_5397839_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|5397817_5398858_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255226.1|5398868_5399384_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|5399386_5400019_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
5400294:5400340	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_106889335.1|5400353_5401517_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	2.6e-199
WP_000446905.1|5401372_5401744_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|5401715_5401994_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|5402041_5402260_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_001443983.1|5402358_5402640_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|5402650_5402842_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|5402814_5402997_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|5402993_5403674_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|5403670_5404456_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|5404461_5404758_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000206913.1|5404833_5405124_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	82.4	2.5e-26
WP_001444023.1|5405590_5405911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|5406046_5406310_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_000858975.1|5406391_5407081_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|5407185_5407416_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182773.1|5407485_5408025_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_001342088.1|5408111_5409041_+	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	4.4e-109
WP_000788789.1|5409037_5409739_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	3.8e-129
WP_000152742.1|5409943_5410291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|5411043_5411652_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|5411951_5412368_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|5412346_5412748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|5412871_5412973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|5412969_5413425_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|5413424_5413595_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|5413587_5413878_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|5413874_5414237_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971074.1|5414233_5414374_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204791.1|5414459_5414843_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737278.1|5415031_5416114_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	80.6	7.8e-166
WP_000839596.1|5416702_5416918_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_032325290.1|5416917_5417415_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	1.6e-89
WP_001228695.1|5417631_5417814_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|5417904_5418198_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001427981.1|5418557_5418752_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	7.4e-27
WP_000453558.1|5419140_5419686_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027295.1|5419660_5421586_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|5421582_5421789_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001444138.1|5421785_5423387_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	8.5e-310
WP_000381395.1|5423859_5425431_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|5425450_5425798_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|5425797_5426475_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000088640.1|5426515_5427394_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.0	1.7e-147
WP_001345004.1|5427403_5427736_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063244.1|5427791_5428817_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.8e-188
WP_000158868.1|5428858_5429254_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000752961.1|5429265_5429640_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	8.0e-62
WP_000985132.1|5429630_5430209_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683110.1|5430205_5430601_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_001342267.1|5430608_5431349_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.0e-129
WP_000479169.1|5431364_5431787_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	3.1e-70
WP_000459457.1|5431768_5432203_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840236.1|5432195_5434757_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.1	0.0e+00
WP_032324072.1|5434753_5435083_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	2.6e-56
WP_001152557.1|5435082_5435781_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	3.4e-130
WP_000090884.1|5436465_5437098_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	8.5e-96
WP_000515439.1|5437158_5440572_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|5440642_5441242_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_000279150.1|5441306_5444267_+	membrane protein	NA	A0A2D1UII2	Escherichia_phage	98.3	3.0e-58
WP_000885569.1|5444266_5444851_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|5444905_5445574_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937502.1|5445630_5445936_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	2.8e-12
WP_001226384.1|5446119_5447604_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|5447790_5448744_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177453.1|5449256_5450018_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
5449167:5449213	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|5450200_5451091_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001375368.1|5451091_5454064_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383941.1|5454050_5456288_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420938.1|5456556_5457693_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 338
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5464539	5469299	5597475		Ralstonia_phage(33.33%)	3	NA	NA
WP_032325246.1|5464539_5466441_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	8.6e-27
WP_000253805.1|5467177_5468626_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	3.9e-11
WP_000770953.1|5468615_5469299_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 339
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5472569	5475713	5597475		Leptospira_phage(100.0%)	1	NA	NA
WP_106889337.1|5472569_5475713_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.2	7.5e-60
>prophage 340
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5487140	5493183	5597475		Tupanvirus(50.0%)	3	NA	NA
WP_000077704.1|5487140_5491022_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	3.8e-61
WP_000096713.1|5491237_5492371_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_001005919.1|5492367_5493183_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 341
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5507722	5509545	5597475		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502941.1|5507722_5508352_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029833.1|5508324_5509545_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	1.0e-57
>prophage 342
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5512654	5514769	5597475		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|5512654_5514220_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|5514340_5514769_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 343
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5530192	5530840	5597475		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|5530192_5530402_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|5530456_5530840_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 344
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5535655	5538095	5597475		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|5535655_5536867_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231415.1|5537006_5538095_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 345
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5545105	5547688	5597475	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|5545105_5547688_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 346
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5554626	5558159	5597475		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367892.1|5554626_5556297_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.7	4.0e-76
WP_001207522.1|5556380_5557316_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|5557433_5558159_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 347
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5566055	5567135	5597475		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|5566055_5567135_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 348
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5571231	5572896	5597475		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|5571231_5572896_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 349
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5577522	5581336	5597475	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|5577522_5579469_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|5579671_5581336_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 350
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5585485	5586250	5597475		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|5585485_5586250_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 351
NZ_CP027338	Escherichia coli strain 2014C-3051 chromosome, complete genome	5597475	5592905	5593583	5597475		Bacillus_phage(100.0%)	1	NA	NA
WP_032323908.1|5592905_5593583_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	1.5e-26
>prophage 1
NZ_CP027339	Escherichia coli strain 2014C-3051 plasmid unnamed, complete sequence	92644	7975	81376	92644	transposase,integrase,protease	Stx2-converting_phage(39.13%)	58	18127:18186	86175:88881
WP_001443774.1|7975_8206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000422675.1|11330_11807_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	90.7	3.0e-45
WP_000937603.1|15785_16973_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000091308.1|16972_17338_-	hypothetical protein	NA	NA	NA	NA	NA
18127:18186	attL	CCGTAAGCGCACCGTGAAGGACGTGGGGTAAAAATTAGTTTACAGATTGAGTGACATTCC	NA	NA	NA	NA
WP_106881567.1|18160_19729_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.8	1.1e-157
WP_000631725.1|19732_20080_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_001341423.1|20076_20751_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_001341442.1|20804_21032_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	100.0	6.2e-33
WP_000361610.1|21194_22172_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_086163899.1|24155_24254_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.5e-07
WP_101981703.1|24362_24575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387727.1|24562_26572_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_071527595.1|26707_27004_+	cytochrome B562	NA	NA	NA	NA	NA
WP_085948186.1|27370_28526_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000445934.1|29231_29627_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000921957.1|29626_30586_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	5.4e-62
WP_077249722.1|30858_31761_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032324142.1|32144_32828_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.1e-28
WP_001443814.1|32827_33046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274418.1|33057_33492_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001341455.1|33536_34019_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|34015_34735_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_032313270.1|35011_35329_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	55.8	4.5e-05
WP_000117628.1|35790_36291_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_001677351.1|37274_37451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247865.1|37543_37810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038351.1|37874_38765_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	4.4e-66
WP_077776889.1|38788_39010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148286.1|39040_39292_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_106889346.1|39350_39629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341408.1|39867_40716_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_106889343.1|40812_41136_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_001291056.1|41367_41700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991402.1|41711_44432_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_085953672.1|45738_46952_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	7.1e-168
WP_136138333.1|46950_47364_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_000112000.1|47661_47919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106889344.1|48166_52069_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	7.2e-238
WP_136139077.1|53006_53426_-	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001341423.1|53356_54031_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000631725.1|54027_54375_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.9	9.2e-44
WP_106889345.1|54378_55947_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	55.6	4.3e-157
WP_000937603.1|56225_57413_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001344870.1|57363_57777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612591.1|58013_58361_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_012917688.1|58410_59949_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	1.9e-295
WP_000550559.1|61325_63047_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|63140_64247_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|64246_65068_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000987096.1|71275_73396_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.6e-45
WP_001213545.1|73399_74839_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_085948186.1|75316_76473_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_106889347.1|76524_76872_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001164205.1|77044_77827_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_001261287.1|78802_79033_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|79029_79446_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001165114.1|79607_80153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948186.1|80220_81376_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
86175:88881	attR	GGAATGTCACTCAATCTGTAAACTAATTTTTACCCCACGTCCTTCACGGTGCGCTTACGGGCAATCAGTCTGCCGGTGCGGTGTACGAGAGGACATGTCAGCAGCAGGCAAAGTGGTGCAAGGAGAATGTTCGGGGCAGGAGCCTGCAGCAGATGAATAATAAGACCCTGCAGGAGAATGCCGGATATACCAAAAAAACCTGCCAGCATACAGAGGACGATCAGCAGGGGGATCCGTCCGATGTTCAGCCAGTCCAGCGCCTCTCCTGTCAGCCCCTCCGGTAAATCAGGTGTATCCATAGCTGAAGAGAGGGAGTGTCCGCAGAGCAGGGCGATAAGTTCAGCGATACCAGTAAGCAGAACAAAAGTCAGGGCTGCCAGATAGGGTACGTTATACGCGGTAAGTAACGTCAGTGTCATTTTTCCTCCTGTGGCAGGTCAGTCAAACAACATTATGGCGTGAAGCTTCCGCTTCTTTAATTGTCAGAAGAAGCATATCGTCAGTCATCAGAAGACAAGGGGATGTCTGCAGGAGGGGATGATAACAACTGAAGCCTCACGCCGGAATGCGCTTTATGACAACCGGAGAGGACGGATAATAAAAAATGGGACATCCACATCAGCAAACCGCGATTTGCGAAAAAAAGTCAGCGGAGAGTGGCTGCCGTTGTGGCTGTCCCGGTATTTCAGTGTAACAGGTGATTGCTGTGATCTATGCCCCATTCGGCTTTCGGTAAACCTGAATGCCCCACATGAAGAATGCGTGACAGCATGTTTCTGCCGCTGCCGTTCAGGCTGCATTCGCGTCCGTGCGCGAGTATAAAACCTTCATCCCGGAATATCTCTTCCACTTCTGAAGATTCGAGGGATGCCGGATGAATTAATGAAAATGCCACCGGTCTGAGCATTCTGCCCGTGGTGGAAAAGGTGTCTCTGGTACTGTTCAGCTGCAGGATATGACGTTTACCTGTTTGCGCACGGGAAAGTGTCTCACTCAGCAGCTGGTCGTTCCATGCGCACGTGCCAATCTGCCATCCCAGACTTCTGCACGCGGAAAGAGCCGAGCGGAAGCGGTACAGGTCGTATAATGCTGCGTTATTGCCACTTTCCAGCAGTGATTTCAGCGTATTTGCTACCGGTATGTCCGTATTGGTGGCCAGCAGTTTTCGCAGAGTCGTAAACTCTTCTGCCATTCCTCTGAATGCGCTCATCTGACGCGCAGATTCAAGCCAGTTCAGCAGGTAACGCCGGCGACGCCGTTCGTTGTTGATACTGTCCGGGGCGGTGGAGAGTGCTTCGAGCATATTCTCCAGTAACAGAATGACAGGGTTTTCCAGGGATAGAATGGTCATAAAGGCGTCCTGAAAAAATGCCCGACAGCCGCTCTCCGTACACCGTAAGGTGTCACCGGTGCCGGGCATTGTGGAAACAGAAGGAAAAAAAATCCCGGCCATAAAGGCCGGGAAAAGTCGTCAAATTAAGACAGCAATTTTCATGTCAACGCTCCGTCATCAGATACCAGGTGCAGGAGCAGGGCGATCCTCGACTCCGGCAGAGGCGGTGCATCAAGCCGGAGGAGGTACTGGTAACGCGCTTTTGTCAGCCAGAGGGTGGAGGCAGCATCCAGCTCCTCCCTGGCTGCCGGATTGAGCGCAGGATCCGGGTACACTTTCATCAAAGACTGAACGATATCCTCCCTGACGGTTTTGATTTCACCGGCCATTTTCACGAAGTTCAGAAAGGCACTGTGACGGCGAAGGTGAGTGAAGCTGTGGCGTTCGGGGTCTGCTTTCAGGAAAAAGTAACCGGGAAACACGGCGTGTATATGTCGACGGTAACCGCAGACTTTATCCGTGCGGCGGACTTTTTTCAGTATCAGGGGTGTCCAGGGAAGGACGTGTTGTTCGGAAAGCCAGGAAAAGAGATGTTCGCGGTTTTTGCCGGCAGGGATGTACTGAGCCAGATACCAGTTGCGTTGATGTAATTCTCTGATATTCAAAATCCGGAACGCTCCGCGAAAATCGATCCCCGCAGAGGGGCTTCGATGTTGTTGTGAACGGCGAATACATAAAGCATGTGTCGGAAACAGCGGCTGATCCTCGTTCAGCCCGGCCTGCAGTTCTGACAGGCACATGATTTACGCACTCTTGTAAGCCTTGTGGACGGTTTCGAGGCCGGCGAAAACCGACAAAACCTGCAAACAGGATTAATGGCTGGCAAACATATTACATAAGGATATATCTGTGGCAAGAGCGAAGATAAGTAGTTAAATAGATCGTTATATTTGATAAAGCAGCATATTACGCTGGGTTGTGTGAGGTGTTTGGATGATTAGATCGTAGATCGTAGATCGTAATCACAAGATCGATTCATCCAAAAAACATGAAAAACACAGCATAAAAGATCGTTTGTGGAATTGTCTATTTTTTGACACAGTTCAAAAAAACGACGTTTTTTAGGTGGTTAATGAGAGGCCTGGTAAATCAGAGAAATCGTGTTGGCTTTTCAAAGCGGTGGAAAAGGGGTATATTGCGGATCGTTATGCAGTGGCTTTTGGGATCGTCAGGATCCGGGAAGTCAGAAAATGGCTGGATGCGCCATAAGGCATTCAGGACGTATGGCAGAAACGACGGCAGTTTGCCGGTGCCGGAAGGCTGAAAAAAGTTTCAGAAGGCCATAAAAGGAAAACCCCCATAATCTTCTCATCG	NA	NA	NA	NA
